ID: 1023142710

View in Genome Browser
Species Human (GRCh38)
Location 7:37118208-37118230
Sequence CTTAATGCACAGAGGCTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023142700_1023142710 25 Left 1023142700 7:37118160-37118182 CCCTTAGTTTATTTTAAAGTCTT 0: 1
1: 0
2: 5
3: 69
4: 777
Right 1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1023142703_1023142710 -5 Left 1023142703 7:37118190-37118212 CCTCCACCAGCACCCTGCCTTAA 0: 1
1: 0
2: 4
3: 47
4: 366
Right 1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1023142704_1023142710 -8 Left 1023142704 7:37118193-37118215 CCACCAGCACCCTGCCTTAATGC 0: 1
1: 0
2: 0
3: 30
4: 221
Right 1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG 0: 1
1: 0
2: 0
3: 8
4: 98
1023142701_1023142710 24 Left 1023142701 7:37118161-37118183 CCTTAGTTTATTTTAAAGTCTTG 0: 1
1: 0
2: 3
3: 35
4: 418
Right 1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG 0: 1
1: 0
2: 0
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023142710 Original CRISPR CTTAATGCACAGAGGCTACT TGG Intronic
905222242 1:36456187-36456209 CCGAATGCACAGAGCCTTCTTGG + Exonic
906949965 1:50326620-50326642 CCTCGTGCGCAGAGGCTACTGGG + Intergenic
911061568 1:93752287-93752309 CCTAATGCAGAGGGGCTAGTTGG - Intronic
918176813 1:182053941-182053963 CTGAATGGACAGACTCTACTGGG + Intergenic
919513117 1:198490993-198491015 CTGAATGCAGGGAGGCTCCTGGG + Intergenic
921606783 1:217165337-217165359 GTAAATGCACAGAGGCAAGTTGG + Intergenic
1063900834 10:10730890-10730912 CATAATGAGCAGAGTCTACTGGG + Intergenic
1064023163 10:11825428-11825450 CTTAGAGCACAGAGGCACCTAGG - Intronic
1064348540 10:14555761-14555783 CTGAAGGCACAGAGCCTCCTGGG - Intronic
1065631462 10:27685175-27685197 CTTTATTGACAGAGGTTACTTGG - Intronic
1073712040 10:106054588-106054610 GTCACTTCACAGAGGCTACTTGG + Intergenic
1078902083 11:15650895-15650917 TTTAATGCTCAGAGGCTGCCAGG - Intergenic
1084726356 11:70944950-70944972 CTTACTGCACTGAGGATATTAGG + Intronic
1084755688 11:71237197-71237219 CTTATTGCCCACTGGCTACTTGG - Intronic
1085732940 11:79014599-79014621 CTTCATGCACAGAGGCCACCAGG + Intronic
1086066857 11:82754716-82754738 CTAAATGCACCGAAGATACTAGG + Intergenic
1091451624 12:575781-575803 CTTCAGGCACAGTGGCTTCTGGG + Intronic
1091701821 12:2668438-2668460 CCTAATACACAGAGGATGCTGGG - Intronic
1091819414 12:3463998-3464020 CTTTATGCACAGAAGATACGGGG + Intronic
1092533602 12:9365685-9365707 CTTCATGCACAGAAGTTACAGGG - Intergenic
1101797414 12:107988229-107988251 CTTAATGAGCAGGAGCTACTGGG + Intergenic
1110983889 13:81939175-81939197 CTGAATTCACAGGGCCTACTGGG + Intergenic
1111011883 13:82324922-82324944 CTTAATGGACAGAGTGTACTGGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1113147882 13:107229008-107229030 CTTAAACCACAGAGGATAATCGG - Intronic
1115675761 14:35671855-35671877 GTTATTGCACAGAAGCAACTAGG - Intronic
1116847174 14:49875734-49875756 CTTAATGATTACAGGCTACTAGG + Intergenic
1117989327 14:61418403-61418425 ATTAATGCACAGAGGATCTTTGG + Intronic
1118164297 14:63321012-63321034 GTTAATGGGAAGAGGCTACTTGG + Intergenic
1120514938 14:85459526-85459548 CTTAATGCTCTGAGGCTCCCCGG - Intergenic
1121704675 14:95982649-95982671 TGTAATGAACAGAGGGTACTGGG - Intergenic
1122912201 14:104836365-104836387 CCCTGTGCACAGAGGCTACTGGG - Intergenic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1128556208 15:68633594-68633616 CCTCATGCACAGAGCTTACTTGG - Intronic
1129681782 15:77662287-77662309 CTTAGTGCTCAGAGGCCCCTTGG - Intronic
1133477838 16:6140555-6140577 GTGAATGAACAGAGGATACTTGG - Intronic
1145224161 17:21114048-21114070 CTGAAGGTACAGAGGCTACCTGG - Intergenic
1145406180 17:22597803-22597825 CTTATAGCACAGAGGCTATATGG + Intergenic
1146899629 17:36574830-36574852 CCCTGTGCACAGAGGCTACTGGG - Intronic
1146978866 17:37140969-37140991 CCCCATGCACAGAGGCTACTGGG - Intronic
1149102302 17:52921588-52921610 CTAAATGCACAGAAGCTTTTAGG - Intergenic
1153994193 18:10425587-10425609 CTCAATGCACAGGGGCCAGTGGG - Intergenic
1155646450 18:28084156-28084178 CTAAAAGCTCAGAGGCTAATAGG - Intronic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1158144946 18:54301701-54301723 CTTAATTCACAGAGACTGCTGGG + Intronic
1160742016 19:690796-690818 CCCCATGCACAGAGGCTACTGGG + Intronic
1161731644 19:5964458-5964480 CTTAGTGCACAGTGGGTGCTGGG - Intronic
1162674029 19:12284792-12284814 CCTCGTGCGCAGAGGCTACTGGG + Intronic
929153616 2:38770243-38770265 CTTAATGCACACAGCCTGATTGG - Intronic
931199372 2:60082435-60082457 CTTAAAGCACAGAAGCTGTTTGG - Intergenic
932759813 2:74431765-74431787 CTTACTCCACTGAGGCTGCTAGG - Intronic
938208797 2:129447018-129447040 CTTAATGCAGGGAGTCTAATGGG - Intergenic
939027638 2:137032999-137033021 CTTATTAAACAGAGGATACTGGG + Intronic
939850968 2:147304185-147304207 CATAATGCACAGTGACTGCTTGG - Intergenic
943054215 2:182955743-182955765 TTTAATGCACACAGTGTACTGGG + Intronic
944644325 2:201763183-201763205 CCCCGTGCACAGAGGCTACTGGG + Intronic
944972524 2:205010322-205010344 GTTCATGCACAGAGGCTGCAAGG - Intronic
946334806 2:219029583-219029605 CTCAATCCACAGGGGCTGCTCGG + Exonic
946366087 2:219249907-219249929 CATAATGCACAGAGGAGCCTGGG + Exonic
1173262754 20:41451336-41451358 CTTAATCCTCACAGGGTACTTGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1181616143 22:24055816-24055838 CTGAGTGCTCAGAGGGTACTGGG + Intronic
1181729454 22:24834034-24834056 CATAGTGAGCAGAGGCTACTGGG - Intronic
1184251035 22:43260470-43260492 CTTGAGCCACAGAGGCTGCTTGG + Intronic
1184938654 22:47743840-47743862 CAAAATGCACAGAGGCAATTTGG + Intergenic
950171130 3:10839710-10839732 TGCAATGCCCAGAGGCTACTGGG - Intronic
951576013 3:24114849-24114871 CTTATTACACAGAATCTACTTGG + Intergenic
951961103 3:28321643-28321665 CTTAATTCAGAAAGGCTACTTGG - Exonic
955795960 3:62637220-62637242 CTTAATGGGGAGAAGCTACTTGG + Intronic
959877326 3:111399896-111399918 TTCAATGCACAGAGACTCCTGGG + Intronic
961495490 3:127288189-127288211 ATTTATGCACAGGGGCTTCTCGG - Intergenic
961538816 3:127586820-127586842 CTTGAGGCACAGAGGCCAGTGGG + Intronic
962385874 3:134932262-134932284 CTGAATGCACAGCTGCTGCTTGG + Intronic
964249029 3:154688922-154688944 CATGATGCTCAGAGGCTAGTGGG + Intergenic
967266989 3:187699803-187699825 TTACATGCACAGAGGCCACTTGG + Intronic
967365585 3:188682859-188682881 CCTAATGCACACAGGAAACTAGG + Intronic
972227258 4:37027308-37027330 CTTAATTCACAGTAGCTATTGGG - Intergenic
978364890 4:107970851-107970873 CTTATAGCACAGAGCCTATTTGG + Intergenic
978490374 4:109305280-109305302 CTTGATGCAGAGAGTCTACCAGG - Intergenic
980595753 4:134952559-134952581 CCCCGTGCACAGAGGCTACTGGG - Intergenic
980700721 4:136425616-136425638 CTGGATGCACAAAGGTTACTTGG - Intergenic
981316946 4:143349646-143349668 CCCCGTGCACAGAGGCTACTGGG - Intronic
982905923 4:161070511-161070533 CTTAATGAAAAGAGGCAACTAGG + Intergenic
988268665 5:28985654-28985676 CTAGATGGACAGAGGCTTCTTGG - Intergenic
993558712 5:89376082-89376104 CTAAATGTACAGAGGCAAGTAGG + Intergenic
1003156241 6:3597798-3597820 CTTAGTACACAAAGGCTAGTGGG + Intergenic
1004023714 6:11798711-11798733 GTGAATGCACAGAGCGTACTGGG - Intronic
1004164896 6:13248176-13248198 CTTAATGAACAGAGCCATCTGGG + Intronic
1007643669 6:43363903-43363925 CCCTGTGCACAGAGGCTACTGGG + Intronic
1007669397 6:43539193-43539215 CCCCGTGCACAGAGGCTACTAGG - Intronic
1008962764 6:57282652-57282674 CTTTATGCAAAGAGGATATTAGG + Intergenic
1011323604 6:86124565-86124587 CTTAATGTAAAGCGGCTCCTGGG - Intergenic
1023142710 7:37118208-37118230 CTTAATGCACAGAGGCTACTTGG + Intronic
1033280368 7:140002226-140002248 CTCAATGGACAGAGCCTCCTTGG + Intronic
1035531579 8:356398-356420 CTAGAGGCACAGAGGCTACCTGG + Intergenic
1043277573 8:78419184-78419206 CTTTAAGCAAAGAGTCTACTAGG - Intergenic
1045182381 8:99798354-99798376 TTTAATGCACAGAGCATATTTGG + Intronic
1045971035 8:108080645-108080667 CTTAATGCAGAGATGCTGTTTGG - Intronic
1047625042 8:126647726-126647748 CTTCATGCCCAGAGGATACATGG - Intergenic
1050284015 9:4081913-4081935 CATAATGAACAGTGGCTTCTAGG - Intronic
1052534789 9:29732715-29732737 CTTAATGCACAGTGCCACCTTGG - Intergenic
1055582792 9:77725533-77725555 TATAATGCACAGAGGAAACTTGG - Intronic
1058023608 9:100117123-100117145 CCCCGTGCACAGAGGCTACTGGG - Intronic
1060458177 9:123820413-123820435 CTGAATGCAGAGAGGCCACATGG + Intronic
1190567915 X:51749977-51749999 CTAAACCCACAGAAGCTACTTGG - Intergenic
1197526105 X:127565446-127565468 CCTAATGCACAGTAGGTACTAGG + Intergenic
1200217985 X:154376978-154377000 CTTAGTACACAGAGGCCTCTGGG + Intergenic