ID: 1023152259

View in Genome Browser
Species Human (GRCh38)
Location 7:37213249-37213271
Sequence TCTTGAGGTACCCTGAAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023152259 Original CRISPR TCTTGAGGTACCCTGAAACT AGG (reversed) Intronic
900744842 1:4354031-4354053 TCTTGAGGTTCCCTGGAGTTTGG + Intergenic
907492118 1:54814926-54814948 TCTTGTGGAAGCCAGAAACTGGG - Exonic
908311689 1:62890502-62890524 TCCTGAGCTACACTGAAATTAGG - Intergenic
909374461 1:74924050-74924072 TTGTGAGGTACCCTGTAAGTGGG - Intergenic
911522816 1:98948621-98948643 TCTTAAGATACCCTGCAGCTTGG + Intronic
915915772 1:159939894-159939916 TCTTGAGGAATCCTGACAGTGGG - Intronic
916935961 1:169628500-169628522 TCTCTTGGTACCCTGAAATTAGG - Intronic
919370683 1:196722388-196722410 TCTTTAAGAACCCTGAAAATAGG + Intronic
921064231 1:211611463-211611485 TGTTGAGGTATCCTGGAGCTAGG + Intergenic
924596496 1:245449504-245449526 TCTTGAGGTGCACTGAATCATGG - Intronic
924820905 1:247489823-247489845 TCTTGAGGTCTCCTGAACCTGGG + Intergenic
1065870179 10:29949746-29949768 TCTTTTGCTATCCTGAAACTTGG - Intergenic
1068952319 10:62789898-62789920 TCTTGGGGAACACTGAAATTGGG + Intergenic
1075277516 10:121107760-121107782 TCTTGGGGTGCCCAGATACTTGG + Intergenic
1078090371 11:8261322-8261344 GCTTGAGGTACACTGCAATTTGG + Intronic
1078593979 11:12671097-12671119 TCTTGAGTCAGCCTGAAGCTAGG - Intergenic
1078602550 11:12746736-12746758 TTTTGTGGTAACCTGACACTGGG + Intronic
1081122884 11:39287693-39287715 TCTTGTGGTACCTTGGAAATGGG - Intergenic
1085140778 11:74139679-74139701 CCTTGATGGAACCTGAAACTGGG + Exonic
1085711293 11:78831222-78831244 TCCTGAGCTGCCATGAAACTTGG - Intronic
1087821867 11:102721558-102721580 TCTTTGGCTAACCTGAAACTTGG - Intronic
1088509485 11:110559995-110560017 TCTTGATGTACACTGCAATTTGG - Intergenic
1092416917 12:8297156-8297178 TCCTGAGGTGCTCTGGAACTGGG + Intergenic
1096343946 12:50828716-50828738 TCTTGGGGTTCCCTGAATCCGGG - Intergenic
1106099921 13:26685433-26685455 TGTTCAGGTACACTGAAATTAGG + Intronic
1108961951 13:56245282-56245304 ACTTGAGGTTGCATGAAACTTGG + Intergenic
1109850908 13:68061938-68061960 ACTTTATGTACCCTGGAACTTGG + Intergenic
1110047808 13:70853658-70853680 TCATGAGTTATTCTGAAACTTGG + Intergenic
1111091623 13:83453664-83453686 TCTCGAGGTACCCTGAGCCAGGG + Intergenic
1116416231 14:44681092-44681114 TCTTGAGAAACTGTGAAACTGGG - Intergenic
1118140420 14:63074324-63074346 TCTTGAGGACCCCTGACACAGGG + Intronic
1118508644 14:66444953-66444975 TCTTGTGATAACCTGGAACTTGG + Intergenic
1122932759 14:104942270-104942292 ACTTTGGGTACCTTGAAACTGGG + Exonic
1127829833 15:62740647-62740669 TCTTGAGGTTCCCTATCACTTGG - Exonic
1132395995 15:101474835-101474857 TGTTGAGGTACCCGGGGACTGGG - Intronic
1135134953 16:19880684-19880706 CCTTGGGGTGCCCTGAAACCAGG + Intronic
1146353022 17:32111711-32111733 GCCTGAGGGAACCTGAAACTTGG + Intergenic
1152848404 17:82616570-82616592 GCCTGAGGGAACCTGAAACTTGG + Exonic
1154085820 18:11304584-11304606 CCTTGTGGTAACCTGAAATTGGG - Intergenic
1161516986 19:4702138-4702160 TCTTGAGGCCCTCTGAACCTTGG + Exonic
1161765523 19:6205919-6205941 TCTTGAGTGAGCCTGAAGCTAGG + Intergenic
1167349266 19:48964631-48964653 TCTTGAGGTGCTCTGCAAGTTGG - Intergenic
1168077278 19:53987998-53988020 TCTCGAGGTAGGCTGAAACCAGG + Exonic
1168584640 19:57583113-57583135 TCTGGGGGCACCCTGAGACTCGG - Intronic
925723898 2:6854773-6854795 TGTGGAAGTACCCTGAAAATAGG - Intronic
927185625 2:20480080-20480102 CCACGAGGAACCCTGAAACTGGG - Intergenic
930032693 2:47068235-47068257 TTTGGAGGTGCCCTGACACTGGG + Intronic
932347810 2:71007189-71007211 TTTTGAGGTCCCCTGAAGCGGGG + Intergenic
933501389 2:83115960-83115982 TATTGATATACCCTGAACCTCGG - Intergenic
936491606 2:112977392-112977414 TTTTGAGGGTACCTGAAACTAGG + Intronic
940464825 2:154014296-154014318 TCCTGAGGTCTCCTGCAACTAGG + Intronic
941199890 2:162495354-162495376 TCTTGAGGTCCCCAGAACATAGG - Intronic
1170874472 20:20237293-20237315 TCGTAAGGTACCCTGAGTCTGGG - Intronic
1173832930 20:46104172-46104194 TTGTGAGGGACCCTGAAAGTTGG - Intergenic
1177623006 21:23621207-23621229 TCTTTAAGTACCATGCAACTGGG + Intergenic
1181973415 22:26711067-26711089 GCCTGAGGGTCCCTGAAACTTGG + Intergenic
1184812093 22:46842977-46842999 TCCTGATGTACCCTGGGACTTGG + Intronic
956389801 3:68759327-68759349 CCATGAGGTACCCAGATACTTGG - Intronic
956887031 3:73570622-73570644 TTTTGAGGAAACCTGAATCTAGG - Intronic
958143759 3:89597793-89597815 TATTGAGGTACCCAGCTACTCGG + Intergenic
962425042 3:135262261-135262283 TCTTGAGATACCCAGAAAGAAGG + Intergenic
963013234 3:140795233-140795255 TATTGAGATATCCTAAAACTTGG - Intergenic
975769444 4:77705393-77705415 TATTGAGGAATCCTGAAATTAGG - Intergenic
981513356 4:145581525-145581547 TCTTGATGTATCCTTAAAATGGG + Intergenic
983071144 4:163269560-163269582 TTTTGCTTTACCCTGAAACTGGG + Intergenic
983111623 4:163757291-163757313 ACTTGAAGAACCGTGAAACTAGG + Intronic
985395412 4:189538503-189538525 TCATGAGGTCTCCTGAAGCTAGG - Intergenic
986831124 5:11579779-11579801 TCTTTGTGTCCCCTGAAACTAGG + Intronic
988531520 5:32031668-32031690 TCTGGAGGCACCCTGAGACCTGG + Intronic
989755532 5:44948843-44948865 TCTTGGGGTACTTTGCAACTAGG - Intergenic
989774704 5:45190407-45190429 AATTGAAGTATCCTGAAACTTGG + Intergenic
991190780 5:63870648-63870670 TCCTGAGAAACCCTGCAACTAGG - Intergenic
996746546 5:126851203-126851225 CCCTGAGGTTCCCTGAGACTTGG + Intergenic
1004664804 6:17740304-17740326 GCTTGAGAGACCCTGAGACTAGG - Intergenic
1007031177 6:38628444-38628466 TCTTAATGTACCCAGAAAGTAGG - Intronic
1008899847 6:56599191-56599213 TCTTGAGGTACCTAGCAGCTAGG - Intronic
1010801463 6:80180769-80180791 TCTTTACGTACACTGATACTTGG - Intronic
1010895521 6:81358396-81358418 ACTTGAGGTACCTTGAAACAAGG - Intergenic
1015907906 6:138136546-138136568 TTATGAGGTTCCCTGAACCTTGG - Intergenic
1017245595 6:152221193-152221215 TCATTACCTACCCTGAAACTAGG - Intronic
1017706223 6:157125416-157125438 ACTTGAGGTACCCTTTTACTTGG - Intronic
1020350336 7:7212184-7212206 TCTTGAGGTCCCAAGAAACTCGG + Intronic
1021002101 7:15344083-15344105 TCTTGATTTACTCTCAAACTTGG - Intronic
1023152259 7:37213249-37213271 TCTTGAGGTACCCTGAAACTAGG - Intronic
1023625479 7:42111345-42111367 CCTTGAGCTACCTTGCAACTTGG - Intronic
1027454414 7:78370901-78370923 TCTTAAGGTACTCTAAAATTTGG - Intronic
1031082989 7:117276321-117276343 TCTTCAGTTACCCTGAAGGTTGG - Intergenic
1032729325 7:134622442-134622464 TGTTGAGGTGCCCAGACACTAGG + Intergenic
1036181351 8:6588143-6588165 TCTTGAGGCAGGCTGACACTGGG + Intronic
1039090223 8:33820030-33820052 CCATGAGGTATCCTGATACTTGG - Intergenic
1041535760 8:58923782-58923804 TCTTGAGGGACCCGGAACCCAGG - Intronic
1041561594 8:59225427-59225449 TTTTGAGGTGCCCTGGAAGTGGG - Intergenic
1043340484 8:79231572-79231594 TCTTTAAGCACCCTGAAAATAGG - Intergenic
1045118914 8:99014051-99014073 TTTTGAGCTACCCTGAAACAAGG + Intronic
1047002280 8:120584929-120584951 TCTGGTGGTGACCTGAAACTAGG + Intronic
1047563548 8:126015160-126015182 TTTGGAGGTAAGCTGAAACTCGG + Intergenic
1058081323 9:100703674-100703696 TCTTGAGGTAAATAGAAACTGGG - Intergenic
1059716770 9:116920446-116920468 TTTTGAGAGACCCTGAAAGTTGG - Intronic
1061746749 9:132745727-132745749 TCTTGAGGGACCCTTGCACTGGG - Intronic
1188013853 X:25086209-25086231 TCTGGTGGTACCCTGGAACAGGG - Intergenic
1188651165 X:32632970-32632992 TCTTGAGTTCTCCTGAAAATGGG + Intronic
1194806082 X:98329780-98329802 TCTTTTGTTACCTTGAAACTGGG - Intergenic
1196277786 X:113788737-113788759 TCTTTAGGTACAGTCAAACTGGG + Intergenic
1200765804 Y:7079733-7079755 TATTGAGGTATCTTGAAAATAGG + Intronic