ID: 1023149566

View in Genome Browser
Species Human (GRCh38)
Location 7:37188836-37188858
Sequence TCATGGAAGGCTCAGTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023149566 Original CRISPR TCATGGAAGGCTCAGTCATG GGG (reversed) Intronic
901910612 1:12454648-12454670 CCCTGGAAACCTCAGTCATGAGG - Intronic
901919354 1:12525414-12525436 TCCAGGAAGGGTCAGTGATGGGG + Intergenic
902547316 1:17198205-17198227 ACATGGAAGGCTGAGGCAGGAGG + Intergenic
904228523 1:29045865-29045887 ACATGGAAGGCTGAGGCAGGAGG + Intronic
904359315 1:29961693-29961715 TCATGTAAGGCTCAGGCTTTGGG + Intergenic
905099881 1:35510713-35510735 TCTTGGGAGGCTGAGTCAGGAGG - Intronic
905576364 1:39047954-39047976 TCATGCAAGGATGAGTGATGCGG + Intergenic
906792812 1:48673747-48673769 GCAAGGAAGGGTCAGTCATGAGG + Intronic
907254096 1:53165105-53165127 TCCTGGAAGGCTGAGGCAGGAGG + Intergenic
909324623 1:74334757-74334779 TCATGGCAGCTTCAGTCATATGG - Intronic
910927995 1:92415975-92415997 TCTTGGAAAGCTGAGTCAGGAGG + Intergenic
915494985 1:156275921-156275943 ACATGGAAGGCTGAGGCAGGAGG - Intronic
916452844 1:164937772-164937794 TGAGGGAAGGCACAGGCATGAGG - Intergenic
916457012 1:164981464-164981486 ACATGGCAGGCTTAGTGATGTGG + Intergenic
917409971 1:174749436-174749458 TCATGGGAGGCTGAGGCAGGAGG - Intronic
919934260 1:202241309-202241331 TCAGGGAAGGTTCAGTCTTGTGG + Intronic
920109594 1:203577934-203577956 TGATGGATGGGTCAGTCAAGGGG + Intergenic
920225597 1:204436419-204436441 ACTTGGAAGGCTGAGTCAGGAGG + Intronic
921072875 1:211676393-211676415 TCTTGGGAGGCTGAGGCATGAGG + Intergenic
922334767 1:224609744-224609766 TCATGGGAAGCTCAGTTAAGTGG - Intronic
922435029 1:225596320-225596342 TCGTAGAAGGATCAGTCATGTGG - Intronic
923562600 1:235052755-235052777 TCAGGGCAGGCTGAGCCATGGGG + Intergenic
924064889 1:240210834-240210856 TCCAGGAAGCCTCAGTCATCAGG - Intronic
1063048455 10:2418319-2418341 TCATGGAAACCTCAGCTATGGGG + Intergenic
1063431062 10:5988598-5988620 ACTTGGAAGGCTGAGTCAAGAGG - Intergenic
1063873207 10:10442714-10442736 TCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1064475537 10:15684473-15684495 ACTTGGGAGGCTCAGGCATGAGG - Intronic
1066302152 10:34106732-34106754 TCATGGAAGAGTAAGTCATGAGG - Intergenic
1066469900 10:35688236-35688258 TCTTGGAAGGCTCAGGCAGGAGG - Intergenic
1067778953 10:49184803-49184825 TCATCGAAGCCTCAGCCATCAGG + Intronic
1068367940 10:56076688-56076710 TCATGGAAGATCCAGTGATGAGG - Intergenic
1069792483 10:71031838-71031860 GCATGGCAGGCTGAGTGATGGGG + Intergenic
1070803793 10:79258725-79258747 TCATGGAAGGCTCATGAAAGGGG - Intronic
1072267071 10:93741123-93741145 TCATGAAAAACTCAGTCACGAGG - Intergenic
1073152878 10:101323670-101323692 TCATGGAGAGATCAGTCAGGAGG - Intergenic
1073667079 10:105545681-105545703 ACATGGAAGGCTGAGGCAGGAGG - Intergenic
1075404257 10:122184032-122184054 TGTTGTAAGGATCAGTCATGAGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077285262 11:1762772-1762794 TCAAGGCAGGCTCAGGCTTGTGG + Intronic
1077491763 11:2864251-2864273 GCAGGGCAGGCTCAGTGATGTGG - Intergenic
1078023177 11:7672163-7672185 TCATGGAAGGCTCCTTGCTGGGG - Intronic
1080143224 11:28947562-28947584 TCATGGAAGACACAGGCAGGAGG - Intergenic
1081983644 11:47285937-47285959 TCATGGAAGAGTCCGTTATGAGG - Intronic
1083196690 11:61092461-61092483 TCATGGAAAGTGCAGTGATGGGG + Intergenic
1083417448 11:62534921-62534943 ACATGGAAGGCTCAGGAGTGGGG + Intronic
1083931314 11:65847362-65847384 ACTTGGAAGGCTGAGTCAGGAGG + Intronic
1084042256 11:66548995-66549017 TCAGGGAAGCCTCAGGCAGGAGG - Intronic
1084955839 11:72691074-72691096 TCCTGGAAGTCTCAGACTTGAGG - Intronic
1085871437 11:80354706-80354728 ACTTGGAAGGCTGAGGCATGAGG + Intergenic
1086548038 11:88021697-88021719 TCTTGAAAGGCTGAGGCATGAGG - Intergenic
1086961732 11:92985051-92985073 TCATGGAGGGCTCAGAACTGAGG - Intronic
1088750536 11:112838746-112838768 TAATGGAAGCCTCCGTCAAGGGG - Intergenic
1089484821 11:118837105-118837127 ACATGGGAGGCTGAGGCATGAGG + Intergenic
1090170797 11:124602394-124602416 TCCTGGATGGCTCACTCATGTGG - Intergenic
1090272139 11:125394386-125394408 TCATGCAGGGCTCAGTCACAAGG - Intronic
1091592095 12:1848849-1848871 TCATGGCAGGCTCAGGCGAGAGG - Intronic
1091954018 12:4621727-4621749 TCATGCATTGCTTAGTCATGGGG - Intronic
1092178883 12:6431080-6431102 GCCTGGCAGGCTGAGTCATGAGG + Intergenic
1092527749 12:9319540-9319562 TCCTGGAAGCCTCAGTTAGGAGG - Intergenic
1092782439 12:11999590-11999612 TCTTGGGAGGCTGAGGCATGAGG - Intergenic
1093064293 12:14640346-14640368 ACTTGGAAGGCTGAGCCATGAGG + Intronic
1093424391 12:19011523-19011545 TCCTAGAAGGCTCACTCATATGG - Intergenic
1094031178 12:26012787-26012809 ACATGGAAGGCTGAGACAGGAGG - Intronic
1097095046 12:56540480-56540502 ACATGGAAGGCTAAGGCAGGAGG - Intronic
1097777468 12:63665362-63665384 ACTTGGAAGGCTGAGGCATGAGG + Intronic
1100161545 12:91866571-91866593 TCATGGAGTTCTAAGTCATGGGG - Intergenic
1102142965 12:110631523-110631545 ACTTGGAAGGCTGAGGCATGAGG + Intronic
1102403176 12:112648925-112648947 ACTTGGAAGGCTGAGGCATGAGG - Intronic
1104594178 12:130109030-130109052 ACCTGGATGGCTCACTCATGTGG - Intergenic
1106598155 13:31164363-31164385 ACATGGGAGGCTGAGGCATGTGG + Intergenic
1108365345 13:49705852-49705874 ACATGGAAGGCTGAGGCAGGAGG + Intronic
1108380125 13:49847202-49847224 TCATGCAAGGCTCTGTGCTGTGG - Intergenic
1108544685 13:51480993-51481015 TCTTGGGAGGCTGAGTCAGGAGG - Intergenic
1108865172 13:54914215-54914237 CCATGGAAGGCTAAGGCAGGCGG + Intergenic
1109905660 13:68837005-68837027 ACTTGGAAGGCTGAGTCAGGAGG - Intergenic
1110015328 13:70393056-70393078 TGCTGGTAGGCTCAGTTATGTGG - Intergenic
1111689517 13:91544906-91544928 TCCAGGAAGGCTCACTCATGTGG + Intronic
1112157695 13:96835295-96835317 TCATTGATGGCTCAGTGATGTGG - Exonic
1113271797 13:108682694-108682716 GCATGGAAGGGTCAGTGATGTGG + Intronic
1113529441 13:111010996-111011018 TCATAGAAAACACAGTCATGTGG - Intergenic
1113696681 13:112351169-112351191 ACATGGAAGGCACAGCCATGTGG - Intergenic
1114348306 14:21821218-21821240 TCCAGGAAGGCTGAGTCATGGGG - Intergenic
1117719700 14:58617468-58617490 TTTTGGAAGGCTCAGGCAGGCGG - Intergenic
1118784411 14:69034271-69034293 GTCAGGAAGGCTCAGTCATGTGG - Intergenic
1120960880 14:90123738-90123760 ACATGGGAGGCTGAGTCAGGAGG - Intronic
1123680491 15:22759556-22759578 TCATGGAAGGCACTGTCATATGG - Intergenic
1123782487 15:23642273-23642295 TCCTGGAAAGCTCAGTTCTGCGG + Intergenic
1124332709 15:28834013-28834035 TCATGGAAGGCACTGTCATATGG - Intergenic
1125935005 15:43627302-43627324 TTTTGGAAGGCTGAGTCAAGAGG - Intergenic
1127159561 15:56167055-56167077 TCATGGGAGGCTGAGGCAGGAGG + Intronic
1128456109 15:67832377-67832399 TGGTGGAAGGCTCGGTGATGAGG - Intronic
1130042013 15:80413191-80413213 GCATGGAGAGCCCAGTCATGGGG - Intronic
1130271388 15:82451615-82451637 TCTTGGAAGGCTGAGGCAGGAGG - Intergenic
1130404839 15:83589483-83589505 ACATGGAAGGCTGAGGCAGGAGG - Intronic
1130463725 15:84178951-84178973 TCTTGGAAGGCTGAGGCAGGAGG - Intronic
1130488946 15:84415832-84415854 TCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1130500541 15:84494590-84494612 TCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1130679899 15:85987626-85987648 TCATTGAAGTCACAGTCATAGGG - Intergenic
1130882729 15:88069055-88069077 GCAAGGAAGGCTTAATCATGGGG + Intronic
1132104909 15:99056543-99056565 TAAGAGAGGGCTCAGTCATGTGG - Intergenic
1133024795 16:2983874-2983896 CCAAGGAAGACTCACTCATGCGG + Intergenic
1133240701 16:4412603-4412625 GCATGGATGGCTCATGCATGGGG - Intronic
1133323804 16:4931253-4931275 TCTTGGGAGGCTGAGGCATGAGG + Intronic
1134159820 16:11878482-11878504 ACTTGGAAGGCTGAGGCATGAGG + Intronic
1134294704 16:12935515-12935537 TCATGGGAAGCTCATTCATGGGG + Intronic
1134622813 16:15702496-15702518 TCTTGGAAGGCTAAGGCAGGAGG - Intronic
1135670062 16:24367696-24367718 TCATGGAAGTCTCAGTCTAGTGG + Intergenic
1136705674 16:32186344-32186366 TCATGGAAGGCCCTATCATATGG + Intergenic
1136762239 16:32743065-32743087 TCATGGAAGGCCCTATCATATGG - Intergenic
1136805860 16:33127321-33127343 TCATGGAAGGCCCTATCATATGG + Intergenic
1137909220 16:52359319-52359341 TCATGGAATGCTCAGATATCTGG + Intergenic
1138162366 16:54766359-54766381 CCATAAAAGGCTCAGTCTTGAGG + Intergenic
1139530690 16:67541311-67541333 TCATGGGAGGCTGAGGCAGGAGG - Intronic
1142306108 16:89286577-89286599 TCGTGGAGGGCTCAGGCAAGAGG + Intronic
1203064396 16_KI270728v1_random:1003382-1003404 TCATGGAAGGCCCTATCATATGG - Intergenic
1143415961 17:6750485-6750507 TCATGGAAAGGTAAGACATGAGG - Intergenic
1143637929 17:8176948-8176970 TCAAGGAAGGTTCAGGCCTGGGG - Intergenic
1143680148 17:8470285-8470307 TCAAGGAAGGCTCATTCCCGAGG - Intronic
1143799477 17:9366755-9366777 TCATGGAGGGCTCAATCAAATGG - Intronic
1143875277 17:9986510-9986532 TCATGGAGGGCTCAAGGATGGGG - Intronic
1144726344 17:17504450-17504472 GCCTGGAAGGCTCAGGAATGCGG + Intergenic
1145899620 17:28481902-28481924 ACATGGAAGGCTGAGGCAGGAGG - Intronic
1148465754 17:47864371-47864393 ACTTGGAAGGCTGAGTCAGGAGG - Intergenic
1149076023 17:52596766-52596788 TCATGTCAGCCTCAGTCCTGGGG + Intergenic
1149151121 17:53565128-53565150 AAATGGAAGACTCAGTCAGGAGG + Intergenic
1149672547 17:58428329-58428351 TCATGAAAGGATTAGTCATTAGG + Intronic
1149929687 17:60738862-60738884 ACATGGAAGGCTGAGGCAGGAGG - Intronic
1150399270 17:64844203-64844225 ACTTGGAAGGCTCAGGCAGGAGG + Intergenic
1150506210 17:65701452-65701474 TCATGGAAGGAACAGTTTTGGGG + Intronic
1152199860 17:78939130-78939152 TCATGGGAGGCTAAGGCAGGCGG - Intergenic
1155191699 18:23436547-23436569 TTTTGGAAGGCTGAGGCATGCGG + Intronic
1155609294 18:27645691-27645713 TCATGGATGGCTGAGCCAAGAGG - Intergenic
1155935345 18:31747309-31747331 TCATGTGAGGCTCAGGGATGGGG + Intergenic
1156873692 18:41978984-41979006 ACATGGAAGGCTGAGGCAGGAGG + Intronic
1160268114 18:77358408-77358430 AGATGGAAATCTCAGTCATGTGG - Intergenic
1160460496 18:79035110-79035132 TCATGGAAGGCTCTGAGATATGG - Intergenic
1160460638 18:79035924-79035946 TCATGGAAGGCTCTGAGATATGG - Intergenic
1161999774 19:7736381-7736403 ACCTGGAAGGCTCAGGCAAGAGG - Intergenic
1162078405 19:8204515-8204537 ACTTGGAAGGCTGAGTCAGGAGG - Intronic
1164064295 19:21702004-21702026 ACTTGGGAGGCTGAGTCATGTGG + Intergenic
1165534531 19:36432153-36432175 ACATGGAAGGCTGAGGCAGGAGG + Intergenic
1165957875 19:39513302-39513324 TCATGGCAGCCTCAGTCTTCTGG + Intergenic
1166310016 19:41957565-41957587 TCATAGAAGTCTCAGGGATGGGG + Intronic
1168008969 19:53514551-53514573 TCATTGAAGGCCTAGTGATGTGG - Intergenic
1168036991 19:53727805-53727827 ACATGGGAGGCTGAGTCAAGAGG - Intergenic
1168229186 19:55018106-55018128 TCATGAAAGCCAGAGTCATGTGG + Intronic
926241845 2:11094585-11094607 TCATGAAAGGTTCAGAGATGAGG + Intergenic
926266534 2:11327530-11327552 TCATTGAAGACACAGGCATGTGG - Intronic
926394704 2:12428718-12428740 TCAGGACTGGCTCAGTCATGAGG - Intergenic
928890321 2:36196758-36196780 TCAGGGAAGGCTAGGACATGAGG + Intergenic
930090454 2:47527874-47527896 TCATGCAAGGCTCAGAAATATGG + Intronic
932848921 2:75164744-75164766 TCCTGGAAGGCTCTGTCATTTGG + Intronic
933051822 2:77610819-77610841 ACAGGGAATGCTCAGTCAGGTGG - Intergenic
934120469 2:88832913-88832935 TCAAGGGAGGCTCAGTGAGGAGG + Intergenic
935093964 2:99926121-99926143 TCATGCAACTCTCAGGCATGGGG + Intronic
936161527 2:110087141-110087163 TCAGGGAAGGCCCTGTCAAGAGG - Intronic
936183136 2:110284213-110284235 TCAGGGAAGGCCCTGTCAAGAGG + Intergenic
936270944 2:111048532-111048554 TCATCAAAGGCTCACTTATGTGG - Intronic
937198840 2:120183674-120183696 TGAGGAAAGGCCCAGTCATGAGG - Intergenic
937251710 2:120528066-120528088 TCATGGAATGCAGGGTCATGTGG + Intergenic
937382466 2:121392517-121392539 TCATGGGAGGCTGAGGCAGGAGG - Intronic
938488944 2:131747248-131747270 TGATAAAAGGGTCAGTCATGAGG - Intronic
938866268 2:135424135-135424157 TCAGAGAAGTCTCACTCATGAGG + Intronic
939663338 2:144918411-144918433 GCATGGAAGGCTGAGGCAGGAGG - Intergenic
940708512 2:157133514-157133536 TTAGGGAAGGCTTAGACATGCGG - Intergenic
940966731 2:159846416-159846438 ACTTGGAAGGCTCAGGCAGGCGG + Intronic
941107661 2:161376764-161376786 TCAAAGAAGTCTCAGTCTTGTGG - Intronic
943067798 2:183106989-183107011 TCTTGGAAGGCTGAGACAGGAGG - Intergenic
944332892 2:198493268-198493290 TCTTGGGAGGCTCAGGCAGGAGG + Intronic
944756536 2:202767905-202767927 TCATGAAAAGCTCAGTTATTTGG + Exonic
945462050 2:210120144-210120166 CCATGGGAGGCTCAGGCAGGTGG + Intronic
946788580 2:223275020-223275042 TCATGGGAGGCTGAGGCAGGCGG - Intergenic
946825396 2:223672727-223672749 TCTTGGAAGGCTGAGGCAGGGGG - Intergenic
947886237 2:233574009-233574031 TCATGGGAGGCTGAGGCAGGAGG + Intergenic
948011829 2:234654919-234654941 CCCTGGAAGGTTCAGGCATGTGG - Intergenic
948282579 2:236759258-236759280 TCCTGGAAGGCTGAGGCAGGAGG - Intergenic
948408400 2:237740160-237740182 TCATGGGAGGCTGAGGCAAGAGG + Intronic
1169101517 20:2954016-2954038 ACATGGAAGGCTGAGGCAGGAGG - Intronic
1169525887 20:6424961-6424983 ACATGGAAGGCTGAGGCAGGAGG + Intergenic
1171164817 20:22960387-22960409 TCATGGGAGGCAAAGGCATGGGG - Intergenic
1173120927 20:40288195-40288217 TCATGGAAGGGTCTGTCCTGGGG - Intergenic
1173624305 20:44460527-44460549 TCTTGGAAGGCTGAGGCAGGAGG + Intronic
1173761677 20:45566416-45566438 TTTTGGAAGGCTGAGTCAGGTGG + Intronic
1173913908 20:46692583-46692605 TGCTGGAACGCTCAGTCAGGGGG + Intergenic
1178241920 21:30912574-30912596 TCATGGGAGGCTCAGGCATAAGG + Intergenic
1179242965 21:39608321-39608343 TCAGGGAAGGCACAGCCATGGGG + Intronic
1181970159 22:26683867-26683889 TCATGGAATTCTCAGTCCAGTGG + Intergenic
1182407789 22:30152433-30152455 TCTTGGGAGGCTGAGTCAGGAGG - Intronic
1182787288 22:32918248-32918270 TCAAGGAAGGTTCAGTCCAGGGG + Intronic
1183071308 22:35398452-35398474 TCTTGGAAGGCTCAGGCGGGTGG + Intergenic
1183343183 22:37293409-37293431 TCATGGAGGGCACAGTCTGGTGG - Intronic
951219128 3:20051089-20051111 TCTTGGGAGGCTGAGGCATGAGG + Intronic
951399121 3:22208889-22208911 TCATGGAAGGCTTTGTAATGAGG + Intronic
952439712 3:33313552-33313574 GCTTGGAAGGCTGAGTCAGGAGG - Intronic
952845331 3:37683297-37683319 TCAGGGAAGTCTCACTGATGAGG - Intronic
959939521 3:112066243-112066265 TCATGGAAGTGTCAGTTTTGAGG + Intronic
961766242 3:129213282-129213304 ACTTGGAAGGCTGAGGCATGAGG + Intergenic
963136624 3:141911601-141911623 GCTTGGAAGGCTGAGGCATGAGG - Intronic
963403139 3:144827109-144827131 TCATGTTAGTCTCAGTCCTGTGG + Intergenic
963774286 3:149422694-149422716 ACTTGGAAGGCTAAGGCATGAGG - Intergenic
964341753 3:155715719-155715741 ACTTGGAAGGCTGAGGCATGAGG - Intronic
966683355 3:182667036-182667058 TCATTGAAGCCTCAGTCTTGTGG - Intergenic
967173964 3:186845962-186845984 TGATGGAAGGCTCACTCGTTAGG + Intronic
969556019 4:7910889-7910911 GCATGGAGGGCCCAGTCGTGGGG - Intronic
970787352 4:19815041-19815063 TCAAGGATAGCTCATTCATGCGG - Intergenic
974368145 4:60979868-60979890 TATTGGAAGGCTGAGTCAGGAGG - Intergenic
976613285 4:87051567-87051589 ACATGGAAGGCTGAGGCAGGAGG - Intronic
977941589 4:102865381-102865403 ACATGGAAGGCTGAGGCAGGAGG + Intronic
978652812 4:111027647-111027669 TCATGGAATGCTCATTCTAGGGG + Intergenic
979128258 4:117004935-117004957 TCTTGGAAGGCTGAGGCAGGAGG + Intergenic
979598451 4:122559679-122559701 GCATGGAAGGCTGAGAAATGTGG - Intergenic
979630462 4:122896121-122896143 TCATATATGCCTCAGTCATGTGG - Exonic
980403869 4:132331091-132331113 TTATGGAAGGCTTAGTAAAGGGG - Intergenic
981540307 4:145839489-145839511 TGATGCAAGCCTCTGTCATGTGG + Intronic
982002896 4:151037411-151037433 TCCTGGAATGTTCAGTCTTGTGG - Intergenic
983675424 4:170286875-170286897 TCTTGGAAGGCTGAGGCAGGAGG - Intergenic
984089996 4:175361302-175361324 TCATATTAGGCTTAGTCATGTGG + Intergenic
985841984 5:2313434-2313456 TCTTGGGAGGCTCACTGATGTGG + Intergenic
986210764 5:5669672-5669694 TCAGGGATTGCTCAGACATGGGG - Intergenic
986391489 5:7291525-7291547 TCATGGAAGGCACTGTCATATGG - Intergenic
986809690 5:11343136-11343158 TGATGGTTGGCTCAGTCATTTGG - Intronic
989210778 5:38856748-38856770 TCAAGGGAGGCTGAGTCAGGTGG - Intronic
992169563 5:74088157-74088179 ACTTGGAAGGCTGAGGCATGAGG + Intergenic
992458123 5:76934953-76934975 TCATGAAAGGATGACTCATGGGG - Intergenic
993247629 5:85470965-85470987 TCATGGGAGGCCAAGGCATGGGG + Intergenic
993466997 5:88260694-88260716 TCATGGAAGGCTAAGGCAGGAGG - Intronic
993982270 5:94557344-94557366 ACCTTGAAGGCTGAGTCATGTGG - Intronic
995332857 5:110965024-110965046 CCATGGCAGGTTCTGTCATGTGG - Intergenic
995698817 5:114910000-114910022 TCCAGGAATACTCAGTCATGGGG + Intergenic
999057388 5:148593621-148593643 TCAGGGAAGGTTAAGTCTTGTGG - Intronic
999659338 5:153842609-153842631 TCTTGGAAGTTTCAGTCATAGGG + Intergenic
1000267677 5:159653305-159653327 TCAAGGGAGGCTCAGAAATGAGG - Intergenic
1000280678 5:159779111-159779133 ACTTGGAAGGCTGAGTCATGAGG + Intergenic
1000520561 5:162289741-162289763 ACATGTAAGTCTCAGTCCTGAGG - Intergenic
1001141886 5:169151340-169151362 TCAGGGAAGTCTCAGAAATGAGG - Intronic
1004652327 6:17622354-17622376 TCTTGGCAGGCTCAGGCAGGAGG + Intronic
1004735904 6:18406278-18406300 TCAGGGAAGTCTCAGTGATAAGG + Intronic
1004964083 6:20827630-20827652 GCATGGAAGACTAAGTTATGTGG + Intronic
1006244441 6:32717984-32718006 TCATGGAATTCTCAGTCACTAGG - Intergenic
1006643558 6:35500919-35500941 TCATGGGAGGCTCAGTCTTGAGG - Intronic
1007083702 6:39127710-39127732 ACATGGAAGGCTCTGTGGTGAGG + Intergenic
1009609881 6:65927769-65927791 ACATGGAAGGCTGAGGCAGGAGG - Intergenic
1011010760 6:82701473-82701495 TTTTGGAAGGCTGAGCCATGAGG - Intergenic
1012643618 6:101653134-101653156 CCATGGAAGGACAAGTCATGGGG + Intronic
1017250953 6:152278874-152278896 ACATGGGAGGCTCAGGCAAGGGG - Intronic
1017266343 6:152450642-152450664 TCATGGAAGACCCAGACAAGTGG - Exonic
1021579888 7:22141565-22141587 GCAAGGAAGGCTCAGGCCTGGGG + Intronic
1023149566 7:37188836-37188858 TCATGGAAGGCTCAGTCATGGGG - Intronic
1023795396 7:43788056-43788078 TCATGGAAAGCCCAGTGAGGCGG + Intronic
1024836470 7:53525649-53525671 TCATGGAAGGCTGCTTCCTGAGG + Intergenic
1026160733 7:67866528-67866550 TCTTGGGAGGCTGAGGCATGAGG + Intergenic
1026458319 7:70591944-70591966 CTATTGAAGGCTCAGCCATGAGG - Intronic
1028898838 7:96073225-96073247 TAATAAAAGGCTCAGTCTTGGGG + Intronic
1029644499 7:101845227-101845249 TTATGGAAGGCTGAGGCAGGAGG - Intronic
1033399196 7:141005817-141005839 TCATGTAAGTTTCAGTCTTGTGG - Intergenic
1035380522 7:158437593-158437615 TCTTGGAAGGCTCAGTCACCTGG + Intronic
1036171526 8:6490084-6490106 TCCTGGAGGTCTCAGTCATAAGG - Intronic
1036332010 8:7836830-7836852 TCATGGAATCCTCAGCAATGAGG + Intronic
1036654298 8:10666494-10666516 ACATGGAAGGCTGAGGCAGGAGG + Intronic
1037352636 8:17977821-17977843 GCATGGAAGTCTCATTCCTGTGG - Intronic
1037385660 8:18337833-18337855 TCTTGGAAGGCTGAGGCAGGAGG - Intergenic
1037527276 8:19739449-19739471 TCATGGCAGTGGCAGTCATGTGG - Intronic
1038099907 8:24361719-24361741 ACTTGGAAGGCTGAGTCAAGAGG - Intergenic
1041781518 8:61582260-61582282 TAAAGGAGGGCTCAGTTATGGGG - Intronic
1043014055 8:74916151-74916173 CCATGGAAGGAGCAGTCATCTGG - Intergenic
1048199881 8:132363548-132363570 TCAAGGAAGGCTCATACATGCGG + Intronic
1051821249 9:21171917-21171939 TCAGGGAAGGCTCAGACAATGGG + Intergenic
1055169607 9:73239747-73239769 TCAGAGAAGGCTCAGCCCTGAGG + Intergenic
1055614867 9:78061259-78061281 TAATGGAAGGCCCAGTAAGGTGG - Intergenic
1056809032 9:89750148-89750170 TCTGGGTAGGCTCAGTCTTGTGG - Intergenic
1057721986 9:97539529-97539551 TCATGGAATGCTGAGGCAAGAGG - Intronic
1058488377 9:105466447-105466469 TCATGGGAGGCCGAGTCAGGTGG + Intronic
1059031774 9:110705739-110705761 ACAGGGAAGCCTCAGTCATCTGG + Intronic
1059523419 9:114965648-114965670 TCATGGAAGTCTTAGGTATGTGG + Intergenic
1061138701 9:128751511-128751533 TCTTGGAAGGCTCAATGCTGGGG + Exonic
1202803316 9_KI270720v1_random:22586-22608 ACATGGAAGGCTGAGACATGAGG - Intergenic
1185780829 X:2843351-2843373 TCAGGTAAGGCTCAGAGATGCGG + Exonic
1189789739 X:44591750-44591772 ACTTGGAAGGCTGAGGCATGAGG - Intergenic
1192071163 X:67942468-67942490 TGCTGGTAGGCTCAGTTATGTGG - Intergenic
1192133119 X:68571541-68571563 TCACTGATGGCTCAGTCATGTGG - Intergenic
1192397863 X:70801460-70801482 TCCTGGAAGGCAGTGTCATGTGG - Intronic
1201289245 Y:12406777-12406799 TCAGGTAAGGCTCAGAGATGTGG - Intergenic
1202371470 Y:24199662-24199684 TCTTGGAAGGCTGAGGCAGGAGG + Intergenic
1202499315 Y:25470453-25470475 TCTTGGAAGGCTGAGGCAGGAGG - Intergenic