ID: 1023142559

View in Genome Browser
Species Human (GRCh38)
Location 7:37116829-37116851
Sequence GAAAAGTACTACATGTGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023142557_1023142559 -9 Left 1023142557 7:37116815-37116837 CCTGGGTCATCCTAGAAAAGTAC 0: 1
1: 4
2: 5
3: 5
4: 75
Right 1023142559 7:37116829-37116851 GAAAAGTACTACATGTGCCTCGG No data
1023142556_1023142559 5 Left 1023142556 7:37116801-37116823 CCATGGAAAGGCAGCCTGGGTCA 0: 1
1: 0
2: 1
3: 28
4: 284
Right 1023142559 7:37116829-37116851 GAAAAGTACTACATGTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023142559 Original CRISPR GAAAAGTACTACATGTGCCT CGG Intronic
No off target data available for this crispr