ID: 1023153995

View in Genome Browser
Species Human (GRCh38)
Location 7:37229476-37229498
Sequence ATAGAGAAGGAGACAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1733
Summary {0: 1, 1: 1, 2: 11, 3: 168, 4: 1552}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023153991_1023153995 30 Left 1023153991 7:37229423-37229445 CCAAAATTTGTAAACCAGAATCT 0: 1
1: 0
2: 1
3: 29
4: 320
Right 1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG 0: 1
1: 1
2: 11
3: 168
4: 1552
1023153992_1023153995 16 Left 1023153992 7:37229437-37229459 CCAGAATCTAGATTCACACATAA 0: 1
1: 0
2: 1
3: 42
4: 208
Right 1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG 0: 1
1: 1
2: 11
3: 168
4: 1552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023153995 Original CRISPR ATAGAGAAGGAGACAGAGGC TGG Intronic
900001767 1:18385-18407 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900021487 1:188908-188930 ATGGAGAAGATCACAGAGGCTGG + Intergenic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900569561 1:3351629-3351651 AGAGAGATGGAGAGAGAGGGAGG - Intronic
900685731 1:3946468-3946490 ACAGAGAAGGAAATCGAGGCTGG + Intergenic
900693508 1:3995831-3995853 GTATGGAAGGAGACTGAGGCTGG + Intergenic
900933929 1:5753619-5753641 ACAGAGGAGGAAACTGAGGCCGG + Intergenic
901056937 1:6452791-6452813 ACAGAGAAGGAAACTGAGGCTGG - Intronic
901144154 1:7053913-7053935 ACAGAGGAGGAGACAGCGCCAGG - Intronic
901257707 1:7845722-7845744 ACAGAGAAGTAAACTGAGGCAGG + Intronic
901336411 1:8453072-8453094 AAAGAGAGGGAGAGAGAGGAAGG + Intronic
901479646 1:9516128-9516150 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
901652403 1:10750601-10750623 TTATAGAAGGAGGCTGAGGCTGG + Intronic
901671698 1:10860004-10860026 GTAGAGAAGATGAGAGAGGCTGG - Intergenic
901696375 1:11011279-11011301 AGAGAGAAAGAGAGAGAGGTAGG + Intergenic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902073693 1:13765337-13765359 ATAGAGAGGAAGAGAGAAGCTGG - Intronic
902130526 1:14256486-14256508 AGAGGGAAGGAGACAGAGAGAGG + Intergenic
902404710 1:16176310-16176332 AGAGAGAGAGAGACAGAGGCAGG - Intergenic
902477438 1:16695704-16695726 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
902531343 1:17092650-17092672 ATAGAAAAGCATAAAGAGGCTGG + Intronic
902755352 1:18545774-18545796 ACAGAGGAGGAGAGGGAGGCTGG - Intergenic
902799425 1:18820040-18820062 ACAGAGGAGGAAACTGAGGCTGG - Intergenic
902893381 1:19461357-19461379 AGAGAGAAGGAGGCAGAGCCTGG - Intronic
902911805 1:19604095-19604117 ATAGATAAGAAAACTGAGGCTGG - Intronic
902982363 1:20134158-20134180 AGAGAGAAAGAAACAGAGGGAGG - Intergenic
903295821 1:22342574-22342596 AGAGATAAGGAGACAGAGAAAGG + Intergenic
903365770 1:22804769-22804791 AAGGAGCAGGGGACAGAGGCGGG - Intronic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
903751655 1:25625642-25625664 ATAGAGAAAGAGAGAGCGACAGG - Intronic
903850467 1:26302759-26302781 ATAGAAGAGGATACAGAGGCGGG + Intronic
903997431 1:27316323-27316345 ACAAAGAAGGAGACAGACACTGG + Intergenic
904357090 1:29947337-29947359 ATAGATAAGAAGACTGAGGCTGG - Intergenic
904541670 1:31238072-31238094 ACAGATAAGAAGACTGAGGCCGG + Intronic
904635851 1:31880502-31880524 AGAGAGAGAGAGACAGTGGCAGG + Intergenic
904998538 1:34650303-34650325 AGAGAGAAAGAGAAAGAGGGAGG + Intergenic
905448097 1:38040514-38040536 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
905594397 1:39193793-39193815 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
905921022 1:41718730-41718752 AGAGAGACAGAGACAGAGGAGGG - Intronic
906152723 1:43597537-43597559 AGAGGGAAGGAGAGAGAGGGAGG + Intronic
906294094 1:44638385-44638407 AGAGAGAAGGAGGCAGAGGCAGG + Intronic
906507629 1:46392194-46392216 AGAGAGAGGGAGTCAGAGACAGG - Intergenic
906515353 1:46435883-46435905 AAAGAGGAGGGGAGAGAGGCAGG - Intergenic
906523747 1:46482147-46482169 AGAGAGAGAGGGACAGAGGCGGG - Intergenic
906554679 1:46699572-46699594 GCAGAGTAGAAGACAGAGGCCGG + Intronic
906613834 1:47221742-47221764 ATAGCTAAGGAGACTGAGGCTGG + Intronic
906707272 1:47903932-47903954 TCAGAGCAGGAGGCAGAGGCAGG - Intronic
906745916 1:48222131-48222153 ATAGTGTAGGAAACTGAGGCTGG - Intergenic
906943343 1:50275096-50275118 ATAGATGAGGAGACAGGGTCCGG - Intergenic
907110508 1:51922437-51922459 ATAGATGAGGAAACAGAGACTGG - Intronic
907270503 1:53288254-53288276 AGAGAGAAAGAAACTGAGGCTGG - Intronic
907290043 1:53407763-53407785 AGAGAGAAGGAAACAGAGAAGGG - Intergenic
907552326 1:55314809-55314831 CTAGAGAAGGGAACAGAGTCAGG + Intergenic
907645079 1:56234329-56234351 ATGGAGACGAAGACACAGGCTGG - Intergenic
907790774 1:57661350-57661372 ATAGTTAAGGACACCGAGGCTGG - Intronic
907793604 1:57692429-57692451 AAAGAGAAGGAGACAGAACGAGG + Intronic
908016378 1:59841858-59841880 AAACAGAGGGAGACAGAGACAGG + Intronic
908115528 1:60936484-60936506 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
908789929 1:67771014-67771036 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
908984794 1:70004726-70004748 AAAGAGAGGGAGAGAGAGCCGGG - Intronic
909187300 1:72503799-72503821 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
909415563 1:75402295-75402317 ACAGAGAAGGAGACAAACTCAGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910707576 1:90146354-90146376 TTAGAAAAGGAAAAAGAGGCCGG + Intergenic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
910868617 1:91810740-91810762 ATAGATAAAGAAACAGAGGCAGG - Intronic
911382378 1:97130914-97130936 ATAGAGAGAGAGAAAGAGGGAGG - Intronic
911387329 1:97193710-97193732 ATGAGGAGGGAGACAGAGGCAGG - Intronic
911426738 1:97724908-97724930 ATAGAGAAGAAGAGAGAGAGAGG + Intronic
911626498 1:100130708-100130730 AGAGAGAAAGAGAGAGAGTCTGG + Intronic
911693481 1:100861884-100861906 ATAGAGAAGGAGAGAGGGCTGGG - Intergenic
911718690 1:101166202-101166224 ATAGAGAAGAGGCCAGAGGATGG - Intergenic
912246789 1:107968306-107968328 TGAGAGCAGGAGGCAGAGGCTGG + Intergenic
912791587 1:112657258-112657280 ACAAAGAAGGAGAAATAGGCCGG - Intronic
912840274 1:113033258-113033280 AAAGAAAAGGAAACATAGGCTGG + Intergenic
913172816 1:116247765-116247787 ATGGTGAGGGACACAGAGGCAGG - Intergenic
913323392 1:117606121-117606143 GAAGAGGAGGCGACAGAGGCAGG - Exonic
913469981 1:119177784-119177806 ACAGAGAAAGAGACAGAGAGAGG + Intergenic
913694876 1:121315127-121315149 ATAGAGACGGAGGTAGAGGGAGG - Intronic
913718932 1:121571310-121571332 ATAGAAAAGGAGACTGAGGTAGG - Intergenic
914049042 1:144116127-144116149 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
914130142 1:144849318-144849340 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
914142684 1:144964931-144964953 ATAGAGACGGAGGTAGAGGGAGG + Intronic
914435001 1:147652024-147652046 ATAGATAAAGAAACTGAGGCTGG - Intronic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915101652 1:153505310-153505332 AAAGAGAAAGAGAGAGAAGCTGG + Intergenic
915109614 1:153554676-153554698 ACAGACAAGGAAACAGAGGCTGG - Intergenic
915448525 1:155988986-155989008 TTGGAGAAAGAGACAGAGGCAGG + Intronic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
915999511 1:160601197-160601219 AGAGAGAAAGAGACAGAGAGAGG - Intergenic
916024274 1:160820474-160820496 ATGGAGATGGAATCAGAGGCAGG + Intronic
916366811 1:164038224-164038246 AGAGAGAAAGAGACAGAGAGAGG - Intergenic
916748051 1:167699490-167699512 ATGGAGATGGAGGCAGAGACTGG - Intronic
916876091 1:168971127-168971149 TGGGGGAAGGAGACAGAGGCAGG + Intergenic
917176050 1:172236640-172236662 GTAGAGAAGAGGACAGAGGGAGG + Intronic
917227758 1:172802105-172802127 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
917501951 1:175593708-175593730 ATAGAAGAGGGGACAGAGTCTGG - Intronic
917644004 1:177011775-177011797 AACTAGAAGGAGGCAGAGGCTGG + Intronic
918011432 1:180590561-180590583 ATAGAGAGGTAGGCAGGGGCTGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
918301113 1:183204688-183204710 TTAGAGGAGGAGACAGAAGAGGG + Intronic
918324333 1:183395278-183395300 GTAGAAAAGGTGATAGAGGCTGG - Intronic
918401789 1:184170545-184170567 TTAGGGGAGGAGACAGAGACAGG - Intergenic
918557424 1:185819487-185819509 ATAGAGAAGGACACAGATTTAGG - Intronic
918658673 1:187062053-187062075 AAAGAGATGGAGATAGAGACAGG - Intergenic
918659175 1:187068345-187068367 ATAGAGCAGGCAACAGAGGCAGG + Intergenic
918754662 1:188324231-188324253 ATAGTGAAGGAGATTGGGGCAGG + Intergenic
919003043 1:191859620-191859642 AAACAGAAGGAGAGAGAGGAAGG - Intergenic
919119500 1:193321585-193321607 ATAGAGAAGGAGAAAGCTACAGG - Intergenic
919511462 1:198470718-198470740 AGAGAGAAGGAGAAAGAGTCAGG - Intergenic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
919710375 1:200721331-200721353 AGAGAGAGAGAGAAAGAGGCCGG - Intergenic
920096779 1:203491708-203491730 ATGGATAGGGAGAGAGAGGCGGG - Intergenic
920100511 1:203514274-203514296 AGAGAGAGAGAGACTGAGGCGGG - Intergenic
920482207 1:206333510-206333532 ATAGAGACGGAGGTAGAGGGAGG - Intronic
920756485 1:208738580-208738602 AAAGAGAAAGAGACAGAGAGAGG + Intergenic
920772893 1:208906481-208906503 AAAGAGAAAGAGACAGAGAGAGG + Intergenic
920773007 1:208907344-208907366 CTAGGGATGGAGAGAGAGGCAGG + Intergenic
920848676 1:209613808-209613830 AGAGAAAAGGGAACAGAGGCAGG - Exonic
921080057 1:211732074-211732096 ATGGGGAAAGAGACAGAGGGAGG - Intergenic
921391292 1:214616981-214617003 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
921437786 1:215147076-215147098 ATGTACAAAGAGACAGAGGCAGG + Intronic
921575629 1:216831505-216831527 AGAGAGAGAGAGAAAGAGGCAGG + Intronic
921709474 1:218359072-218359094 AACGAGAGGGAGACAGAGGAAGG + Intronic
921972033 1:221160303-221160325 ATAGATAAGGAAACTGAGGCTGG - Intergenic
922232712 1:223700408-223700430 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
922327156 1:224538630-224538652 AGAGAGAAGGAGGAGGAGGCAGG - Intronic
922640341 1:227223627-227223649 TTAGAGAAGGGGACAAAGGGAGG - Intronic
922740491 1:228011557-228011579 AGAGAGATAGAGACAGAGACGGG - Intronic
922914985 1:229249907-229249929 AGAGAGAAAGAGAGAGAGGAAGG - Exonic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923597579 1:235372626-235372648 AAAGAGAGAGAGAGAGAGGCTGG + Intronic
924058658 1:240148447-240148469 AGAGAGAAAGAGAGAGAGACAGG + Intronic
924090315 1:240494256-240494278 ACAGTGAAGGAAACTGAGGCTGG + Intronic
924116508 1:240753085-240753107 ATAGAGACAGAGAGAGAGGGAGG - Intergenic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924255867 1:242182404-242182426 ATAGAGACAGAGATAGAGGTAGG - Intronic
924328663 1:242921152-242921174 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
924482781 1:244451908-244451930 AGGAAGAAGGAGCCAGAGGCCGG + Exonic
1063057052 10:2517056-2517078 ATAAGGAAGGAGGCAGGGGCAGG - Intergenic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063218093 10:3942219-3942241 AAAGAAAAAGAGAGAGAGGCAGG + Intergenic
1063245036 10:4209039-4209061 AGAGAGAGAGAGAGAGAGGCTGG + Intergenic
1063255830 10:4326347-4326369 AGAGAGAGAGAGACAGATGCGGG - Intergenic
1063379679 10:5576412-5576434 AGACAGATGGAGACAGAGACAGG - Intergenic
1063388822 10:5635201-5635223 AGAGAGAGAGAGACAGAGACAGG + Intergenic
1063424294 10:5939509-5939531 ATTGAGAAGTAGTTAGAGGCTGG + Intronic
1063668265 10:8079449-8079471 AAAGAGAAAGAGAGACAGGCAGG - Intergenic
1063869725 10:10404553-10404575 ATAGAGAAGGAGAGAGAGAGAGG + Intergenic
1064211101 10:13361141-13361163 ATATAGAAGTAGATAGAGGCTGG - Intergenic
1064332027 10:14402949-14402971 ATGGAGATGGGGACAGAGGGTGG + Intronic
1064860898 10:19824127-19824149 AAAGAGAAAGAGACAGAGACAGG + Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065258481 10:23899939-23899961 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1065497231 10:26341872-26341894 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065497261 10:26342007-26342029 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1065580377 10:27164932-27164954 TTAAAAAAGGAGACAGTGGCTGG - Intronic
1065697759 10:28395558-28395580 ATAGAGAAAGAGAGAGAGGCAGG - Intergenic
1065771281 10:29081161-29081183 ATAGAGAAGGAGAGAGGGCTGGG + Intergenic
1065810408 10:29438101-29438123 AGAGAGAGAGAGACAGAGGGGGG - Intergenic
1065851634 10:29794898-29794920 AGAGAGAGGGAGACAGAGAGAGG + Intergenic
1065958515 10:30714451-30714473 AGAGAGAGCGAGACAAAGGCAGG - Intergenic
1066176205 10:32909538-32909560 AATGATAAGGAGACACAGGCTGG + Intronic
1066187183 10:33021591-33021613 ATAAAGAAGGAAATGGAGGCTGG + Intergenic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066239773 10:33522328-33522350 ATTGGGAAGGAGACAGAACCAGG + Intergenic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067242874 10:44510893-44510915 ATGGCAAAGGAGACAGAGGAAGG + Intergenic
1067288511 10:44924590-44924612 ACAGAGCAGGGGACAGAGGAGGG + Intronic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067438534 10:46295212-46295234 ATAGAGCAGGAAACTGAGTCAGG + Intronic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067764619 10:49075645-49075667 ATAGAGACACAGGCAGAGGCTGG + Intronic
1067768241 10:49105310-49105332 ACAGAGAAAGAGAGAGAGACGGG + Intronic
1067770628 10:49121031-49121053 GAAGAGCAGGAGACAGAGACAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068240846 10:54299194-54299216 AAAGAGGAGGAGACAGAGAGAGG + Intronic
1068356838 10:55920816-55920838 ATTAAAAAGGAGACAGATGCTGG - Intergenic
1068774300 10:60854357-60854379 AGAGACAAAGAGACTGAGGCTGG - Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1068972881 10:62977719-62977741 ATAGAGAGAGAGAGAGAGGAAGG + Intergenic
1069200371 10:65607696-65607718 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1069200400 10:65607916-65607938 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1069210085 10:65746197-65746219 ATGGAGAATGAGACAGACACAGG - Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069335792 10:67348594-67348616 AGAGAGCAAGAGACAGAGGGAGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069551441 10:69367159-69367181 ACAGAGAAGGAGCCAGAGGTGGG + Intronic
1069631899 10:69902361-69902383 ACAGGGAGGGTGACAGAGGCAGG + Intronic
1069680665 10:70283294-70283316 TGAGAGAGGGAGACAGAGACAGG - Intronic
1069725823 10:70577542-70577564 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1069740567 10:70684704-70684726 ATAAATAAGGAAACTGAGGCAGG + Intronic
1069846366 10:71374600-71374622 ATGGAGATGGGGACAGGGGCAGG - Intergenic
1069902075 10:71712124-71712146 ATGCAGATGGAGGCAGAGGCTGG - Exonic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070148254 10:73789930-73789952 AGGGAGAAAGAGACGGAGGCAGG - Intronic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071255194 10:83866049-83866071 ATATAGAAGTACACAGAGGTTGG + Intergenic
1071793565 10:88981676-88981698 GTAGGGAGGGAGAGAGAGGCTGG + Intronic
1072270200 10:93768800-93768822 ACAGATGAGGAGACTGAGGCTGG - Intronic
1072454303 10:95562425-95562447 ACAGAAAAGGAAACAGAGACAGG + Intergenic
1072563832 10:96601175-96601197 ATAGACAAGGAAATTGAGGCTGG + Intronic
1072737353 10:97888170-97888192 ACAGAGAATGAGACAGACCCAGG + Intronic
1072833840 10:98690151-98690173 AAGGAGAAGGAGTCAAAGGCTGG - Intronic
1073030802 10:100524145-100524167 AGAGAGAAGGAGAAAGGGGGAGG + Intronic
1073311762 10:102547852-102547874 AGAGAGAAAGAAAGAGAGGCTGG + Intronic
1073457539 10:103646727-103646749 ATACAGCAGGAGATAAAGGCTGG + Intronic
1073699421 10:105908875-105908897 ATAGATAATGAGACATATGCTGG - Intergenic
1073834242 10:107422776-107422798 ATAGAGAGCGAGACAGAGAGAGG + Intergenic
1073867875 10:107825696-107825718 ATAGTGAAGGAGGCTGAGCCTGG + Intergenic
1073943933 10:108729825-108729847 AGAGGGAAGGAGAGAGAGGGAGG + Intergenic
1074186441 10:111102905-111102927 ATAGAGGAGGAAGCTGAGGCTGG + Intergenic
1074364365 10:112846019-112846041 AAAGAAAAGAAGACAGAGGTGGG + Intergenic
1074449855 10:113550192-113550214 ATTTAGAAGGAAAAAGAGGCTGG - Intergenic
1074496701 10:113985911-113985933 TTCTAGAAAGAGACAGAGGCAGG + Intergenic
1074602268 10:114927048-114927070 AGAGAGAGGGAGAGAGAGGGGGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1074875948 10:117613523-117613545 GTAGCGGAGGAGTCAGAGGCAGG - Intergenic
1074997832 10:118773117-118773139 ATAGATAAGAAGAGAGAGGCTGG - Intergenic
1075103059 10:119519420-119519442 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075103096 10:119519576-119519598 ACAGATAGGGAGACAGAAGCTGG - Intronic
1075103139 10:119519764-119519786 ACAGACAGGGAGACAGAAGCTGG - Intronic
1075635166 10:124025791-124025813 AGAAAGACGGAGACAGAGCCTGG + Intronic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076227192 10:128787738-128787760 ATAGAAAACGAAACAGAGGAAGG + Intergenic
1076365371 10:129918299-129918321 ATGGAGAATGAGACAGAAGTGGG - Intronic
1076677060 10:132152601-132152623 ACACAGAAGGGGACAGAGGCTGG + Intronic
1077022981 11:427698-427720 AGAGAGAGAGAGACAGAGACAGG - Intronic
1077280419 11:1742437-1742459 ATAGAGAAAGTGACAGTGGCTGG + Intronic
1077367933 11:2168708-2168730 ACAGAGATGGAGAGAGAGGGTGG + Intronic
1077373916 11:2196275-2196297 ACAGAGATGGGGAGAGAGGCAGG - Intergenic
1077373956 11:2196678-2196700 GCAGAGATGGAGACAGAGACGGG - Intergenic
1077373994 11:2197054-2197076 GCAGAGATGGAGACAGAGACAGG - Intergenic
1077775926 11:5271475-5271497 ATGGAGACGGAGGCAGAGGTGGG - Intronic
1077784372 11:5366614-5366636 ATAGAGAAAGAGAGAGAGGTAGG + Intronic
1077848732 11:6053600-6053622 TTAGAGAATGAGAGAGAGGCAGG + Intergenic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1077902595 11:6501595-6501617 GCAGAGAAGGAGACAGAGAATGG + Intronic
1077966527 11:7139669-7139691 ACAGAGGAGGAGACAGATTCAGG + Intergenic
1078024524 11:7681944-7681966 AAAGAAAAGGAAGCAGAGGCTGG - Intergenic
1078064942 11:8072162-8072184 AGGGGGAAGGAGGCAGAGGCGGG + Intronic
1078152653 11:8772620-8772642 AGAGAGAAGGAAACAGAGACAGG + Intronic
1078469539 11:11576035-11576057 ACATAGAAAGAGACAGAGCCAGG + Intronic
1078525161 11:12095104-12095126 ACAGATAAGGAGACAGAGCTGGG + Intronic
1078808783 11:14736697-14736719 ATAGAGAAGGAGAGAGGTTCTGG + Intronic
1078987813 11:16612214-16612236 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079388055 11:19998292-19998314 AGAGAGAAGGAGAGGGAGGTGGG - Intronic
1079495870 11:21043436-21043458 AGAGAAAGGGAGACAGAGGCAGG + Intronic
1079872139 11:25811787-25811809 TTTGAGAATGAGACAGAGGTTGG - Intergenic
1079902145 11:26199855-26199877 ATTGAGAAAGAGACAAAGGAAGG - Intergenic
1080114607 11:28607594-28607616 ATAGATGAGGAAACAGAGGCTGG + Intergenic
1080169747 11:29285901-29285923 ATTAAGGAGGAGACAGAGACAGG - Intergenic
1080337337 11:31213096-31213118 AGAGAGAGAGAGAGAGAGGCTGG - Intronic
1080466667 11:32503947-32503969 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1080767689 11:35311905-35311927 AGAGAGAGAGAGAGAGAGGCGGG + Intronic
1080928660 11:36784798-36784820 AGGGAGAAAGAGACAGAGGGAGG - Intergenic
1081283270 11:41237475-41237497 ATAGAAAAGCTGACAGAGACGGG + Intronic
1081589585 11:44411911-44411933 AAAGAGAAGGTGAAACAGGCAGG + Intergenic
1081603271 11:44510265-44510287 ACAGAGAGGGAAACTGAGGCAGG - Intergenic
1081655924 11:44857537-44857559 AGAGTGAAGGAGACAGAACCAGG + Intronic
1082114571 11:48314418-48314440 GTAGAGAAGGAGACAGGGGTAGG - Intergenic
1082181137 11:49121233-49121255 AGAGACAGGAAGACAGAGGCAGG - Intergenic
1082556273 11:54566445-54566467 GTAGAGAAAGAGATAGAGGTAGG - Intergenic
1082773998 11:57231922-57231944 ATAGAGACAGAGGCAGAGGGAGG - Intergenic
1083010865 11:59397736-59397758 GTAGAGAAGGAGACTGTGACAGG + Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083297659 11:61723724-61723746 ATAGACAAGGAAACTGAGGCAGG - Intronic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1083575637 11:63789092-63789114 CTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1083902032 11:65647819-65647841 AAAGAGAGAGAGACAGAGACAGG - Intronic
1084016316 11:66384584-66384606 CTTGGGAGGGAGACAGAGGCGGG + Intergenic
1084019221 11:66407810-66407832 ACAGATAAGGAGACTGAGACTGG - Intergenic
1084182798 11:67455084-67455106 ATAGATAGGGAAACTGAGGCTGG + Intronic
1084288376 11:68146385-68146407 GCAGAGAAGGAGCCAGAAGCCGG - Intergenic
1084521397 11:69665217-69665239 AGAGAACAGGAGACAGAGACGGG + Intronic
1084535343 11:69753152-69753174 AGAGAGGAGCAAACAGAGGCTGG - Intergenic
1084598633 11:70132040-70132062 ACAGAGAAGAAGACCGTGGCGGG - Exonic
1084751769 11:71208718-71208740 ACAGATAAGGAAACTGAGGCTGG - Intronic
1084886000 11:72207291-72207313 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1084941881 11:72617368-72617390 AGAGAGCAGGGCACAGAGGCTGG + Intronic
1084945024 11:72633736-72633758 ATAGTGAAGGAGAGAGGAGCTGG + Intronic
1084965488 11:72742195-72742217 ATCGAGAGGGAGACTGAGTCAGG - Intronic
1085224848 11:74910586-74910608 ATGGAGAAGCAGGCAGAGTCAGG + Intronic
1086270843 11:85064875-85064897 AGAGAGAAAGAGAGAGAGGCTGG - Intronic
1086338041 11:85818966-85818988 AGAGATAAGGACACCGAGGCAGG - Intergenic
1087194906 11:95295674-95295696 ATAGAGCAGGAAAGACAGGCGGG - Intergenic
1087458810 11:98421342-98421364 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
1087496498 11:98896946-98896968 GGAGAGGAGGAGACAGAGGAGGG + Intergenic
1087526752 11:99323922-99323944 ACAGAGGAAGAGACAGAGGGAGG + Intronic
1087558967 11:99759730-99759752 AGAGAGAAGGAGAGGGAGGGAGG + Intronic
1087967779 11:104438945-104438967 GGAGAGAAAGAGACAGAGGTTGG - Intergenic
1088670962 11:112140245-112140267 AAAGAGAAAGAGAGAGAGGGAGG - Intronic
1088680005 11:112231874-112231896 AGAGAGAGGGAGACAGAGACAGG + Intronic
1088699087 11:112396003-112396025 ATTAAGAAAGAGATAGAGGCAGG - Intergenic
1088832632 11:113550416-113550438 ATAGAGCACTAGCCAGAGGCAGG + Intergenic
1088894180 11:114065293-114065315 ATAGAGAAGGAAACGGAAGCCGG - Intronic
1089060437 11:115621949-115621971 ATAAAGAATGAAATAGAGGCTGG - Intergenic
1089134114 11:116235568-116235590 ATAGGGATGGGGAGAGAGGCTGG - Intergenic
1089134755 11:116240154-116240176 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1089134775 11:116240358-116240380 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1089145617 11:116327834-116327856 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
1089200512 11:116722082-116722104 CTGGAGCAGGACACAGAGGCTGG - Intergenic
1089382123 11:118041752-118041774 CTAGAGAAAGAAACACAGGCCGG + Intergenic
1089440952 11:118516225-118516247 ATAGAGAGTGACACAGAGGTGGG + Intronic
1089502201 11:118939360-118939382 AGAGAGATGTGGACAGAGGCAGG + Intronic
1089641787 11:119852628-119852650 AGAGAGAAAGAGAGAGAGACAGG - Intergenic
1089658614 11:119970963-119970985 AGAGAGAGGGAGCGAGAGGCTGG + Intergenic
1089773729 11:120821431-120821453 ATAAAGATGGAAAGAGAGGCTGG + Intronic
1089850104 11:121488285-121488307 AGAGAGAAGGAGGGAGAGGCAGG - Intronic
1089893263 11:121902239-121902261 ATAGAAAAGGCAACAGAGCCTGG - Intergenic
1089925009 11:122248197-122248219 ATAGAGAAGAAATAAGAGGCAGG + Intergenic
1090124084 11:124067637-124067659 ATAGAGAAGAAGGCAAAGCCAGG - Intergenic
1090262028 11:125328115-125328137 ACAATGAAAGAGACAGAGGCTGG + Intronic
1090347586 11:126083604-126083626 AAAGAGAGAGAGACAGAGGTAGG - Intergenic
1090428529 11:126627287-126627309 ATGAGGAAGGAGACAGAGGCTGG + Intronic
1090557227 11:127889529-127889551 AGAGAGACAGAGACAGAGACTGG + Intergenic
1090636271 11:128692383-128692405 ATTGAGAAGCAGACAGGAGCGGG + Intronic
1090640618 11:128726298-128726320 ATAGAGTAGGAGTCTGGGGCTGG - Intronic
1090730402 11:129568851-129568873 ACAGATAAGGAAACTGAGGCCGG - Intergenic
1090818629 11:130320188-130320210 AGAGAGAAGAAGGCAGTGGCTGG - Intergenic
1090970071 11:131633752-131633774 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1091192047 11:133704182-133704204 AGAGGGAAGGAGAGAGAGGGAGG + Intergenic
1091374845 12:18490-18512 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091899547 12:4134018-4134040 ATAGACAAGGAGAGCCAGGCTGG - Intergenic
1092084449 12:5744174-5744196 ATAGAGAAGAAGACGGTGGCAGG + Exonic
1092167840 12:6353982-6354004 AGAGAGAGGGAGGCCGAGGCGGG + Intronic
1092171242 12:6375189-6375211 ATAGAGAGGGAGTGAGAGGCAGG - Exonic
1092252178 12:6905697-6905719 GACGAGAAGGAGACAGAGGAGGG + Exonic
1092333902 12:7611262-7611284 ACTGAGTAGGAGACTGAGGCAGG + Intergenic
1092532309 12:9354597-9354619 ACAGAGCAGGTGATAGAGGCTGG + Intergenic
1092756392 12:11767217-11767239 AGAGATAAGGAAACTGAGGCTGG - Intronic
1092824171 12:12382272-12382294 TAAGAGAGGGAGACAGAGGTGGG + Intronic
1092997934 12:13967915-13967937 ATGGAGATGGTGACACAGGCAGG - Intronic
1093201615 12:16193828-16193850 AGAGAGAGAGAGAGAGAGGCTGG + Intronic
1093201708 12:16195230-16195252 ATAGAGACAGAGGCAGAGGCAGG - Intronic
1093203409 12:16217543-16217565 ATAGAGGAGGACATTGAGGCTGG - Intronic
1093448861 12:19292420-19292442 ACAGAGAAAGAGAGAGAGGGAGG + Intronic
1093483757 12:19630969-19630991 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1093698953 12:22195953-22195975 ACATAGAAGCAGAAAGAGGCAGG + Exonic
1094809772 12:34125830-34125852 ATAAAGCAGGAGGCAGAGTCAGG - Intergenic
1095051245 12:37556116-37556138 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1095362273 12:41357133-41357155 AGAGAGAAAGAGACAGAGAGAGG - Intronic
1095417165 12:41989687-41989709 ATGAAGATGGAGGCAGAGGCTGG + Intergenic
1095848410 12:46773096-46773118 ACAGAGAAGGTGACAGAGAGTGG - Intronic
1095979240 12:47961719-47961741 ATAGAGAGTGAGGCTGAGGCTGG - Intergenic
1096136520 12:49206954-49206976 AAAAAGAAAGAGAGAGAGGCCGG + Intronic
1096370274 12:51063709-51063731 ATAGAGAATGGGTAAGAGGCAGG + Exonic
1096424633 12:51490744-51490766 AATGAGAAGGAAAGAGAGGCAGG + Intronic
1096476885 12:51913914-51913936 ATAGAGAAGGGGGCTGTGGCTGG + Intronic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1096652096 12:53066814-53066836 ACAAAGATGGAGAGAGAGGCCGG + Intronic
1096830877 12:54313142-54313164 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1096845868 12:54406099-54406121 ATAGTGAAGCAGACATAGGGTGG - Intronic
1097313618 12:58149114-58149136 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1097350978 12:58548695-58548717 AGAGAGAGAGAGACAAAGGCAGG + Intronic
1097369967 12:58766387-58766409 AAAGAGGAGGTGGCAGAGGCAGG + Intronic
1097394303 12:59054905-59054927 AGGAAGAAGGAGACAAAGGCTGG + Intergenic
1097515335 12:60597411-60597433 AGAGAGACAGAGACAGGGGCAGG + Intergenic
1098020887 12:66155343-66155365 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1098161649 12:67651091-67651113 ATAGAGAGACAGACAGAGGGAGG - Intronic
1098190110 12:67938945-67938967 AAATAGAAGGAGCCAGAGGAAGG + Intergenic
1098870797 12:75814865-75814887 ATAGCCAAGGAGAGAGATGCAGG - Intergenic
1099005250 12:77227616-77227638 ATAGATATGGAGCTAGAGGCAGG + Intergenic
1099376473 12:81900297-81900319 AGAGAGAAGGATATAGAGGTTGG - Intergenic
1099539850 12:83894235-83894257 ATAGAGAAAGAGAGAGAAGAGGG - Intergenic
1099546063 12:83981136-83981158 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1099604421 12:84784127-84784149 AGAGAGAAGGAGAGAGAAGAAGG + Intergenic
1099877511 12:88427401-88427423 AGAGTTGAGGAGACAGAGGCAGG + Intergenic
1099946862 12:89254789-89254811 ATAGAGTGGGATACAGAGGCAGG - Intergenic
1099954774 12:89343205-89343227 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1100141553 12:91625231-91625253 AAAGAGAAGGAGAGAGAAACAGG - Intergenic
1100282162 12:93128232-93128254 ATAGGGAAGGAGAGTGAGGGCGG + Intergenic
1100379385 12:94047460-94047482 ATAGAGGAGGAAACCAAGGCAGG - Intergenic
1100644675 12:96516234-96516256 ATAGATAAGGAAGCTGAGGCTGG + Intronic
1100750165 12:97690225-97690247 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1100767556 12:97884593-97884615 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1100793618 12:98157241-98157263 TTAGAAAAGGCCACAGAGGCCGG + Intergenic
1100883893 12:99048074-99048096 ATAGAGGTGGAGGCAGAGGCTGG + Intronic
1100924653 12:99530988-99531010 ATAAGCAAGAAGACAGAGGCAGG - Intronic
1100976787 12:100130960-100130982 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
1101010322 12:100443050-100443072 AGAGAGAAAGAGACAAAGGAAGG - Intergenic
1101514253 12:105419779-105419801 ATAGAGGTGGAAACAGTGGCTGG + Intergenic
1101600648 12:106206559-106206581 ATAGAGAAGGACACACATGGAGG - Intergenic
1101740450 12:107495806-107495828 ACAGACAAGAAAACAGAGGCAGG - Intronic
1101821970 12:108191373-108191395 ACAGAGATGGAGAGAGAGGCAGG + Intronic
1101838130 12:108309371-108309393 ACAGAGAGGGAGACATGGGCTGG + Intronic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101885789 12:108660549-108660571 ATAGGGAAGAAGGCAGAGGAAGG - Intronic
1101964606 12:109273877-109273899 AGAGAGAGAGAGACTGAGGCAGG - Intergenic
1102039812 12:109793682-109793704 GAAGAGAGGGAGGCAGAGGCTGG + Intronic
1102054950 12:109889547-109889569 ATGAAGATGGAGGCAGAGGCTGG - Intergenic
1102241779 12:111329033-111329055 AGAGAGATGGTGAGAGAGGCAGG - Intronic
1102548615 12:113674718-113674740 ACAGAGAAGGAGGGAGAGACAGG - Intergenic
1102661915 12:114536562-114536584 AGAAAGAAAGAGACAGAGGAAGG + Intergenic
1102665769 12:114571461-114571483 AGAAAGAAAGAGACAGAGGAAGG - Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103059531 12:117847546-117847568 TTAGAGCAGGTGACAGATGCTGG - Intronic
1103147171 12:118604888-118604910 ACAGACAAGGAGACTGAGGCTGG - Intergenic
1103316818 12:120062846-120062868 AACGTGAAGGAGTCAGAGGCTGG - Intronic
1103357642 12:120333471-120333493 AGAGAGCAGGAATCAGAGGCAGG - Intergenic
1103492999 12:121337712-121337734 ATCTAGAAGGTGACAGAAGCAGG - Intronic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103710079 12:122906012-122906034 ATAGATAAGGAAATTGAGGCAGG - Intergenic
1104187693 12:126448526-126448548 ACAGAGAAGGAGGAAGAGACTGG + Intergenic
1104254058 12:127123951-127123973 ATAGAGGGGGGGACAGAGGGAGG + Intergenic
1104254179 12:127124248-127124270 ATAGAGGGGGGGACAGAGGGTGG + Intergenic
1104254286 12:127124505-127124527 ATAGAGGGGGGGACAGAGGGTGG + Intergenic
1104254438 12:127124882-127124904 ATAGAGGGGGGGACAGAGGGAGG + Intergenic
1104254569 12:127125207-127125229 ATAGAGGGGGGGACAGAGGGTGG + Intergenic
1104272543 12:127294957-127294979 AGAGAGAGGGAGACAGAGCCAGG - Intergenic
1104502765 12:129302409-129302431 ATAGAAAAGGTGGCAGAGGCCGG - Intronic
1104687045 12:130793281-130793303 ATAGAGGATGAGAGAGTGGCTGG - Intronic
1104766379 12:131332959-131332981 CTAGAGAAGGGGGCAGAGGGAGG + Intergenic
1104813029 12:131629638-131629660 CTAGAGAAGGGGGCAGAGGGAGG - Intergenic
1104938133 12:132377859-132377881 GGAGAGAAGGAGACAGAGAGAGG + Intergenic
1105434842 13:20367564-20367586 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
1105685851 13:22781064-22781086 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1105762935 13:23530346-23530368 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1106243837 13:27930029-27930051 AGAGAGAATGAGACAGAGAATGG - Intergenic
1106488893 13:30198351-30198373 ATAGCAAAGGTGACAGAGGTGGG - Intergenic
1106777640 13:33024427-33024449 ATGGATGATGAGACAGAGGCAGG - Intronic
1106899248 13:34337646-34337668 AAAGAGCAGGAGAAAGAGGAGGG + Intergenic
1107012718 13:35684063-35684085 AGAGGGAAGGAGACAGGAGCTGG - Intergenic
1107021776 13:35759610-35759632 GTAGAGAAGGAGGCTGAGGAAGG - Intergenic
1107032346 13:35866135-35866157 AGAAATAAGGACACAGAGGCAGG - Intronic
1107071427 13:36274041-36274063 ATAGAGAAGGAGAATGAAGTGGG - Intronic
1107364119 13:39651647-39651669 AAAGAAAAAGATACAGAGGCTGG - Intergenic
1107812673 13:44215407-44215429 GTGGAGAAGGAGACAAAGACTGG - Intergenic
1107939906 13:45374363-45374385 AGAGAGAAAGAGAAAGAGGTGGG + Intergenic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108677001 13:52745718-52745740 CTTGAGAAGGAGAGAGAGTCAGG + Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109370735 13:61416297-61416319 AGAGAGAAAGGGAGAGAGGCAGG - Intronic
1110081673 13:71321421-71321443 ATAAAGAAGGAGAAAGAAGATGG + Intergenic
1110478666 13:75947856-75947878 AGAGAGAAAGTGACAGTGGCTGG + Intergenic
1110619524 13:77579508-77579530 AAAAAGAAAGAGACAGAGACAGG - Intronic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111116629 13:83787018-83787040 TTAGTGAAGGAGACATTGGCTGG + Intergenic
1111225233 13:85262189-85262211 AAAGAGGAAGAGACAGAGGGAGG - Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111514734 13:89314183-89314205 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1111613880 13:90640176-90640198 AGAGAGAAAGAGACAGAGAGAGG - Intergenic
1111632362 13:90858583-90858605 AGAGAGAAAGAGACAGTGACTGG - Intergenic
1111775366 13:92654970-92654992 TTATAGATGGAGACAGAGGCTGG + Intronic
1111785056 13:92776265-92776287 AGAGGAAAGGAGACAGAGGGAGG - Intronic
1111787425 13:92807028-92807050 ACAGAGGAGGAGACTGAGACTGG - Intronic
1111796466 13:92927085-92927107 TTAGAAAAGAAGAAAGAGGCTGG + Intergenic
1112206968 13:97334001-97334023 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1113074353 13:106453222-106453244 CCAGAGAAGAAGACAGAGGCAGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113340373 13:109417142-109417164 ATAGATAATTAGACAGAGGATGG - Intergenic
1113341961 13:109434460-109434482 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1113679915 13:112236118-112236140 GTAAAGAAGGAGGCAGAGACCGG + Intergenic
1113695227 13:112341526-112341548 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1113695260 13:112341680-112341702 AAAGAGAGAGAGAGAGAGGCGGG - Intergenic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114339156 14:21724680-21724702 AGAAAGAAAGAGAGAGAGGCAGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114483579 14:23049575-23049597 GAGGAGAAGGGGACAGAGGCAGG + Intronic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114524281 14:23358832-23358854 CTAGAGAAGGGGACAGGGGAGGG - Intronic
1114944767 14:27666211-27666233 AGAGAGAGGGAGACAGAGAGAGG + Intergenic
1115348514 14:32368094-32368116 AGAGAGAGAGAGACAGAGGGAGG - Intronic
1116168622 14:41368408-41368430 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
1116268265 14:42725341-42725363 ATAGAGACAGAGACAGAGATAGG - Intergenic
1117021809 14:51578730-51578752 ATAGACGAGGAAACTGAGGCTGG + Intronic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117308427 14:54498613-54498635 AGAGGAAAGGAGACAGAGGGAGG + Intergenic
1117362835 14:54994898-54994920 ATAGAGAATGAAAGAGAGGTGGG - Intronic
1117397586 14:55326245-55326267 AAAGGGGAGGAGACAGAGGGAGG - Intronic
1117662321 14:58020494-58020516 ATAGAGAAAGAGACAAGGGGAGG - Intronic
1117771653 14:59139691-59139713 CTAGAGATGGAGCCAGCGGCTGG - Intergenic
1117949451 14:61067156-61067178 ATATAGAAAGAGACAGAAGCTGG - Intronic
1118026982 14:61779426-61779448 ACAGAAAATGAGACAGAGACTGG - Intronic
1118275312 14:64381301-64381323 AAAGAGAAGAAGAAATAGGCCGG + Intergenic
1118479992 14:66154939-66154961 ATACAGAAAGAGAGAGAGACAGG + Intergenic
1118810502 14:69270020-69270042 CCAGACAAGGAGACAAAGGCGGG - Intronic
1118819217 14:69334215-69334237 GCAGCGAAGGAGACAGAGGTGGG + Intronic
1119225815 14:72943796-72943818 TGAGAGGAGGATACAGAGGCAGG + Intronic
1119425703 14:74533537-74533559 AAGGAAAAGGAGGCAGAGGCTGG + Intronic
1119812509 14:77534150-77534172 AGAGAGAAAGAGAGAGAGACAGG - Intronic
1120318015 14:82921083-82921105 AGAGAGAGGGAGAGAGAGACAGG + Intergenic
1120998541 14:90435076-90435098 ATGAAGAAGGAGACAAAGACAGG - Intergenic
1121270163 14:92632539-92632561 ATAGATAAAGAAACTGAGGCTGG + Intronic
1121420639 14:93810985-93811007 TCAGAGAAGGAGGCAGAGGATGG + Intergenic
1121501636 14:94442760-94442782 AGTGAGAAGGGGACCGAGGCCGG - Exonic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121662108 14:95642805-95642827 TCAGAGCAGGAGAAAGAGGCAGG - Intergenic
1121740433 14:96248351-96248373 AGAGAGATGGAGGCAGAGACTGG + Intronic
1121777017 14:96597955-96597977 AAAGAGAAGGAGGCAGAGGTGGG - Intergenic
1121876738 14:97459565-97459587 AGATGGAGGGAGACAGAGGCAGG + Intergenic
1121961335 14:98262986-98263008 TTAGAGATGGAGAAACAGGCTGG + Intergenic
1122023784 14:98859890-98859912 AGAGAAGAGAAGACAGAGGCTGG + Intergenic
1122082841 14:99278491-99278513 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
1122447951 14:101782336-101782358 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1122448067 14:101782653-101782675 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1122803583 14:104245253-104245275 ACAGAGCAGGAGGCTGAGGCTGG + Intergenic
1123081666 14:105698282-105698304 AGAGAGATAGAGACAGAGGCAGG - Intergenic
1123418979 15:20115700-20115722 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123446885 15:20337807-20337829 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1123528200 15:21122243-21122265 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1123852454 15:24373524-24373546 AGAGAGAGAGAGACAGAGACAGG + Intergenic
1124047280 15:26161866-26161888 ATAAAGCAGGATCCAGAGGCAGG - Intergenic
1124521293 15:30408221-30408243 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124537369 15:30557996-30558018 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124761286 15:32449591-32449613 ATATAGAAGGAGAGAGGGCCCGG - Exonic
1124777348 15:32599472-32599494 ATATAGAAGGAGAGAGGGCCCGG + Exonic
1124849408 15:33321882-33321904 ATAGATTAGGAAACTGAGGCTGG - Intronic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125315892 15:38430695-38430717 AGAGAGAAAGAGACAGGGGGAGG - Intergenic
1126040753 15:44588407-44588429 ATAGAGAAGAAGATAGTGACAGG + Intronic
1126085390 15:45006201-45006223 AGAGAGAAAGAGACAGAGACCGG - Intergenic
1126563716 15:50072917-50072939 AGAGAGAGAGAGAGAGAGGCCGG - Intronic
1126753260 15:51898845-51898867 AAAGAAAAAGAGACAGAGGTAGG - Intronic
1127006341 15:54574569-54574591 TCAGAGAAGGAAACAGAGGATGG - Intronic
1127027102 15:54819012-54819034 ACAGATGAGGAGGCAGAGGCAGG - Intergenic
1127254618 15:57278744-57278766 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1127455883 15:59155718-59155740 AGAAAGGAGGAGACAGAGCCGGG + Intronic
1127770736 15:62228297-62228319 ACAGAGAGAGAGACAGAGACAGG - Intergenic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1127956607 15:63859298-63859320 GCAGAGAAGAAGACAGAAGCAGG - Intergenic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1129654271 15:77513296-77513318 AGAGAGAAAGAGAAAGAGACAGG - Intergenic
1129676768 15:77635876-77635898 ATAAAGCAGGAGCCAGTGGCTGG + Intronic
1129690211 15:77708969-77708991 ATGAAGATGGAGGCAGAGGCTGG + Intronic
1129694031 15:77730547-77730569 ATATAGAGGGACAGAGAGGCAGG - Intronic
1129795570 15:78373605-78373627 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
1130040239 15:80400375-80400397 ATAGAGAAGAAGGCAGGGGTGGG + Intronic
1130041656 15:80410169-80410191 GTAGAGAATGAGAGAGAGGGAGG + Intronic
1130052185 15:80493128-80493150 AGAGAGAACGAGACAGAGAGCGG + Intronic
1130656039 15:85792826-85792848 GGAGAGAAGGAGACACAGGTGGG - Intronic
1131279503 15:91009254-91009276 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1131296077 15:91150301-91150323 ATAGAGAGACAGACAGAAGCCGG - Intronic
1131366496 15:91846284-91846306 AGAGAGAGGGAGAGAGAGACAGG - Intergenic
1131457810 15:92597058-92597080 AAAGAGGAGCAGACAAAGGCAGG - Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1131818911 15:96251681-96251703 AAAGAGAAGGAAGCAGAGTCAGG + Intergenic
1131962884 15:97807891-97807913 ATAGAGGAGGAAACTGAGGCCGG - Intergenic
1132190160 15:99847742-99847764 GTATAGATGGAGACAGAGGTTGG - Intergenic
1132451744 15:101972555-101972577 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1132455148 16:18074-18096 ATGGAGAAGATCACAGAGGCTGG + Intronic
1132594549 16:742441-742463 ATGGAGAAGGCCACACAGGCTGG - Intronic
1132602304 16:778769-778791 AGAGAGGAGGAGACAGGGGCAGG + Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132951257 16:2563662-2563684 TGAGAGTGGGAGACAGAGGCAGG - Intronic
1132963093 16:2636508-2636530 TGAGAGTGGGAGACAGAGGCAGG + Intergenic
1133050518 16:3114844-3114866 ACAGAGAAGGAAGCAGAGACTGG - Intronic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133214553 16:4283682-4283704 ACAGAGAGGGAGGCAGTGGCGGG - Intergenic
1133475435 16:6116837-6116859 AGACAGAGGGAGAGAGAGGCTGG + Intronic
1133499050 16:6348067-6348089 GCAGAGAAGGGGAAAGAGGCAGG + Intronic
1133565188 16:6986678-6986700 AGAGAGAAGGAGAGAGAGAAGGG - Intronic
1133577064 16:7102115-7102137 ACAGAGAAGTAGGCACAGGCAGG - Intronic
1133817656 16:9210468-9210490 AAGAAGAAGGAGCCAGAGGCTGG - Intergenic
1134117569 16:11560765-11560787 GTAGAGAAGGCCACAGAAGCAGG + Intronic
1134310285 16:13070265-13070287 ACAGAGATGGAGGCAGAGTCCGG - Intronic
1134316808 16:13126536-13126558 AGAGAGAAAGAGACTGAGGGAGG + Intronic
1134490973 16:14694886-14694908 AGCGAGAAAGAGACAGAGTCTGG - Intergenic
1134496354 16:14734004-14734026 AGCGAGAAAGAGACAGAGTCTGG - Intronic
1134663228 16:15999760-15999782 AGAGAGAGAGAGAAAGAGGCCGG - Intronic
1134826117 16:17285678-17285700 CTGGTGAAGGAGACAGAGGCAGG - Intronic
1134856043 16:17520118-17520140 ATGGAGAAGGAGGCAGGGGAAGG + Intergenic
1135100654 16:19602500-19602522 AGAGAGGAGGAGAGAGAGGGAGG - Intronic
1135516880 16:23143555-23143577 ACAGAGAAGGAGAAAGAGAGAGG + Intronic
1135551230 16:23399702-23399724 ACACAGAGGCAGACAGAGGCTGG + Intronic
1135592919 16:23717588-23717610 ATAGAGAGAGAGATAGCGGCTGG + Intergenic
1135653521 16:24227703-24227725 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1135663031 16:24313008-24313030 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1136079509 16:27842528-27842550 CTAGAGAAGGGCACAGAGGAAGG - Intronic
1136284307 16:29232272-29232294 ACAGATAAGGAAACTGAGGCTGG + Intergenic
1136464317 16:30431548-30431570 AAAGATAAGGAAACTGAGGCCGG + Intergenic
1136464966 16:30436424-30436446 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1136573013 16:31108206-31108228 ATAGAGCAGGAGATAGAGGCTGG + Intronic
1136629777 16:31483137-31483159 ATGGAGGAGCACACAGAGGCAGG + Exonic
1136630021 16:31484655-31484677 ATGGACTGGGAGACAGAGGCGGG - Exonic
1137404084 16:48176430-48176452 AAAGAGGAGGAGACAGAGGCTGG + Intronic
1137568363 16:49548617-49548639 AAAGAGAAGGGGAGAGAGACGGG + Intronic
1137585803 16:49663635-49663657 AGAGGGCAGGAGCCAGAGGCAGG + Intronic
1137593931 16:49711173-49711195 AAAGAGAAGGTTACAGAGGCTGG + Intronic
1137781459 16:51101103-51101125 AGAGAGAAGGAGACAGAAAGTGG + Intergenic
1137819210 16:51427604-51427626 ATAAAGAAAGAGAGAGAGGGAGG - Intergenic
1138026157 16:53523900-53523922 AGAGAGAAGGAGGCCGAGGGCGG - Intergenic
1138483217 16:57317924-57317946 ACAGAGAAGGAAACTGAGGCTGG - Intergenic
1138493097 16:57388368-57388390 AGAGAGAAGGAGGCTGAGGCGGG - Intergenic
1138784301 16:59828478-59828500 AGAGAGATGGAGACAGAGAAGGG + Intergenic
1138835993 16:60435214-60435236 AGAAAGAAGGAAAGAGAGGCCGG + Intergenic
1138954924 16:61959636-61959658 ACACAGAAAGAGACAGAGGGAGG + Intronic
1139075016 16:63435050-63435072 AAAGAGAAAGAGACAAAGGATGG + Intergenic
1139120639 16:64012172-64012194 AGAGAGAAGGACACAGATGGAGG - Intergenic
1139361351 16:66402123-66402145 ACAGACAAGGAAACTGAGGCTGG + Intronic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139660671 16:68418774-68418796 ATTTACAAGGAGACAGAGCCAGG - Intronic
1140270782 16:73464794-73464816 AGAGAGAAGGACCCAAAGGCGGG - Intergenic
1140307092 16:73813214-73813236 AGAGAGAAAGAGAAAGAGGTAGG - Intergenic
1140350883 16:74261037-74261059 AGACAGATGGAGAGAGAGGCTGG - Intergenic
1140410546 16:74738216-74738238 AGAGAGAATGAGAGAGAGGTGGG + Intronic
1140692611 16:77498820-77498842 AGAGAGAGAGAGTCAGAGGCGGG + Intergenic
1140740325 16:77935972-77935994 AAAGAGAACGAGAGAGAAGCAGG - Intronic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141326768 16:83067812-83067834 AGAGAGAAGAAGAGAGGGGCAGG - Intronic
1141362243 16:83406423-83406445 AGAGAGACAGAGAGAGAGGCGGG - Intronic
1141558890 16:84853833-84853855 ACAGAAAGGGAGACCGAGGCTGG + Intronic
1141640540 16:85338451-85338473 ATGGAGGGGGAGACTGAGGCAGG - Intergenic
1141744351 16:85915551-85915573 ACAGATGAGGAGACTGAGGCTGG + Intronic
1141752620 16:85969131-85969153 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1141883736 16:86877835-86877857 AGAGAGAGAGAGACAGAGACAGG - Intergenic
1141991244 16:87611632-87611654 ATAGAGCAGCAGACAGAGGCGGG - Intronic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142717964 17:1757465-1757487 ATGGAGCTGGAGACACAGGCGGG + Intergenic
1142758591 17:2030030-2030052 ATAAAGGAGGAGATAGGGGCGGG - Intergenic
1142913950 17:3118355-3118377 ATGAATAAAGAGACAGAGGCTGG + Intergenic
1143324778 17:6091685-6091707 ATTGGGAAGGAGTCAGAGCCTGG + Intronic
1143369741 17:6431597-6431619 ATAGAGTAGCAGACAGAAGACGG + Intronic
1143431478 17:6890570-6890592 ATAGTGCAGGAGCCTGAGGCTGG - Intronic
1144343359 17:14329408-14329430 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1144837058 17:18162013-18162035 AGAGAGAAGCATTCAGAGGCAGG - Intronic
1145158132 17:20556418-20556440 ATGGAGAGAGAGACAGAGACAGG + Intergenic
1145371880 17:22313053-22313075 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1145833396 17:27935719-27935741 CTAGAGAAGGGAACAGATGCAGG + Intergenic
1145842995 17:28011998-28012020 ATAGAGAAGGAGACAAGGAGAGG + Intergenic
1145904593 17:28509245-28509267 ATGGGGAAAGAGACAGAGACGGG - Intronic
1146299842 17:31679260-31679282 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146721974 17:35130212-35130234 ATAGAGACAGAGAGAGAGCCAGG + Intronic
1146765242 17:35515047-35515069 ATAAAGAAAGAAACAGAAGCTGG - Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1146954396 17:36928702-36928724 AAAGAGAAAGAGACAGACTCGGG + Intergenic
1147007582 17:37416364-37416386 ATTGAGAGGGAGGCCGAGGCAGG - Intronic
1147178148 17:38669510-38669532 AGATGGAAGAAGACAGAGGCGGG + Intergenic
1147390820 17:40108123-40108145 AGACAAAAGGAGACAGAAGCAGG + Intergenic
1147530201 17:41269190-41269212 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1147748778 17:42713243-42713265 CTAAAGAAGGAGACAGTGACAGG - Exonic
1147771828 17:42873226-42873248 AGAGAGAGAGAGACAGAGACAGG + Intergenic
1147993322 17:44348494-44348516 AGAGAAAAGGACACAGAAGCTGG - Intronic
1148107477 17:45127147-45127169 ACAAAGAAGGAAACTGAGGCAGG + Intronic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148602077 17:48901778-48901800 AGAGAGAGGGAGACGGGGGCGGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148874911 17:50681329-50681351 ACGGTGAAGGAGACACAGGCGGG - Intronic
1148911622 17:50946070-50946092 TTAGGGAGGGAGACTGAGGCAGG + Intergenic
1148985056 17:51613548-51613570 AGAGAGAGGGGGACAGAGGGGGG - Intergenic
1148987409 17:51635214-51635236 ATAAAGATGGAGGTAGAGGCTGG + Intronic
1149287500 17:55181027-55181049 ATGGAGGTGGAGACAGATGCAGG + Intergenic
1149321032 17:55481073-55481095 AGAGAGAGAGAGACAGAGACAGG - Intergenic
1149378614 17:56070356-56070378 ATAAAGAAGGCGACAGAGTCTGG - Intergenic
1149651344 17:58278411-58278433 AGAGAGAAGGGGAGAGAGACGGG - Intronic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1150023357 17:61644210-61644232 AAAGAGAAGGAGAAAGAGAGAGG - Intergenic
1150174716 17:63040018-63040040 ATAGGGAAAGAGACATTGGCAGG - Intronic
1150296807 17:64014446-64014468 AGAGAGAAGGAGAGAGAGAGGGG + Intronic
1150368305 17:64611609-64611631 AGAGAGAAGTAGACAGATGAAGG - Intronic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151123412 17:71818416-71818438 AGAGAGAATGAGAGAGAGGGGGG + Intergenic
1151130558 17:71892628-71892650 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1151290791 17:73148351-73148373 AGAGAGATGGAGAGAGAGACGGG - Intergenic
1151391815 17:73792317-73792339 ACAGAGCTGGAGCCAGAGGCTGG - Intergenic
1151739433 17:75969886-75969908 AAAGAGAGCGAGAAAGAGGCCGG + Intronic
1151871686 17:76841076-76841098 ACAGAGAGGGAGAGAGAGACAGG - Intergenic
1151930512 17:77228993-77229015 AAGGAGAAGGAGACAGACGTGGG - Intergenic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152193887 17:78904806-78904828 AAAGAGACAGAGGCAGAGGCAGG + Intronic
1152272456 17:79332825-79332847 ATAGAGAAAGAGAGAGAGATGGG + Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1153320808 18:3772317-3772339 AGAGAGAAGGAGAGAAAGGAAGG - Intronic
1153331298 18:3878361-3878383 AAACACAAGGAGACAGTGGCAGG + Intronic
1153533299 18:6071833-6071855 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1153565560 18:6414605-6414627 AAAGAGAAAGAGAAAGAGCCTGG + Intronic
1153737107 18:8082526-8082548 AGAGAGAAGGGGAGAGAGGGAGG - Intronic
1155112212 18:22727179-22727201 ATATTGAAAGAGACAGAGCCAGG + Intergenic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155696336 18:28691178-28691200 AGAGAGAAAGAGAGAGAGCCAGG - Intergenic
1155833959 18:30554426-30554448 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
1156156015 18:34302481-34302503 ATAGAGAAAGAGATAGTGGTAGG + Intergenic
1156271417 18:35536568-35536590 AATGTGAAGGAGACAGAGGAGGG - Intergenic
1156274305 18:35568077-35568099 AGAGAGAATGAGAGAGAGGGAGG + Intergenic
1156354007 18:36325680-36325702 AAAGAGAAGGAGAAAGAGAGAGG - Intronic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156392045 18:36659891-36659913 GCAGAGAAGGAGACACAGACAGG - Intronic
1156519357 18:37708727-37708749 ATAGAGAAGTGGAGAGAGGAAGG - Intergenic
1156615298 18:38776210-38776232 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1156700971 18:39824406-39824428 TTAGAGAAGGTGAAAGATGCTGG - Intergenic
1156723839 18:40103426-40103448 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1156777704 18:40813423-40813445 AAAGAGAAACAGACAGAGACAGG - Intergenic
1156779705 18:40836852-40836874 ATAGAGAAAGAGGGAGAGGGAGG + Intergenic
1156898745 18:42276257-42276279 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1157002917 18:43549044-43549066 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1157005990 18:43585566-43585588 AGAGAGAAAGAGAGAGAGACGGG + Intergenic
1157105874 18:44773789-44773811 AGAGAGAGAGAGAGAGAGGCTGG - Intronic
1157106806 18:44781511-44781533 ATATAGAGAGAGACAGAGGTGGG - Intronic
1157177522 18:45465130-45465152 ATACAGAGTGAGACAGAGGAGGG + Intronic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1157543838 18:48533873-48533895 AGAGAGAGAGAGACAGAGGTGGG + Intergenic
1157711436 18:49852420-49852442 AAAGAGAGGGAGAGAGAGGGAGG + Intronic
1157996164 18:52558915-52558937 ATAGACAAGGAAACCGAGGTTGG + Intronic
1158141567 18:54261380-54261402 ATAGAAAAGGGGCTAGAGGCTGG + Intergenic
1158346176 18:56519224-56519246 AGAGAGAGAGAGACAGAGGGAGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158734026 18:60059151-60059173 AAAGAGAGGGACACAGAGGAGGG - Intergenic
1158807923 18:60997693-60997715 AGAGAGAAAGAGGCAGATGCAGG + Intergenic
1159551237 18:69897626-69897648 ATAGAGAAAGAGAGAAAGGAAGG + Intronic
1159610924 18:70524832-70524854 ATTGGGAAGGAAACTGAGGCAGG + Intergenic
1159755324 18:72356948-72356970 AGAGAGAAAGAGAGAGATGCAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160045580 18:75383983-75384005 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1160172574 18:76567273-76567295 ACAGAGAAAGAGACAGACGTGGG - Intergenic
1160238898 18:77108419-77108441 ATAGAAAAGGAAAGAGAGGGAGG + Intronic
1160257527 18:77259821-77259843 GGAGAGAGGGGGACAGAGGCAGG + Intronic
1160435107 18:78845596-78845618 ATAGAGACAGACAAAGAGGCAGG - Intergenic
1160505616 18:79425258-79425280 ACAGAGAGAGAGACAGAGACAGG - Intronic
1160700139 19:502136-502158 ACAGACAAGGAAACTGAGGCTGG - Intronic
1160758313 19:769894-769916 ACAGATAAGGACACTGAGGCTGG - Intergenic
1160771992 19:836471-836493 ACAGAGAAGGAGACAGAAAGAGG + Intergenic
1160840644 19:1145711-1145733 ACACAGAAGGAAACTGAGGCAGG - Intronic
1160944120 19:1633279-1633301 ATAGAGAGGGAAACCAAGGCAGG - Intronic
1160951169 19:1668089-1668111 GAAGAGAAAGAGACAGAGACAGG - Intergenic
1160991611 19:1862619-1862641 ACAGATAAGGAAACTGAGGCTGG + Intronic
1161029918 19:2052854-2052876 ACAGAGGAGGAGGCAGAGACTGG - Intergenic
1161036681 19:2088896-2088918 TTAAAGAGGGAGACAGAGCCAGG - Intronic
1161054032 19:2181002-2181024 ACTGACAAGGAGACAGAGGAAGG - Intronic
1161111363 19:2472487-2472509 ACAGAGAAAGAAACTGAGGCTGG + Intergenic
1161235189 19:3194131-3194153 ATAGTAAAGGAGGCTGAGGCGGG + Intronic
1161430356 19:4228809-4228831 AGAGAGAGAGAGACAGAGACAGG - Intergenic
1161527100 19:4763105-4763127 AAAGGGAAGAAGACAGAGGTTGG - Intergenic
1161560763 19:4971354-4971376 GGAGAGAAGGACACAGAGGACGG - Intronic
1161647825 19:5465234-5465256 AGAGAGAAGGAGTCAGTGGCCGG + Intergenic
1161649923 19:5478140-5478162 AGAAAGAAAGAGAGAGAGGCTGG + Intergenic
1161943779 19:7421902-7421924 AGGGAGAAGGGGACAGAGGTGGG - Intronic
1162158326 19:8694878-8694900 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1162340337 19:10087779-10087801 ATTGGGGAGGAGAGAGAGGCAGG + Intronic
1162550943 19:11357792-11357814 ACAGATAAGGAGACTGAGGTTGG - Intronic
1162567752 19:11453593-11453615 AGACAGAAAGAGACAGAAGCTGG - Exonic
1162569673 19:11464084-11464106 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1162717057 19:12640786-12640808 AGAGAAAAGGAAAAAGAGGCCGG + Intergenic
1162779292 19:12998307-12998329 AGAGGGAAAGAGAGAGAGGCAGG - Intronic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1162877798 19:13633798-13633820 AAAGAGAGAGAGACAGAGGAAGG - Intergenic
1163116870 19:15194293-15194315 GAAGAGAAGAAGACAGAGACAGG + Intronic
1163172403 19:15541391-15541413 AAAGAGACGAAGACAGAGACAGG - Intronic
1163175878 19:15563839-15563861 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1163216671 19:15884085-15884107 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1163492038 19:17622850-17622872 CCAGACAAGGAAACAGAGGCTGG + Intronic
1163505548 19:17703935-17703957 CAAGAGGAGGAGACGGAGGCAGG + Intergenic
1164434337 19:28216348-28216370 AGAGAGAGGGAAAGAGAGGCTGG - Intergenic
1164509242 19:28883972-28883994 AAAGAGAAGGAAAGAGAGGAGGG - Intergenic
1164522186 19:28988186-28988208 AAAGAAAAGGAGAGAGAGGAGGG + Intergenic
1164629044 19:29749190-29749212 CTGGAGAAGGACACAGAGGCAGG - Intergenic
1164684880 19:30159995-30160017 ATAGAGATGGAGGCTGAGGCAGG - Intergenic
1164954249 19:32367997-32368019 GTAGACATGGAAACAGAGGCTGG + Intronic
1164976538 19:32577038-32577060 AGAGAGAGAGAGACAGAGGGAGG - Intergenic
1165346985 19:35254644-35254666 ATAAAGAAGGAACCAGAGGTTGG + Intronic
1165393835 19:35553211-35553233 ACAGAGATGGACACAGAGACAGG + Intronic
1165421476 19:35724108-35724130 ATAGAGAAGGTGGCTGAGGGCGG + Intronic
1165491494 19:36126010-36126032 AGATATGAGGAGACAGAGGCTGG - Intergenic
1165701684 19:37943003-37943025 AGAGAGAGAGAGAAAGAGGCTGG - Intronic
1165840841 19:38788502-38788524 ACAGAGAAGGAGGCTGAGGCTGG - Intergenic
1165995340 19:39839972-39839994 TTAGTGAAGGAGACAAAGCCAGG + Intronic
1166004005 19:39894726-39894748 ACAGAGAGAGAGACAGAGACAGG - Intronic
1166110858 19:40622296-40622318 ATAGATAGGGAAACAGAGGGTGG - Intronic
1166162319 19:40963902-40963924 ATAGACAAGGGGAGAGAGACAGG + Intergenic
1166198730 19:41222608-41222630 AGAAAGTAGGAGACAGAGGCTGG + Intronic
1166212698 19:41317424-41317446 ACAGAGAAAGAGAGAGAGGCTGG + Intronic
1166215494 19:41331963-41331985 AAAGAGATGGGGAGAGAGGCAGG - Intronic
1166303176 19:41923556-41923578 AGGGACAAGGAGACAGGGGCAGG + Intronic
1166304171 19:41928252-41928274 ACAGCCAAGGAGACAGAGACGGG + Intronic
1166328938 19:42067812-42067834 ACAGCAAAGGAGACAGAGACAGG + Intronic
1166343656 19:42152527-42152549 AGAGAGAGAGAGGCAGAGGCAGG - Intronic
1166382832 19:42363672-42363694 AGAGAGAAAGAGAGAGAGGAGGG - Intronic
1166551060 19:43666528-43666550 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166913628 19:46179058-46179080 GGAGAGGAGGAGAAAGAGGCAGG + Intergenic
1167018213 19:46855747-46855769 AGAGAGAAAGAGAGAGAGGTTGG + Intergenic
1167084597 19:47300660-47300682 ACAGAGAAAGAGAGAGAGGAGGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167103979 19:47419772-47419794 AGAGACAAGGAGAGAGAGACTGG - Intergenic
1167104166 19:47420530-47420552 AGAGAGACAGAGACAGACGCGGG + Intergenic
1167419031 19:49392154-49392176 GGAGAGATGGAGACAGAGGAAGG + Intronic
1167424286 19:49422128-49422150 AGAGAGAAGGGGACAGAGATGGG + Intergenic
1167609034 19:50497348-50497370 AGAGAGGAGGAGTCAGAGACAGG + Intergenic
1167609413 19:50500095-50500117 AGAGAGACGGAGAGAGAGACAGG + Intergenic
1167669082 19:50839257-50839279 ACAGAGAGGGAGACGCAGGCAGG - Intergenic
1167682149 19:50930345-50930367 AAAGACAAGAACACAGAGGCCGG - Intergenic
1167779745 19:51591239-51591261 AAATAGTATGAGACAGAGGCTGG - Exonic
1167789699 19:51666613-51666635 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1168025430 19:53640294-53640316 AAAGGGAAAGAGACAGAGGCCGG + Intergenic
1168191690 19:54742924-54742946 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168193964 19:54759556-54759578 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168196009 19:54774281-54774303 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168197906 19:54789144-54789166 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168204374 19:54838527-54838549 ACAGAGAAAGAGCCAGAGGAAGG + Intronic
1168206600 19:54854700-54854722 ACAGAGAATGAGCCAGAGGAAGG + Intronic
1168236414 19:55066395-55066417 AGAGAAAAGGAGACAGAGAGAGG - Intronic
1168236668 19:55068026-55068048 AGAGAGAAGGAGACACAGGAGGG - Intronic
1168307615 19:55443853-55443875 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1168312284 19:55466552-55466574 ACAGTGAAAGAGACAGAGACAGG - Intergenic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
1202688493 1_KI270712v1_random:69021-69043 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
1202711457 1_KI270714v1_random:21530-21552 ACAGAGAAGGAAACTGAGGCTGG + Intergenic
925238610 2:2301241-2301263 AAAAAGACAGAGACAGAGGCAGG - Intronic
925332891 2:3072371-3072393 AGAAAGAGGGAGAGAGAGGCAGG + Intergenic
925760883 2:7183357-7183379 ATACAGAAGGACACACAAGCAGG + Intergenic
925864275 2:8212527-8212549 ATAGAGAAAGAGGGAGAGGAAGG - Intergenic
925886265 2:8395738-8395760 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
925887212 2:8403213-8403235 ATAGAGAGAGAGAGAGAGGAGGG - Intergenic
925944113 2:8844984-8845006 AGAGAGCAAGAGACAGAGACAGG + Intergenic
926013510 2:9427252-9427274 AAATAGAAGGAGACAGATGTGGG + Intronic
926438024 2:12857305-12857327 ATTGAGAGAGAGAAAGAGGCAGG - Intergenic
926527703 2:14002826-14002848 ATAGAGTAGAAGGCAGAGGGCGG + Intergenic
926729330 2:16024049-16024071 ATAGAGATAGTGATAGAGGCAGG + Intergenic
927246272 2:20959360-20959382 AGAGAGAAGGAGACAGATTTTGG + Intergenic
927499914 2:23575757-23575779 ATAGAGGAGGAGAGAGAGAGGGG + Intronic
927615737 2:24592917-24592939 AAAAAGAAGGGGACAGAGACAGG - Intronic
927732917 2:25491177-25491199 AGAGAGAGGGAGGAAGAGGCAGG + Intronic
927900761 2:26816731-26816753 ATAGGGGAGGGGACAGAGGATGG + Intergenic
927973029 2:27317570-27317592 GCAGAGAAGGAAACTGAGGCAGG - Intronic
928125000 2:28609214-28609236 AGAGAAAAGAAAACAGAGGCCGG - Intronic
928539534 2:32271565-32271587 AGAGAGAGAGAGACAGAGTCTGG + Intergenic
928746725 2:34424749-34424771 AAAGAGAAGGAGAGAAAGGAGGG + Intergenic
928786736 2:34896236-34896258 ACAGAGAGAGAGAGAGAGGCAGG - Intergenic
929242542 2:39666626-39666648 GGAAAGAAGGAGACAGAGGCGGG - Intronic
929330685 2:40676758-40676780 AAAGAGAAGGAGACAGAGAGAGG + Intergenic
929579997 2:43076009-43076031 AGAGAGAGAGAGACAGAGCCTGG - Intergenic
929685145 2:44026996-44027018 AGAGAGAGAGAGACAGAGGGAGG + Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930087334 2:47507096-47507118 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
930159342 2:48138189-48138211 AGAGAGAAGGAAAGAGAGGGGGG + Intergenic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930769689 2:55119088-55119110 CAAGGGAAGGAGACAGAGGTGGG + Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931171994 2:59813444-59813466 AAAAAAAAGAAGACAGAGGCTGG + Intergenic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931540753 2:63326517-63326539 AGAGAGAAAGAGACAGAGAGGGG + Intronic
931540759 2:63326597-63326619 AGAGAGAAAGAGACAGAGAGAGG + Intronic
931716500 2:65032965-65032987 AGAGAGAGAGAGAGAGAGGCCGG + Intergenic
932141144 2:69279175-69279197 TTAGAAAAGGAGGCGGAGGCTGG - Intergenic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932401618 2:71484680-71484702 ATAGAGTAGAATCCAGAGGCAGG - Intronic
932468740 2:71940198-71940220 AGAGAGGAGGAGGCAGGGGCTGG - Intergenic
932509926 2:72276044-72276066 AGAGAGATGGAGATAGAGGAGGG + Intronic
932887799 2:75562616-75562638 ACAGATAAGGAAACAGAGGTCGG - Intronic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933664062 2:84950476-84950498 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
933957927 2:87386907-87386929 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934147511 2:89110092-89110114 ATAGAAAAGGAGGCAAAGGGGGG + Intergenic
934221759 2:90090499-90090521 ATAGAAAAGGAGGCAAAGGGGGG - Intergenic
934242049 2:90278825-90278847 ATAGAGTAGGAAGCAGGGGCGGG + Intergenic
934271124 2:91537863-91537885 ATAGAGTAGGAAGCAGGGGCGGG - Intergenic
934607385 2:95707094-95707116 AAAGGGAAGAAGACAGTGGCTGG - Intergenic
934695957 2:96400297-96400319 ATACAGAAGGACAGAGAGTCTGG + Intergenic
934777782 2:96950036-96950058 ATGGAGACGGGGAAAGAGGCAGG + Intronic
934939859 2:98492874-98492896 ATAGATAAGGAGCCTGGGGCTGG + Intronic
935135351 2:100295671-100295693 AAAGGGATGGAGAGAGAGGCGGG + Intronic
935241172 2:101179396-101179418 ATAAGAAAAGAGACAGAGGCCGG - Intronic
935318230 2:101859090-101859112 CTACAGAATGAAACAGAGGCGGG - Intronic
935685180 2:105676748-105676770 AAAGAGAGGGAGAGAGAGGGAGG - Intergenic
936040523 2:109146000-109146022 ATAGACAAGGACACTGCGGCCGG - Intronic
936172217 2:110186173-110186195 AGAAAGAGGGAGAAAGAGGCTGG - Intronic
936567955 2:113595022-113595044 ATGGAGAAGATCACAGAGGCTGG - Intergenic
936776207 2:115976484-115976506 ATAGAGAAAGAAAGAGAGGAAGG + Intergenic
937107423 2:119330657-119330679 ATAGTGAAGGAGAGAGGGACGGG - Intronic
937298514 2:120824260-120824282 ATAGAGAGGGAGGAAGAGGGAGG + Intronic
937571737 2:123371395-123371417 ACAGAGAAAGAGAGAGAGACTGG + Intergenic
937680720 2:124641260-124641282 ACAGAGGAGGAGACTGAGGCTGG + Intronic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
937982667 2:127624464-127624486 AGGGAGGAGGAAACAGAGGCTGG - Intronic
938029817 2:127982397-127982419 CTAGAGGAACAGACAGAGGCAGG + Intronic
938289383 2:130141406-130141428 ACAGAGGAGGAAACTGAGGCAGG - Intronic
938467147 2:131531532-131531554 ACAGAGGAGGAAACTGAGGCAGG + Intronic
939031884 2:137086450-137086472 TCAGAGAAGGAGACAGAAGCAGG - Intronic
939095921 2:137833253-137833275 AGAGAGAAGGATAGAGAGGAAGG - Intergenic
939719177 2:145626143-145626165 AGAGAGAGGGAGACAGAGAGAGG + Intergenic
939986617 2:148835085-148835107 ATGAAGATGGAGGCAGAGGCTGG - Intergenic
940023885 2:149184704-149184726 CAAGAGAAAGAGACAGAGGTTGG - Intronic
940776950 2:157894782-157894804 ACAGAGAAGGAACCTGAGGCAGG + Intronic
940944897 2:159605039-159605061 AAAGAGAGAGAGACAGAGACAGG + Intronic
940987718 2:160064868-160064890 ACACAGAAGGAAACTGAGGCTGG - Intergenic
941060324 2:160840013-160840035 AAAGAGAGGGAGAGAGAGGGAGG + Intergenic
941176698 2:162205806-162205828 AATAAGAAGGAGACATAGGCCGG - Intronic
941270591 2:163422532-163422554 ATAAAGAAGAAGACATAGGAAGG + Intergenic
941311801 2:163941908-163941930 AGAGAGAAAGAGACAGAGAGAGG - Intergenic
941420078 2:165273592-165273614 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
941573794 2:167204533-167204555 ACAGATAAGGAAACAGAGACGGG - Intronic
941717923 2:168783173-168783195 AGAGAGAAGGAGAGAAAGGGAGG + Intergenic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942003963 2:171679106-171679128 AGAGACAGAGAGACAGAGGCAGG - Intergenic
942074623 2:172345340-172345362 ACAGAGAAAGAGAACGAGGCTGG + Intergenic
942158626 2:173158358-173158380 ATATAAAAAGAGGCAGAGGCAGG + Intronic
942223269 2:173791845-173791867 AGAGAGAAAGAAACAGAGGAAGG - Intergenic
942232819 2:173875703-173875725 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
942510950 2:176699915-176699937 ATAGACAAGCATACATAGGCAGG - Intergenic
943266490 2:185738841-185738863 CTAGAGAAGGAGAGCGGGGCGGG + Exonic
943751854 2:191517441-191517463 ATAAACAAGGAGATAGAGGCTGG + Intergenic
943828998 2:192434631-192434653 AGAGAGAGAGAGACAGAGGGAGG - Intergenic
944079426 2:195770399-195770421 AGAGAGAAGACGCCAGAGGCTGG - Intronic
944107620 2:196095943-196095965 AGAGAGACAGAGACAGAGTCAGG - Intergenic
944589711 2:201205529-201205551 CTAGAGAAGGAAAAAGAGGGAGG - Intronic
944677878 2:202049343-202049365 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
944786792 2:203079525-203079547 ATAGAGAAAGAAACAGAGGGAGG - Intronic
945321629 2:208430859-208430881 AAAGAGAGCCAGACAGAGGCCGG - Intronic
945438745 2:209851962-209851984 AAAGTGAAGGTGACAGAGGCTGG + Intronic
945499824 2:210557980-210558002 AGAGAGATGGAGACAGGGGGAGG + Intronic
946026687 2:216676179-216676201 CTAGAGGAGGAGACAGATCCGGG + Exonic
946212063 2:218155099-218155121 AAAGAGAAGGGGACAGAGAGAGG + Intergenic
946524676 2:220505546-220505568 CAAGAGAGGGAGAGAGAGGCAGG + Intergenic
946830826 2:223726619-223726641 AGAGAGAGGGAGAGAGAGGGAGG + Intergenic
947150686 2:227112128-227112150 CGATAGAAGTAGACAGAGGCTGG - Intronic
947540882 2:230976974-230976996 AGACAGACTGAGACAGAGGCGGG - Intergenic
947591383 2:231388132-231388154 ACAGAGAAGGAAACTGAGGCAGG - Intergenic
947605193 2:231481546-231481568 AGAGAGGATGACACAGAGGCAGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947801500 2:232931093-232931115 ATAGAAAAAGAGAGAGAGGAAGG + Intronic
947813094 2:233016581-233016603 AGAGAGAGGGAGAGAGAGGCAGG - Intergenic
947819490 2:233060231-233060253 AGAGAGAAAGAGAGAGAGGGGGG - Exonic
947941921 2:234064238-234064260 AGAGAGAGAGAGACAGAGGAAGG - Intronic
947955592 2:234187778-234187800 AGAGAGAAGGAGATGGAGGTGGG - Intergenic
948054895 2:235003752-235003774 ACAGTGATGGTGACAGAGGCTGG + Intronic
948238422 2:236408277-236408299 ACAGAGAAGGCCACACAGGCAGG + Intronic
948480696 2:238248341-238248363 AGAGAGCAGGAGAGAGGGGCTGG + Intronic
948596102 2:239080814-239080836 AGAGTGATGGAGACAGAGGCAGG - Intronic
948671430 2:239571124-239571146 AGAGAGGAGGAAACCGAGGCTGG - Intergenic
948861183 2:240753279-240753301 ATAGAGAGGTAAACTGAGGCAGG + Intronic
948951333 2:241253828-241253850 ATAAAGAATGAGACAGAGCACGG + Intronic
1168736636 20:145698-145720 CTAGAGCAGGAGACAGAGGCTGG - Exonic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1168953520 20:1818535-1818557 ATAGAGAGGGAGAGATGGGCTGG - Intergenic
1168980199 20:1997386-1997408 ACAGAGAAGGAAACAGAGGCTGG + Intergenic
1169020356 20:2326422-2326444 ATGGGGCAGGAGACAGAGGGAGG - Intronic
1169465389 20:5833618-5833640 AGAGAGAGAGAGACAGAGACAGG + Intronic
1169465391 20:5833650-5833672 AGAGAGAGAGAGACAGAGACAGG + Intronic
1169465393 20:5833680-5833702 AGAGAGAGAGAGACAGAGACAGG + Intronic
1169866002 20:10200674-10200696 AAAGAGATGGAGAGAGAGACTGG + Intergenic
1169941954 20:10946787-10946809 AAAGAGAAAGAGAGAGAGGGAGG - Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170456862 20:16541729-16541751 GAAAAGAAGGAGACTGAGGCAGG + Intronic
1170541375 20:17391891-17391913 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
1170633934 20:18088593-18088615 AGAGAGAGAGAGAAAGAGGCGGG - Intergenic
1170762334 20:19262105-19262127 ACACAGAAAGAGAGAGAGGCCGG + Intronic
1170788362 20:19487240-19487262 ATAAGGAAGGACTCAGAGGCTGG + Intronic
1170935372 20:20805029-20805051 GTAGAGAAGAAGGGAGAGGCTGG + Intergenic
1171038823 20:21740963-21740985 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1171136108 20:22695980-22696002 GTAGGTAAGGGGACAGAGGCTGG + Intergenic
1171270930 20:23816313-23816335 TTAGAGAAAGAGACAGAGAGAGG + Intergenic
1171896685 20:30815194-30815216 ATAGAGAGAGAGACAGAGAAGGG + Intergenic
1172228713 20:33322750-33322772 AGAAATAAAGAGACAGAGGCAGG + Intergenic
1172308251 20:33897167-33897189 AAAGAGAGAGAGAGAGAGGCTGG - Intergenic
1172779987 20:37430918-37430940 GATGAGAAGGAGACAAAGGCAGG - Intergenic
1172804683 20:37603348-37603370 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1172810151 20:37641533-37641555 AGAGAAAAGGAGAGAGAGTCTGG - Intergenic
1172842899 20:37912692-37912714 TTAGAGCAGGAGTCAGAGCCGGG + Intronic
1172877810 20:38176715-38176737 AAAGAGTAGGGGTCAGAGGCCGG + Intergenic
1173105502 20:40129665-40129687 ATATAGAAAGATAAAGAGGCAGG - Intergenic
1173198345 20:40934472-40934494 AGAGAAAAGGGGACAAAGGCAGG + Intergenic
1173333073 20:42091788-42091810 AAAGAGAGGGAGAGAGAGGGGGG + Intronic
1173420404 20:42896148-42896170 ATAGATAAGGAAACTGAGGCAGG + Intronic
1173483152 20:43419219-43419241 AAAGAGAGAGAGAGAGAGGCAGG + Intergenic
1173605723 20:44329963-44329985 AGAGAGCAGAAGACAGAGCCTGG + Intergenic
1174006316 20:47413836-47413858 ATAGTGAGGGAGGTAGAGGCCGG - Intergenic
1174103755 20:48147422-48147444 AGAGAGATGGAGAGAGCGGCAGG + Intergenic
1174390586 20:50216296-50216318 AGAGAGAAAGAGAAAGAGACAGG + Intergenic
1174423489 20:50415972-50415994 AGAGAGAAGGAAACAGAGGGAGG + Intergenic
1174694128 20:52540424-52540446 ATAGATGAGGAAACCGAGGCAGG + Intergenic
1174863789 20:54116242-54116264 TGAAAGAAGGAGAGAGAGGCTGG + Intergenic
1174880633 20:54275411-54275433 ACAGAGAAAAAGACAGAGCCTGG - Intergenic
1175175387 20:57108808-57108830 ATGAAGAAGGAGGCAGAGGCAGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1175921348 20:62451857-62451879 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
1175950137 20:62578997-62579019 AGACAGAAGGAGACAGAGACAGG - Intergenic
1175950149 20:62579097-62579119 AGAGAGACAGAGACAGAGGGAGG - Intergenic
1175963065 20:62646787-62646809 TTTGAGAAGAAGACGGAGGCTGG - Intronic
1176047812 20:63101722-63101744 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1176114428 20:63425065-63425087 GTAGAGACGGAGGCAGAGACGGG - Intronic
1176192245 20:63817416-63817438 ATAGAAAAAGAAAAAGAGGCCGG + Intronic
1176546408 21:8202862-8202884 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1176554314 21:8247286-8247308 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1176565359 21:8385909-8385931 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1176573236 21:8430310-8430332 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1177343950 21:19843751-19843773 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1177685515 21:24432825-24432847 AGATAGAAAGAGACAGAGGGAGG - Intergenic
1177706252 21:24709162-24709184 AGAGAGAGAGAGACAGGGGCAGG + Intergenic
1177930473 21:27276821-27276843 AGTGAGAAAGAGAGAGAGGCCGG + Intergenic
1177936056 21:27347974-27347996 AGAAAGAAAGAGAGAGAGGCCGG + Intergenic
1178157529 21:29872437-29872459 TCAGAGCAGGAGGCAGAGGCGGG - Intronic
1178348386 21:31851609-31851631 ATAGAGATGGAGACAGACAAAGG + Intergenic
1178503830 21:33147201-33147223 AGAGAGAATGAGAGAAAGGCAGG + Intergenic
1178598601 21:33976640-33976662 ACAGCGAGGGAGACAGAGGCTGG - Intergenic
1178667732 21:34563803-34563825 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1179020902 21:37640054-37640076 TTACAGAAGGAGACACAGGAAGG - Intronic
1179138389 21:38700478-38700500 ATAGATAAAGAAACAGAGGCAGG + Intergenic
1179367803 21:40774289-40774311 AGAGAGACATAGACAGAGGCTGG + Intronic
1179423299 21:41253001-41253023 ATAGTTAAAGAGACACAGGCAGG - Intronic
1179439842 21:41385713-41385735 ATAGAGAGAGGGAGAGAGGCTGG + Intronic
1179466907 21:41581841-41581863 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1179941802 21:44644529-44644551 AAAGAGAAGCAGACAGAAACAGG + Intronic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1180186870 21:46144564-46144586 AGAGGGAGGGAGACAGAGGGAGG - Intronic
1180243392 21:46527900-46527922 CTAGAGAGGACGACAGAGGCAGG - Intronic
1180552995 22:16555993-16556015 ATAGAGCAGGAAGCAGGGGCGGG + Intergenic
1180834581 22:18923448-18923470 ACAGGGAAGGAAACCGAGGCAGG - Intronic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181351096 22:22258446-22258468 ATAGAGCAGGAAGCAGGGGCGGG - Intergenic
1181902443 22:26168067-26168089 ATAAAGAAGGTGGCTGAGGCAGG - Intergenic
1182066524 22:27435248-27435270 ACAGACAGGGAGACTGAGGCCGG + Intergenic
1182111724 22:27728274-27728296 AGAAAGAAGGAGACAGAGAGAGG + Intergenic
1182399659 22:30066072-30066094 AGGGAGAGGGAGACAGAGGGAGG - Intergenic
1182546406 22:31079274-31079296 GCAGAGAGGAAGACAGAGGCAGG + Intronic
1182586807 22:31348083-31348105 ACAGAGAAAGAGAAAGGGGCCGG + Intergenic
1182595684 22:31418344-31418366 ATATTCAAGGAGACTGAGGCAGG + Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182888088 22:33793022-33793044 CCAGAGGAGGAGACGGAGGCAGG + Intronic
1182901818 22:33904583-33904605 ATACAGAAGAAGGCAGAGCCAGG + Intronic
1183007615 22:34916542-34916564 AGAGGGAGGGAGACAGAGGGAGG + Intergenic
1183007623 22:34916568-34916590 AGAGGGAGGGAGACAGAGGGAGG + Intergenic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183289558 22:36991376-36991398 CCAGAGCAGGAGACAGAGCCGGG - Intronic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183367911 22:37416976-37416998 AGAGAGGAGGAGACAGAGAAAGG - Intronic
1183445970 22:37855303-37855325 ATAGTTAATGATACAGAGGCAGG + Intronic
1183521852 22:38300229-38300251 ACAGAGAAGAAGCCTGAGGCAGG + Intronic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
1183705447 22:39472653-39472675 ACAAAGGAGGAGACTGAGGCTGG + Intronic
1183739242 22:39661078-39661100 AGTGAGATGGAGACAGAGGGAGG - Intronic
1183864387 22:40692743-40692765 ATAGAGAATGGGATAGAAGCAGG + Intergenic
1184361498 22:44021825-44021847 GTAGAGACGGAGGCAGAGACGGG + Intronic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184516809 22:44967171-44967193 AGAGACCAGGGGACAGAGGCCGG + Intronic
1184672621 22:46023370-46023392 ACACAGAAGGAAACTGAGGCTGG + Intergenic
1184863792 22:47191674-47191696 AGAGAGAGGGAGAGAGAGGTGGG + Intergenic
1184863838 22:47191849-47191871 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1184909019 22:47513618-47513640 ATGGAGATGAAGGCAGAGGCTGG - Intergenic
1185086430 22:48743331-48743353 ATGCAGACAGAGACAGAGGCGGG - Intronic
1185175964 22:49326869-49326891 AGAGAGACAGAGACAGAGGCTGG - Intergenic
1203251280 22_KI270733v1_random:119100-119122 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1203259320 22_KI270733v1_random:164328-164350 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1203284670 22_KI270734v1_random:148747-148769 ACAGGGAAGGAAACCGAGGCAGG - Intergenic
949373239 3:3358060-3358082 ATAGAGAAGGGAGCAGAGCCAGG + Intergenic
949689959 3:6624919-6624941 ACAGAGACAGAGACAGAGACAGG + Intergenic
949710277 3:6863063-6863085 ATAGGGAAAGACACAGAGGAGGG - Intronic
949825750 3:8163411-8163433 ATTAAGAAGGAGATAGAGGCAGG + Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
949898128 3:8785585-8785607 ATAGATAAGAAGTCAGAGGCTGG + Intronic
949961915 3:9319294-9319316 AAAGAGAAAGGGACAGAGGGAGG + Intronic
950184275 3:10935408-10935430 ACAGACAGGAAGACAGAGGCTGG - Intronic
950314491 3:11988494-11988516 ATTTAGAAGGGGACAGAGGTAGG + Intergenic
950471388 3:13188806-13188828 AGAGGGAAAGAGACAGAGCCAGG + Intergenic
950539821 3:13605025-13605047 ACAGAGAAGGACACTGAGTCTGG + Intronic
950716514 3:14851315-14851337 ATAGATGAGGAAACTGAGGCAGG + Intronic
951020931 3:17780042-17780064 AAATAGAAGGAGACAGAGAGAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951377918 3:21945214-21945236 AGAGAGAAAGAGACAGAGAGAGG + Intronic
951533459 3:23720349-23720371 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
951585599 3:24211965-24211987 ATAGAAAAGGAAATTGAGGCTGG + Intronic
951687865 3:25364539-25364561 ATAGACAAAGATTCAGAGGCTGG + Intronic
951703703 3:25522858-25522880 GCAGAGAAGGAGACCCAGGCTGG + Intronic
951923498 3:27881139-27881161 ATAGAGGAGGAGACTGAGACTGG - Intergenic
952580807 3:34831515-34831537 ACAGAGAAAGAGACAGCTGCAGG - Intergenic
952927491 3:38331378-38331400 AAAGAGTAGGAGTCAGAGGGTGG + Intergenic
952992001 3:38838306-38838328 AGAAAGAAGGATAGAGAGGCAGG - Intergenic
953082322 3:39632226-39632248 AGAGAGAAGGAGAGAGAGAGAGG - Intergenic
953156199 3:40376978-40377000 AAAGAGAAGAAGAGAAAGGCAGG + Intergenic
953242105 3:41158815-41158837 ATAGAGAGAGAGAGAGAGTCAGG + Intergenic
953256037 3:41291423-41291445 AGAGAGAAGGAGAGAGAAGGAGG + Intronic
953350018 3:42208479-42208501 AAAGAGAAGGGAACACAGGCAGG - Intronic
953463003 3:43096458-43096480 ATAGATTGGGACACAGAGGCTGG + Intronic
953943976 3:47129587-47129609 CAAGAGAAGGAGATACAGGCTGG + Intronic
954003177 3:47573651-47573673 ATGTGGAAGGATACAGAGGCAGG + Intronic
954436696 3:50500065-50500087 AGGGAGATGGAGACAGGGGCTGG + Intronic
954707880 3:52490675-52490697 ATGGAGAAAGGGACAGAGGGAGG - Intronic
954924311 3:54218853-54218875 ACAGTGAAGGAGAGAGAAGCAGG - Intronic
955086940 3:55711949-55711971 ATAGAGAAAGAGGTACAGGCTGG - Intronic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
955415362 3:58686567-58686589 ATAGACCAGGTGACAGATGCTGG - Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
955951266 3:64244639-64244661 ATAGAGAGGGAGAACGAGACAGG + Intronic
956231673 3:67023445-67023467 ATAAGGAAAGAGACAGAGGTGGG + Intergenic
956322599 3:68014461-68014483 CCAGAGTAGGAGTCAGAGGCTGG + Intronic
956846513 3:73188737-73188759 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956850999 3:73228113-73228135 AGAGAGAGGGAGAGAGAGGAGGG - Intergenic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957409449 3:79818958-79818980 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
958834592 3:99130012-99130034 ATAGAGCAGGAGAAAGAGAGAGG + Intergenic
959565270 3:107826689-107826711 ACAGTGAAGGTGACAGAGGATGG - Intergenic
959627641 3:108471038-108471060 AAAGAAAAGGAGAAAGAGGAAGG + Intronic
959683507 3:109122354-109122376 ACAGAGACAGAGACAGAGACAGG + Intergenic
959967162 3:112369230-112369252 ATAAAAAAGGAGACACAGGGAGG - Intergenic
960022175 3:112967085-112967107 ATAGGGAAAGAGACAGAGAAGGG - Intronic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960343586 3:116505137-116505159 AGAGAGAAAGAGAGAGAGGTGGG + Intronic
960376012 3:116902375-116902397 ATAGAGAGAGAGAGAGAGGGAGG + Intronic
960660626 3:120054225-120054247 CTAGGGAAGGAGAGAGAGGAGGG - Intronic
961009826 3:123428263-123428285 ACAGACAAGGAAACTGAGGCAGG + Intronic
961025523 3:123552310-123552332 ATAGGGAAAGAGAAAGAGGCAGG + Intronic
961103242 3:124219865-124219887 AGAGAGAGAGAGAGAGAGGCTGG - Intronic
961520049 3:127461864-127461886 ATACAGCAGGAGGAAGAGGCAGG + Intergenic
961861423 3:129919374-129919396 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
961928867 3:130512375-130512397 GTAGAGAAGTAAGCAGAGGCAGG - Intergenic
962075985 3:132082059-132082081 AGAGAGAAAGAGACAGAGAGAGG - Intronic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962336631 3:134537671-134537693 ATGGAAAAGGAGACAGAGGGAGG - Intronic
962522051 3:136206513-136206535 ATAAAGGAGGGGACAGAGGAAGG - Intergenic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962572443 3:136724154-136724176 ATAGAGGAGGGGAGAAAGGCGGG + Intronic
963124238 3:141800107-141800129 ATAAAGAACCAGACAGAAGCAGG + Intronic
963125288 3:141810378-141810400 AGAGAGAGGGAGAGAGAGGAAGG - Intronic
964202878 3:154137899-154137921 ATGGAGAAGGGGATAGAGACTGG - Intronic
964622316 3:158730411-158730433 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
965048137 3:163605947-163605969 ATGGAGAGAGAGAGAGAGGCTGG + Intergenic
965406446 3:168275096-168275118 ATAGAGCAGCAGACAGGAGCTGG + Intergenic
965449976 3:168825741-168825763 GTAGAGAAGGTGATACAGGCAGG - Intergenic
965514259 3:169604246-169604268 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
965597621 3:170423773-170423795 ATAAAGAAGGAGGCCGAGGTGGG + Intronic
965709779 3:171545608-171545630 AGAGAGAAAGAGACAGAGCATGG - Intergenic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966254589 3:177903337-177903359 AAAGAGAAAGAGACATTGGCTGG - Intergenic
966826678 3:183970731-183970753 TGACAGAAGGGGACAGAGGCTGG - Intronic
967188472 3:186965415-186965437 AGAGGGAGGGGGACAGAGGCTGG - Intronic
967572056 3:191041222-191041244 AAAGAGAGGGAGAGAGAGACAGG - Intergenic
968235698 3:197029181-197029203 ATGGAGGTGGAGACGGAGGCCGG - Intronic
968466123 4:752262-752284 ACAGAGAAGGTGGCAGATGCAGG - Intronic
968478192 4:822354-822376 AGACAGAGGGAGACAGAGACAGG - Intronic
968486941 4:867411-867433 GAAGAGAAGGAGGCAGAGACTGG - Exonic
968495280 4:911955-911977 AGAGAAAGGCAGACAGAGGCAGG + Intronic
968618810 4:1594324-1594346 AAGGAGAAGGGGACACAGGCTGG - Intergenic
968657648 4:1785588-1785610 AGAGAGCTGGACACAGAGGCTGG - Intergenic
968701981 4:2061660-2061682 CTATAGAAGGCCACAGAGGCTGG - Intronic
969264160 4:6054340-6054362 GAAATGAAGGAGACAGAGGCTGG + Intronic
969333998 4:6496023-6496045 ACAGAGGAGGAGGCAGAGACTGG - Intronic
969393974 4:6909242-6909264 ATAGATTAAGAGACTGAGGCTGG + Intronic
969404526 4:6981009-6981031 AAAAAAAAAGAGACAGAGGCCGG - Intronic
969597903 4:8159246-8159268 ACAGAGAGGGAAACTGAGGCGGG + Intergenic
969854007 4:9984711-9984733 GCAGAGAAGGGGACAGATGCTGG - Intronic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970502423 4:16691534-16691556 AGAGAGAAGGAGATGGAAGCAGG + Intronic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971116243 4:23648813-23648835 ATAGAGAAGAAAACAGTGGTGGG - Intergenic
971244315 4:24914307-24914329 AGAGTGAAAGAGACAGTGGCAGG - Intronic
971280748 4:25240860-25240882 AAAGAGAAGGAGACAGAGAGAGG - Intronic
971363213 4:25955447-25955469 CTAGGGAAGGGGCCAGAGGCAGG - Intergenic
971380779 4:26095603-26095625 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
971864211 4:32147734-32147756 AGAGAGAGAGAGACAGAGGAGGG + Intergenic
972031015 4:34458241-34458263 ATACAGACACAGACAGAGGCAGG + Intergenic
972619830 4:40736438-40736460 ATAGACAAGGAGTCAGATGTAGG + Intergenic
972651269 4:41019911-41019933 AAAGAGAAGGAGACAGAGAGAGG + Intronic
973260741 4:48160812-48160834 AAAGAGAGAGAGACAGAGGGAGG + Intronic
973302808 4:48607603-48607625 GAAGAGAAGGAGATAAAGGCTGG - Intronic
973743682 4:53942954-53942976 TTAGAGAAGGTCACAGAGGCTGG + Intronic
974205868 4:58702704-58702726 ATAGTGTAGGAGGCCGAGGCAGG - Intergenic
974387654 4:61223730-61223752 ATAGGGAAGCAGACAGAAACTGG - Intronic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974496159 4:62631195-62631217 AAAGAGAAGGAGAGTGAGACAGG + Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975437630 4:74371817-74371839 AAAAAGGAGGAGACATAGGCAGG - Intronic
975468108 4:74732958-74732980 AGAGAGAAAGAGAGAGAGGATGG + Intergenic
975690278 4:76956305-76956327 ATAGAGAAGGAAAATGAGACAGG + Intronic
976195788 4:82530120-82530142 AGAGAGATGGAGTCAGAGGGAGG + Intronic
976307847 4:83579142-83579164 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
976383895 4:84433369-84433391 ATAGAGAAAGAAGCAGAGACAGG + Intergenic
977287952 4:95132695-95132717 TGAGAGAAGGAGAGAGAGGCTGG - Intronic
977337862 4:95720853-95720875 ATAAAGAAGAAGACAGAGATTGG + Intergenic
977470270 4:97434786-97434808 AGAGAGAAGGAGAGAGGGCCAGG + Intronic
978068061 4:104430896-104430918 AGAGAGAAAGAGAGAGAGGATGG - Intergenic
978453006 4:108857299-108857321 AAAGAAAGGGAGACAGAGACAGG - Intronic
978665710 4:111178574-111178596 CAAGAGAAGGAGAAAGAAGCAGG - Intergenic
978992618 4:115104317-115104339 CTTGAGAAGGAGACAGATGGTGG + Intronic
979211117 4:118104310-118104332 ACAGAGAAGGAGACAGAGAGAGG + Intronic
979609447 4:122673732-122673754 AAAAAGAAGGACACAGTGGCAGG + Intergenic
979647207 4:123084632-123084654 AGAGAGACAGAGACAGAGACAGG + Intronic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980632821 4:135458612-135458634 ATAGAAATGCAGAAAGAGGCTGG - Intergenic
980882329 4:138724558-138724580 ATAGAGAAGGGGAAAGAGGCAGG - Intergenic
980959222 4:139458264-139458286 AAAGAGAGAGAGACAGAGACAGG - Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
981786595 4:148486603-148486625 AAAGAGAAGGAGACAGGGAGAGG - Intergenic
981901651 4:149871988-149872010 AGAGAGAGAGAGACAGAGACAGG - Intergenic
982013063 4:151125555-151125577 AGAAAGAAAGAGAGAGAGGCCGG + Intronic
982112962 4:152072917-152072939 ATAGAGAGAAAGAGAGAGGCAGG - Intergenic
982677467 4:158392403-158392425 ATAGAGAGAGAGACAGAGAGAGG + Intronic
982882089 4:160731948-160731970 AGAGAGAAAGAGACAGAGGGAGG - Intergenic
982995055 4:162333145-162333167 ATAGAGAAAGAGATACAGGTGGG + Intergenic
983379567 4:166974568-166974590 ATAGAGAAAGAGACAGAAAGAGG - Intronic
983672455 4:170254171-170254193 AGAAAGGAGGAGAAAGAGGCTGG + Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984107321 4:175564459-175564481 ATGAAGATGGAGACAGAGGTTGG + Intergenic
984312903 4:178086209-178086231 AGAGAAAGAGAGACAGAGGCAGG - Intergenic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984632615 4:182076496-182076518 ATAAAGAAGGAGAAAGAGGCTGG - Intergenic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
984922454 4:184777790-184777812 AGAGAGACAGAGACAGAGGGAGG + Intronic
985038963 4:185869424-185869446 AGACAGAAGGAGACTGAGACAGG - Intronic
985042344 4:185904305-185904327 TTAGAAATGGGGACAGAGGCTGG + Intronic
985115392 4:186585043-186585065 ATAGACAAAGAGAAAGAAGCAGG + Intergenic
985179466 4:187240917-187240939 ATAGAAAAGGAGAGAGAAGCTGG + Intergenic
985203444 4:187506900-187506922 CTAGAAAGGGAGGCAGAGGCTGG - Intergenic
985237498 4:187892012-187892034 ATGGATAAGTAGACAGAGGAAGG + Intergenic
985520905 5:373619-373641 ACAGAGGAGGAGACTGGGGCTGG + Intronic
985585840 5:733570-733592 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985599503 5:819344-819366 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985600261 5:824982-825004 AGAGAGATGGAGTGAGAGGCAGG - Intronic
985756639 5:1723396-1723418 ACAGAGGAAGAGACAGAGGCAGG - Intergenic
986001169 5:3631889-3631911 AAAGAGAAAGAAAGAGAGGCAGG - Intergenic
986051640 5:4095687-4095709 AGAGAGGACGAGACAGAGGGAGG - Intergenic
986285250 5:6354283-6354305 TCAGAGAGGGAGGCAGAGGCTGG + Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986285345 5:6354669-6354691 TGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986309862 5:6543944-6543966 AGAGAGAGAGAGACAGAGGAGGG - Intergenic
986329091 5:6704400-6704422 TTAGAGACACAGACAGAGGCTGG - Intergenic
986350216 5:6870657-6870679 ATTGTGAAAGAGACAGAGCCAGG - Intergenic
986680600 5:10229718-10229740 GTAGATAAGGAGACAGAGAGAGG - Intronic
986901100 5:12434503-12434525 AGAAAGAAGGAGAGAGAGGGAGG + Intergenic
987052250 5:14157410-14157432 AGAGAGAGGGAGACACAGGGAGG - Intronic
987064121 5:14271285-14271307 AAAGACAAGGCAACAGAGGCAGG - Intronic
987162242 5:15156225-15156247 AGAGAGAAGGAGAGAGAGAGAGG + Intergenic
987360591 5:17103014-17103036 ATAAAAAAGGAGAAAGAGGCCGG - Intronic
987448910 5:18056835-18056857 AGAGAGAGGGAGACAGAGAAGGG + Intergenic
988176608 5:27734614-27734636 ATAGAGAAGTTGAAAGAGACTGG + Intergenic
988277594 5:29101949-29101971 AGAAAGAAGGAAACAGAGGGTGG - Intergenic
988294103 5:29332686-29332708 ATAGAGAAAATGAGAGAGGCTGG + Intergenic
988491948 5:31712447-31712469 AGAGAGAGAGAGAGAGAGGCAGG - Intronic
988896442 5:35679320-35679342 AAACAGGAAGAGACAGAGGCGGG + Intronic
988920221 5:35934558-35934580 GGAGAGGAGGAGATAGAGGCTGG + Intronic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989345504 5:40425032-40425054 TTAGAGAAGGAGAAAGAGTTTGG - Intergenic
989959668 5:50396758-50396780 ATAGAAAAGGAGACTGAGGTAGG + Exonic
990048545 5:51465974-51465996 ATAGAGAAAGAGAGAGAGAGTGG - Intergenic
990050998 5:51500708-51500730 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
990536339 5:56726904-56726926 AGAGATGAGGAGACTGAGGCTGG + Intergenic
990602130 5:57369670-57369692 ATATAGAAGGAAACAGATGTTGG + Intergenic
990654176 5:57936086-57936108 AGGGAGGAGGATACAGAGGCTGG - Intergenic
990729793 5:58795826-58795848 ATAGAGAAAGAGAAAAAAGCAGG + Intronic
991348269 5:65693231-65693253 AGAGAGAAAGAGAGAGAGGAAGG + Intronic
991438468 5:66620713-66620735 AGAGAGATAGACACAGAGGCAGG - Intronic
991449146 5:66733212-66733234 GGAGACAGGGAGACAGAGGCAGG - Intronic
991502305 5:67289322-67289344 GTAGGGAAGGAGAGAGGGGCAGG + Intergenic
991981914 5:72241147-72241169 ATAAAGAAGGAGGCAAAGGCAGG - Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
992719255 5:79543667-79543689 ATAAAGAATGAGAAACAGGCTGG - Intergenic
993447314 5:88029230-88029252 AGAGAGAGAGAGAGAGAGGCAGG - Intergenic
994278950 5:97876741-97876763 ACAGAGAAGGAGTCAGGTGCTGG + Intergenic
994443380 5:99838919-99838941 ATAGAAAATGATAAAGAGGCCGG - Intergenic
995294138 5:110499135-110499157 ATAGAAAAGGAGAAAGAGCAGGG + Intronic
995582998 5:113620312-113620334 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
995764358 5:115600034-115600056 TTAGAGAGGGAGAGAGAGGTGGG + Intronic
995887159 5:116908471-116908493 GTAGAGAATGAGACAGAGCTGGG - Intergenic
996098939 5:119428312-119428334 AAAGAGAAGGAGACAGAGAGAGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
996279079 5:121705595-121705617 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
996453836 5:123657352-123657374 AGAGAGAAAGAGACAGAGTAAGG + Intergenic
996633830 5:125666976-125666998 AGAGAGAAAGAGAGAGAGGAGGG + Intergenic
996642405 5:125772010-125772032 AAGGTGAGGGAGACAGAGGCAGG + Intergenic
996681952 5:126237407-126237429 CTAGTGAAGGACACAGACGCCGG + Intergenic
997349709 5:133221771-133221793 AGAAATAAGGAGACAGAGTCGGG - Intronic
998388471 5:141772176-141772198 ACAGGGAAGGAGAGAGAGGCAGG - Intergenic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998532559 5:142899452-142899474 ATAGAGAAGGAGGCACAGGGAGG + Intronic
998859458 5:146428423-146428445 CAAGAGGAGGAGACAGAGCCAGG + Intergenic
998990728 5:147812904-147812926 AGAGAGACAGACACAGAGGCAGG + Intergenic
999138175 5:149337780-149337802 ATATAGAAAGGGACAGAGACTGG + Intronic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999454102 5:151700302-151700324 AAAGAGAGAGAGACAGAGGTGGG + Intergenic
999486763 5:152004564-152004586 ATAGGGTAGGAGACAGATGGTGG + Intergenic
999536570 5:152523810-152523832 ATAGAGAAGCAGGCAGATACTGG + Intergenic
999674045 5:153981367-153981389 AAAGAGAAGAAGACAGGGTCTGG - Intergenic
999693472 5:154168463-154168485 AAAGAGAAGGGGACAGTGCCAGG - Intronic
999955935 5:156701570-156701592 ATAGAGAAGGGAAGAGAGGCAGG + Intronic
1000079398 5:157830743-157830765 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000362714 5:160462803-160462825 ATAAAGGAAGAGAGAGAGGCAGG - Intergenic
1000585771 5:163096795-163096817 ACAGAGAAAAAGACAGAGGGAGG + Intergenic
1000669706 5:164045831-164045853 GTAGAAAGGGAGACTGAGGCGGG - Intergenic
1001245840 5:170105523-170105545 AGAGAGAAGGAAACCGAGGTGGG + Intergenic
1001634334 5:173198948-173198970 GGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1001651337 5:173318283-173318305 AGAGAGAGAGAGAGAGAGGCTGG + Intronic
1001663509 5:173413793-173413815 ACAGAGAGGGAAGCAGAGGCAGG - Intergenic
1001778444 5:174346868-174346890 ATAGAGAAGGAGGAAGAGCATGG - Intergenic
1001987773 5:176090145-176090167 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1002229097 5:177748007-177748029 AGAGAGAGAGAGAGAGAGGCAGG - Intronic
1002266249 5:178035776-178035798 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1002304044 5:178273076-178273098 CTAGAGCAGGAGAGAGCGGCCGG - Intronic
1002395511 5:178949909-178949931 ATTAAGAATGAAACAGAGGCCGG - Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002795681 6:469454-469476 ACAGAGAGAGAGACAGAGACAGG - Intergenic
1002833898 6:849185-849207 AGAGAGAAGGAGAGAGAGAGTGG + Intergenic
1002850905 6:995635-995657 AGAGGGAAGGAGGCAGGGGCTGG - Intergenic
1003138586 6:3453440-3453462 ATGCAGAAGGCGAGAGAGGCTGG + Intronic
1003255120 6:4468303-4468325 ATAGAAATGGAAACAAAGGCTGG - Intergenic
1003514557 6:6807094-6807116 AAAGAGAAGTAAACAGGGGCGGG + Intergenic
1003700546 6:8459951-8459973 ATCAAGAAGTAGAAAGAGGCTGG - Intergenic
1003898173 6:10627877-10627899 AGAAAGGAGGAGACAGAGGGAGG + Exonic
1004036217 6:11926574-11926596 ACAGAGAAAGAGAGAGAGGGAGG + Intergenic
1004036219 6:11926584-11926606 AGAGAGAGGGAGGCTGAGGCAGG + Intergenic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1004305929 6:14502007-14502029 GAAGAGGAGGAGACAGAGCCGGG + Intergenic
1004399192 6:15272738-15272760 ACAGAGATTGTGACAGAGGCAGG - Intronic
1004822045 6:19377862-19377884 AGAGAGGAGGAGACAGTGGCAGG - Intergenic
1005248175 6:23912920-23912942 AGAGAGACAGAGACAGAGGTTGG - Intergenic
1005459435 6:26054498-26054520 AGAGACAGGAAGACAGAGGCAGG - Intergenic
1005626773 6:27669839-27669861 ATGGTGGAGGAGAGAGAGGCTGG - Intergenic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1006113104 6:31760663-31760685 ATAGGGAAGGAGACAGGGCCTGG - Intronic
1006151542 6:31992683-31992705 ATAGGAAAGGATACAGAGCCAGG - Intronic
1006157843 6:32025421-32025443 ATAGGAAAGGATACAGAGCCAGG - Intronic
1006187376 6:32189114-32189136 AGAGGGAGAGAGACAGAGGCTGG + Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006289804 6:33126012-33126034 AGAGAGCAGGAACCAGAGGCAGG + Intergenic
1006835793 6:36998218-36998240 ATAGAGAAGGAGCCTGTCGCTGG + Intergenic
1007002262 6:38325263-38325285 AAAGAGAAGGGAACAGAAGCAGG + Intronic
1007115970 6:39343542-39343564 CTCGAGAAGGAATCAGAGGCTGG + Intronic
1007143362 6:39600621-39600643 ATAGAGAAGGAGAAAGTGACTGG - Intronic
1007240241 6:40419671-40419693 ATGAAGACAGAGACAGAGGCAGG - Intronic
1007243694 6:40444881-40444903 ATCATGAAGAAGACAGAGGCAGG - Intronic
1007361150 6:41356870-41356892 ATAAAAAAGGATACAGGGGCAGG - Intergenic
1007388103 6:41532891-41532913 AGACAGATGGAGGCAGAGGCTGG + Intergenic
1007415245 6:41687820-41687842 AAAGAGAAGGAGAGAGGAGCTGG + Intronic
1007478300 6:42133804-42133826 TCATAGAAGGAGACAGGGGCGGG + Intronic
1007522841 6:42465689-42465711 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007550876 6:42728562-42728584 AGAGAGAGAGAGAGAGAGGCTGG + Intergenic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007836576 6:44678597-44678619 ACAGAGGAGGAGACAGAGAGGGG - Intergenic
1007944869 6:45817266-45817288 AGAGAGAAGGAGAGAGAGAGGGG + Intergenic
1007946506 6:45832035-45832057 ATAGGGGAGGAGAAAGAGGGAGG - Intergenic
1007959493 6:45946154-45946176 ATAGAGAGGTGGCCAGAGGCAGG + Intronic
1007988578 6:46232074-46232096 ATACAGAAGAAGACAGTGACAGG + Intronic
1008130034 6:47710700-47710722 AAAGAGAAAGAGAGAGAGACAGG - Intronic
1008179690 6:48313004-48313026 AAATAGAAGGAGGAAGAGGCAGG + Intergenic
1008892469 6:56511013-56511035 AAAGATAAGGAGATAAAGGCTGG + Intronic
1009233839 6:61098254-61098276 ATAGTCAAGGAGACAGGTGCTGG - Intergenic
1009407288 6:63327780-63327802 AAAGAGAAAGAGACAGAGAGAGG - Intergenic
1009471229 6:64030100-64030122 AAAGAGAAAGAGACAGAGAGAGG + Intronic
1009602935 6:65826566-65826588 ATAGAGAAGGGAACAGAGTGTGG - Intergenic
1010007500 6:71011633-71011655 AAAGAGAAGGGGACAGAGACAGG - Intergenic
1010065837 6:71681497-71681519 TTAGATTAGGAGACAGAAGCTGG - Intergenic
1010373824 6:75142823-75142845 CTAGAGAAGGACACAGAGAAAGG - Intronic
1010494562 6:76517479-76517501 ATAGAGAATAATACTGAGGCAGG + Intergenic
1010574014 6:77510324-77510346 AGAGAGGAGAAGAGAGAGGCTGG + Intergenic
1010595390 6:77756673-77756695 AGAGAGAAGGAGAAGGCGGCGGG - Intronic
1010927573 6:81762550-81762572 AGAATGAAAGAGACAGAGGCAGG + Intergenic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011012151 6:82714729-82714751 AGAGAGAAGGAGGAAGAGCCAGG + Intergenic
1011042705 6:83048190-83048212 ATAGAGGAGGAGACTTGGGCAGG + Intronic
1011704010 6:89983137-89983159 TTAAAGAAGGAGGCAGAGGATGG - Intronic
1011963371 6:93120400-93120422 ATAGAGAATGAGTGAGAGGGAGG - Intergenic
1012085597 6:94822356-94822378 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012085605 6:94822422-94822444 AGAGAGAAGGAGAGAGAGAAGGG - Intergenic
1012194812 6:96328234-96328256 ACAAAGAAGGAAACAGACGCTGG + Intergenic
1012218474 6:96618394-96618416 AAAGAGAAAGAGTCAGAGGAAGG + Intergenic
1012512398 6:100018184-100018206 GTAGAGAAAGAGAGAGAGGTAGG + Intergenic
1012921564 6:105225507-105225529 ATAAAGAAAGTGACAGGGGCTGG - Intergenic
1012957414 6:105586393-105586415 CGAGAGAAAGAGAGAGAGGCAGG + Intergenic
1013270552 6:108542000-108542022 AGAGAGAAGGAGGGAGAGGGAGG - Intergenic
1013656733 6:112254332-112254354 AGAGAGAGGGAGAGAGAGGCTGG - Intronic
1013999889 6:116352919-116352941 AGAGAGAAAGAGAGAGAGGAAGG - Intronic
1014126147 6:117779325-117779347 AGAGGGAAGGAGATAGAGGAAGG - Intergenic
1014826725 6:126055367-126055389 ATAGTGAAGGAGAAGCAGGCAGG - Intergenic
1014881081 6:126725400-126725422 ATAAAGGAGGAGAAAGGGGCAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015540502 6:134308929-134308951 AGAGAGAAAGAGAGAGAGACAGG + Intronic
1015966834 6:138702688-138702710 AGAGAGAAAGAGACAGAGAAGGG - Intergenic
1016320940 6:142845399-142845421 AGAGAGAAAGAGAGAGAGGGAGG - Intronic
1016460508 6:144276130-144276152 AAAGAGGAGAAGACAGAGGGTGG + Intergenic
1016645270 6:146399736-146399758 AGAGAGAAAGAGACAGAGAAAGG - Intronic
1017509385 6:155100267-155100289 ATAGAGCAGGAGGCAGGAGCAGG + Intronic
1017574142 6:155782663-155782685 TTATAGAAGGAGAGAGAGACTGG - Intergenic
1017644026 6:156522476-156522498 ACAGAGACAGAGACAGAGGAGGG - Intergenic
1017901722 6:158723809-158723831 ACAGCGGAGGAGCCAGAGGCTGG - Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1018302651 6:162419762-162419784 ATAGAGACAGAGCCAGAGACAGG + Intronic
1018335564 6:162785195-162785217 AGAGAGAGGGAGAGAAAGGCAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018682155 6:166273513-166273535 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1018859560 6:167700968-167700990 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1018933353 6:168256880-168256902 ACAGAGAGGGAGACAGAGAGAGG - Intergenic
1018933438 6:168257592-168257614 ACAGAGAGAGAGACAGAGACAGG - Intergenic
1018961665 6:168453615-168453637 AGAGACAAAGAGACAGAGACAGG - Intronic
1019013806 6:168864935-168864957 ATGGAGAAAGAGACAGAGAGAGG + Intergenic
1019132569 6:169888099-169888121 ATACAGAAGGGCACAGAGGCAGG - Intergenic
1019158112 6:170052502-170052524 AGACAGAAGGAGAGAGAGGGAGG - Intergenic
1019162038 6:170075467-170075489 AGAGAGAAGGGGAGAGAGGGAGG + Intergenic
1019332423 7:466924-466946 AAACAGTAGGAGGCAGAGGCCGG + Intergenic
1019346639 7:534059-534081 AGAGAGAGGGAGACAGAGACCGG - Intergenic
1019361063 7:604396-604418 CTAGAGATGGAAACTGAGGCAGG - Intronic
1019491416 7:1315217-1315239 AGAGATGAGGAGACCGAGGCTGG - Intergenic
1019495487 7:1337766-1337788 AGAAAGAAGGAGAGAGAGGAGGG - Intergenic
1019497092 7:1345758-1345780 ACAGAGACAGAGACAGAGACAGG + Intergenic
1019570496 7:1709348-1709370 AAGGAGATGGAGACAGAGCCAGG + Intronic
1019705056 7:2493642-2493664 AGAGAGCAGGGGACAGAGACAGG - Intergenic
1019712335 7:2523450-2523472 ACAGGGAAGGAAACTGAGGCTGG + Intronic
1019772793 7:2894337-2894359 AGAGAGAAGGAGAAGGAGGCAGG - Intergenic
1019812823 7:3176968-3176990 GTAGAGAAGGAGGCAGAGATTGG + Intergenic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1019962620 7:4473545-4473567 AGAGGGAGAGAGACAGAGGCAGG + Intergenic
1019964085 7:4484702-4484724 AGAGAGAAGGGGAGAGAGGAGGG + Intergenic
1019983421 7:4638443-4638465 GTAAAGAAGAAGGCAGAGGCTGG - Intergenic
1020011358 7:4807556-4807578 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020011369 7:4807594-4807616 AGAGAGAAGGAGAGGGAGGAGGG - Intronic
1020083177 7:5297213-5297235 ACAGAGAAGGGAACAGAGGTGGG - Intronic
1020083180 7:5297225-5297247 ACAGAGAAGGGGACAGAGAAGGG - Intronic
1020164955 7:5800495-5800517 AAAGGTAAGGAGGCAGAGGCAGG - Intergenic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020423229 7:8034723-8034745 AAAAAGAAGGAAAAAGAGGCTGG + Intronic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021695239 7:23269909-23269931 ACAGAGAAGGGGAGAGAGGAAGG - Intronic
1021944940 7:25717167-25717189 ACAGAGGAGGAAACTGAGGCAGG + Intergenic
1022063592 7:26826659-26826681 ATATAGAAGGAGAAAGAAGACGG - Intronic
1022105893 7:27198073-27198095 AAAGAGAAAGAGACAGAGACTGG - Exonic
1022172619 7:27844286-27844308 ATAAAGCAGAGGACAGAGGCTGG - Intronic
1022508516 7:30921401-30921423 AGAGAGAAGGAGAGACAGGGAGG + Intronic
1022524950 7:31030901-31030923 ATATAGAAAGAGCCACAGGCTGG - Intergenic
1022592674 7:31680755-31680777 ATAGACCAGGACCCAGAGGCTGG + Intergenic
1022687516 7:32610449-32610471 ATAGAGATGGAGTCTCAGGCTGG - Intergenic
1023021666 7:36016962-36016984 AGAGACAAAGAGAGAGAGGCAGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023528414 7:41129271-41129293 AGAGAGAAAGAGAAAGAGGTTGG - Intergenic
1023784319 7:43691326-43691348 AAAGAGAAAGAGAGAGAGGGAGG + Intronic
1023847083 7:44128421-44128443 ATTGAGAAGGGGACAGATACTGG + Intergenic
1023958321 7:44905757-44905779 ATGGAGTCTGAGACAGAGGCAGG - Intergenic
1024178085 7:46861494-46861516 ACAGAGGAGGAGCCAGAGGTTGG - Intergenic
1024364876 7:48509287-48509309 CTGGACCAGGAGACAGAGGCTGG - Intronic
1024368887 7:48557885-48557907 GAAGAGAAAGAGATAGAGGCAGG - Intronic
1024614290 7:51096046-51096068 ACAGAGAAAGAGACAGAGATAGG - Intronic
1024686787 7:51754575-51754597 ATATAGAAAGAGACAGAGTCAGG - Intergenic
1024711589 7:52021013-52021035 ATAGAGACAGAGACAGAGAGAGG + Intergenic
1025247500 7:57328402-57328424 AGAGAGAAGAAAACAGAGGGAGG - Intergenic
1025269949 7:57501124-57501146 ATTAAGATAGAGACAGAGGCAGG - Intergenic
1025297185 7:57784649-57784671 AGAGAGAAAGAGACAGAGAAAGG + Intergenic
1025626898 7:63230817-63230839 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1025626910 7:63230863-63230885 AGAGAGAGGGAGACAGAGGGAGG + Intergenic
1026299812 7:69087798-69087820 AGAGAGAGAGAGAGAGAGGCCGG + Intergenic
1026335213 7:69388371-69388393 AGAGAGAGGGAGAGAGAGACAGG - Intergenic
1026470405 7:70690104-70690126 CTAGATAAGGAAACTGAGGCAGG + Intronic
1026494169 7:70888276-70888298 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026494181 7:70888332-70888354 AAAGAGAGGGAGAAAGAGGGAGG + Intergenic
1026555977 7:71408865-71408887 ACAGAGACAGAGACAGAGACAGG - Intronic
1026718831 7:72813470-72813492 TTAGAGAAGCAGTTAGAGGCTGG - Intronic
1026967759 7:74451251-74451273 AAAGAAAAAGAGAAAGAGGCAGG + Intergenic
1027179963 7:75931727-75931749 AAAGGGAAGGAGACAGAGTGGGG - Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027887302 7:83925022-83925044 ATAGAGAGAGAGACAGAGAGCGG - Intergenic
1027947686 7:84770138-84770160 ATAGAAATTGTGACAGAGGCAGG - Intergenic
1028297715 7:89155955-89155977 AAAGAGAGAGAGACAGAGGAGGG - Intronic
1028696397 7:93717793-93717815 AGAGAGAGGGAGAGAGAGGAAGG + Intronic
1028879274 7:95861141-95861163 GTAGATAAGGTGGCAGAGGCAGG - Intronic
1028928739 7:96389468-96389490 ATAGAGAAGGAGGTATAGGGAGG - Intergenic
1029026323 7:97420741-97420763 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1029162201 7:98560396-98560418 ATAGAGAAAGAGGCAGAGAGGGG + Intergenic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029243386 7:99180628-99180650 ACAGAGACGGAGAGAGAGACGGG - Intronic
1029303814 7:99604304-99604326 AGAGGGAAGGAGACAGTGGCTGG - Intronic
1029538448 7:101169241-101169263 AGAGAGAAAGAGACAGAGATGGG + Intergenic
1029601438 7:101565799-101565821 ACTCAGAAGGAGGCAGAGGCTGG - Intergenic
1029720660 7:102362311-102362333 AGAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029745245 7:102512723-102512745 AGAGAGAAGGGGAGAGAGGGAGG + Intronic
1030136291 7:106253843-106253865 ATAGAGCAAGGGACAGAGGCAGG - Intronic
1030345010 7:108423301-108423323 AAAGTGAAGGAGAAAGAGTCAGG + Intronic
1030473516 7:109998834-109998856 ACAGAGAAGGCCACACAGGCAGG + Intergenic
1030926494 7:115461821-115461843 AGAGAGAAGCAGAGAGAGTCAGG - Intergenic
1031002303 7:116430451-116430473 AGAGAGAAAGAGAGAGAGACAGG - Intronic
1031021903 7:116638147-116638169 AGAGAGAGGGAGACGGAGGGAGG - Intergenic
1031148401 7:118023818-118023840 AGAGAGATGGAGAGAGAGGGAGG + Intergenic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031379956 7:121073394-121073416 GTGGAAAAGGAGGCAGAGGCAGG + Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031545845 7:123050525-123050547 ATAGAAAAGGAGAAACAGCCGGG - Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031936816 7:127743509-127743531 GAAGAGAAGGAGAGAGAGGGTGG - Intronic
1032222171 7:130002739-130002761 ATAGACATGGAAACAGATGCCGG + Intergenic
1032254154 7:130283852-130283874 CTAGAGAAGGAGAAAAAGGATGG + Intronic
1032605491 7:133346319-133346341 ATGGAGAAGCAGACAGAAGCAGG - Intronic
1033621311 7:143064207-143064229 CTAGAGAAGGAGACAGACGAGGG - Intergenic
1033671824 7:143500488-143500510 TTAGAGCAGGGGACAGAGACAGG - Intergenic
1033732236 7:144191284-144191306 CTAGAGAAGAAGGCAGAGCCAGG - Intronic
1033743087 7:144289869-144289891 CTAGAGAAGAAGGCAGAGCCAGG - Intergenic
1033750811 7:144359730-144359752 CTAGAGAAGAAGGCAGAGCCAGG + Intronic
1033916753 7:146335789-146335811 ATAGAGAAGGTGTTAGAGACTGG + Intronic
1033942353 7:146671375-146671397 AAAAAGAAAGAGACAGAGGTGGG - Intronic
1034098328 7:148429931-148429953 ATAAAGAAGAAAAGAGAGGCCGG + Intergenic
1034446591 7:151116933-151116955 GCAGAGAAGGGGACAGAAGCCGG - Intronic
1034575306 7:151991629-151991651 ATAGAGCAGAAGAGAGATGCTGG - Intronic
1034992185 7:155554959-155554981 AGAGAGGTGGAGACAGAGTCAGG - Intergenic
1035117822 7:156539686-156539708 AGAGAGAGGGAGAGAGAAGCAGG - Intergenic
1035240332 7:157524814-157524836 ACAGAGAAGGAGGCAGAGAGAGG + Intergenic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035534791 8:382653-382675 AGAGAGAGGGAGGCAGAGACAGG + Intergenic
1035562486 8:616633-616655 ACAGAGAAGGAGAGACAGACGGG + Intronic
1035723214 8:1808398-1808420 AAAGACAAGCAGACACAGGCTGG + Intergenic
1035727361 8:1833360-1833382 ACAGAGGCAGAGACAGAGGCAGG + Intronic
1035727367 8:1833420-1833442 ACAGAGACAGAGACAGAGGCAGG + Intronic
1036077989 8:5522439-5522461 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1036164782 8:6422561-6422583 ATAGAGAATGAGTCAGGGGCTGG - Intronic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036205974 8:6806067-6806089 TCAGAGGAGGAGACAGAGACAGG + Intergenic
1036779039 8:11633273-11633295 AGAGAGCAGGAGAGATAGGCAGG - Intergenic
1037231067 8:16659580-16659602 ATATAGAAGGACAGAGAGGGAGG - Intergenic
1037753406 8:21696922-21696944 AGAGGGAAGGGGACAGAGGAAGG + Intronic
1037896490 8:22659753-22659775 AAAGAGACGGAGACACAGGAAGG - Intronic
1037932377 8:22889302-22889324 AAACAGCAGGAGGCAGAGGCTGG + Intronic
1038148271 8:24918169-24918191 AAAGAGAAGGAGAAAGCGGGAGG + Exonic
1038328141 8:26587884-26587906 ATAGAGGGGAAGACTGAGGCCGG + Intronic
1038563907 8:28603660-28603682 AGAGAAAAGGAGAGAGAAGCGGG + Intronic
1038734226 8:30154925-30154947 AGAGAGAAGTAGGCAGGGGCTGG + Intronic
1038906534 8:31910309-31910331 ATGAAAATGGAGACAGAGGCGGG + Intronic
1039108324 8:34014203-34014225 ATTGAACAGGAGACAGAGTCAGG + Intergenic
1039390872 8:37179916-37179938 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1039660595 8:39459201-39459223 ACAGAGACAGAGAGAGAGGCAGG + Intergenic
1039845100 8:41320497-41320519 AGAAAGAAGGAGAGAGAAGCGGG - Intergenic
1040095197 8:43435888-43435910 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1040384235 8:46902787-46902809 GTAGAGAAGGAAAGAGAGGTAGG + Intergenic
1040472360 8:47744886-47744908 AAAGAGAAAGAGAGAGAGGGAGG + Intergenic
1040478244 8:47799788-47799810 ATAGTGAATGAGACGGAAGCAGG + Intronic
1040704694 8:50111398-50111420 AGAGAGAAAGAGACAGAGAGAGG - Intronic
1040873083 8:52120848-52120870 CAAGAGAAGGAGACAGACTCAGG + Intronic
1041094827 8:54339468-54339490 AGAGAGAGAGAGAGAGAGGCTGG + Intergenic
1041257869 8:55995051-55995073 AGACAAAAGGAAACAGAGGCAGG + Intronic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1041313522 8:56539548-56539570 AGAGAGAAGGAGAGAGAGAGAGG + Intergenic
1041494155 8:58467735-58467757 AGAGAGAGAGAGACAGAGACAGG + Intergenic
1041698149 8:60759434-60759456 AGAGAGAGGGAGACAGAGAGCGG - Intronic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1041801922 8:61809639-61809661 AAAGTGAAAGAGACAGAGACAGG - Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042849299 8:73199909-73199931 ATAAAGACAGAGAGAGAGGCTGG - Intergenic
1043156941 8:76794843-76794865 ATAGAGATGGAGAAGGCGGCTGG + Intronic
1043360572 8:79466994-79467016 ACTAAGATGGAGACAGAGGCAGG - Intergenic
1043372461 8:79611060-79611082 CTAGAGAAAGAGCAAGAGGCAGG - Intronic
1043934774 8:86130785-86130807 ATGGGGAAGAGGACAGAGGCAGG - Intronic
1043970197 8:86520030-86520052 ATAGAGATGGAGACTGAGTTTGG + Intronic
1043998221 8:86844929-86844951 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1044386534 8:91595476-91595498 ATGGAGCAGGAGACAGACCCAGG + Intergenic
1044450341 8:92328992-92329014 AGAGAGAAAGAGAGAGAAGCAGG - Intergenic
1044587895 8:93885052-93885074 AGAGAAAAGGAGAAACAGGCAGG + Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045189480 8:99868837-99868859 GTAGAGAATGAGACAGAGTGTGG + Intronic
1045371904 8:101532838-101532860 AGAGAGAAAGAGAAAGAGGTGGG + Intronic
1045508016 8:102792299-102792321 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1045546151 8:103130524-103130546 ATAGAGAGAGAGAAAGAGGATGG - Intergenic
1045714006 8:105020348-105020370 AGAGAGGAGGAGAGAGAGACTGG + Intronic
1045911907 8:107419699-107419721 AGAGACAAGGAGAGAGAGACAGG + Intronic
1045947894 8:107817498-107817520 AGAGAGAGGGAGACAGAGAGAGG + Intergenic
1046048300 8:108988772-108988794 AAAGAGAAAGAGAGAGAGGCAGG + Intergenic
1046205046 8:110983243-110983265 AGAGAGAGGGAGAGAGAGGGAGG - Intergenic
1046231123 8:111360068-111360090 ATAGAGAGAGAGAGAGAGCCAGG + Intergenic
1046314068 8:112477609-112477631 ATAGAGAATGAGAGAGAGAATGG - Intronic
1047412704 8:124637313-124637335 CTAGAGAGGGAGACAGAGTCAGG + Intronic
1047723985 8:127668825-127668847 TAAGAGAACAAGACAGAGGCAGG + Intergenic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048169397 8:132091003-132091025 ACAGAGAAGGAGGCCGAGGCGGG - Intronic
1048225994 8:132586125-132586147 TTAGAGAAGGAGAGAGAGAACGG + Intronic
1048231934 8:132651072-132651094 ACAGAACAGGAGATAGAGGCTGG - Intronic
1048526646 8:135208869-135208891 ACAGACAAGAAGACAGAGTCAGG + Intergenic
1048667042 8:136674027-136674049 ATAGTGGAGTACACAGAGGCTGG - Intergenic
1048987776 8:139744435-139744457 TCAGACAGGGAGACAGAGGCTGG + Intronic
1049249643 8:141581397-141581419 ACAGAGAAAGAGACAGAGACAGG + Intergenic
1049345247 8:142135463-142135485 AGAGAGAAAGAGACAGAGAGAGG + Intergenic
1049358440 8:142200198-142200220 ATACAGAAGGAAACAGAGGTGGG - Intergenic
1049397707 8:142409282-142409304 AAAGAGAAGGAGAGAGGGGAAGG + Intergenic
1049416762 8:142498948-142498970 CAAGAGAGGGAGAGAGAGGCTGG - Intronic
1049884575 9:18498-18520 ATGGAGAAGATCACAGAGGCTGG + Intergenic
1050396479 9:5203419-5203441 AAAGAGAAAGAAATAGAGGCAGG - Intergenic
1050525580 9:6543629-6543651 ATAGAGATGGAGAGAGATGCTGG - Intronic
1051567404 9:18516253-18516275 AGAGAGATGGAGACAGATACTGG + Intronic
1051657120 9:19393810-19393832 AAAGTGAAGGAGAAATAGGCCGG + Intergenic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1052359145 9:27535743-27535765 AGAGGGAAGGCAACAGAGGCAGG + Intergenic
1052393532 9:27909758-27909780 ATAAAGAAGGAAACAGACACTGG + Intergenic
1052399378 9:27981189-27981211 AGAGAGAGAGAAACAGAGGCAGG - Intronic
1052519193 9:29522664-29522686 AAAGATAAGGAAACCGAGGCAGG - Intergenic
1052830648 9:33212470-33212492 ATAAAGATGAAGACATAGGCAGG - Intergenic
1053005219 9:34599806-34599828 AGACAGACAGAGACAGAGGCAGG - Intergenic
1055087218 9:72326480-72326502 ATAAAGAACCAGATAGAGGCTGG + Intergenic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1055336983 9:75242248-75242270 AGAGAGAAAGAGAGAGAGACAGG - Intergenic
1055559443 9:77508096-77508118 ATAGAGAATGAGAGAGAGCAGGG - Intronic
1055615918 9:78072796-78072818 AGAGAGCAGGAGACAGAGTTAGG + Intergenic
1055856523 9:80694534-80694556 AAAGAGAAGGAGACAGGAGTAGG + Intergenic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056275111 9:84986768-84986790 ACAGAGCAGGAGACAGAAGGTGG + Intronic
1056711337 9:88994244-88994266 ACACAGGAGGAGACCGAGGCTGG - Exonic
1057177467 9:93010516-93010538 AAAGAGACAGAGACAGAGGCAGG + Intronic
1057183290 9:93041124-93041146 AGAGAGAAAGAGCTAGAGGCTGG + Intergenic
1057195015 9:93111958-93111980 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1057441726 9:95088503-95088525 AGAGAGAGAGAGAGAGAGGCCGG - Intergenic
1057698260 9:97342680-97342702 ATTGAGAAGGAGAGAGAACCAGG - Intronic
1057824336 9:98360532-98360554 GTAGATAAGGAAACAGAGCCTGG - Intronic
1057944578 9:99314175-99314197 AGAGAGAAAGAGAGAGAGGAGGG - Intergenic
1058438074 9:104982189-104982211 ATTGAGAAAGAGACAGAATCAGG + Intergenic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058661867 9:107274041-107274063 AGAAAGAAGGAGACAGAAGGAGG + Intergenic
1058671980 9:107367565-107367587 AAAGAGGAGGAGAGAGAGGCCGG - Intergenic
1058872320 9:109213280-109213302 ATACAGAAGGAGAAGGAGACAGG - Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1059409726 9:114124365-114124387 AGAGAGGAGGAGGCAGAGGAGGG + Intergenic
1059409783 9:114124713-114124735 CTAGAAAAGAAGACTGAGGCTGG + Intergenic
1059426788 9:114226262-114226284 ACAGACAAGGAAACAAAGGCAGG - Intronic
1059757280 9:117305245-117305267 CTAGGGAAGGAGTCAGAGGAGGG - Intronic
1060165718 9:121412853-121412875 ATAGAGGGAGAGACAGAGGAGGG - Intergenic
1060282841 9:122225763-122225785 ATGGAGCCGGAGACAGAGGTTGG + Intronic
1060481923 9:124021395-124021417 ACAGAGAAGCAGACACAGGGTGG - Intronic
1060505323 9:124193432-124193454 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1060508798 9:124217301-124217323 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1060635091 9:125193827-125193849 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1060827453 9:126695173-126695195 CTGGAGGAGGAGACCGAGGCTGG - Intronic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1061026823 9:128055290-128055312 AGAGAGAGGGAGAGAGAGGAAGG + Intergenic
1061041352 9:128142632-128142654 GAAGAGAAGGAGACAGTGGGAGG + Intergenic
1061267699 9:129516860-129516882 AAAGGAAAGAAGACAGAGGCTGG + Intergenic
1061458880 9:130720273-130720295 ATAGAGAAGGGGACAGGGAATGG + Intronic
1061803272 9:133124384-133124406 ATAGAGACAGACACAGAGGCTGG + Intronic
1061880095 9:133564575-133564597 AGAGAGAAGGAGAGAGAGAGGGG + Intronic
1061880116 9:133564699-133564721 AGAGAGAAGGAGAGAGAGAGAGG + Intronic
1061943973 9:133898168-133898190 ACAGAGAAGGAAACTGAGGCCGG + Intronic
1062081910 9:134628605-134628627 GTGAAGAAGGAGGCAGAGGCTGG - Intergenic
1062190541 9:135245744-135245766 GTGGAGACGGAGGCAGAGGCTGG - Intergenic
1062197630 9:135282998-135283020 ATGCAGGAGGACACAGAGGCAGG + Intergenic
1062198319 9:135286977-135286999 AGAGCAAAGGAGGCAGAGGCCGG + Intergenic
1062349963 9:136133670-136133692 ATAGAGAGGGAGAGAGAGAGAGG + Intergenic
1062540150 9:137038256-137038278 ATAGAGAGAGAGAGAGAGGGGGG - Intergenic
1062724893 9:138066451-138066473 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1203467684 Un_GL000220v1:102410-102432 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1203475509 Un_GL000220v1:146386-146408 AGAGAGAGAGAGAGAGAGGCTGG - Intergenic
1185483597 X:466177-466199 AGACAGAGGGACACAGAGGCCGG + Intergenic
1185485841 X:481508-481530 AGAAGGAAGGAGACAGAGGGAGG + Intergenic
1185523839 X:761622-761644 ATGGAGATGGAGGCAGAGACTGG - Intergenic
1185533101 X:837737-837759 ATAGAGCAGGAAGCAGGGGCAGG + Intergenic
1185536914 X:869657-869679 ATAGAGACGGAGGCAGAGACTGG - Intergenic
1185538525 X:883582-883604 ATAGAGAAAGAGACAGACAGAGG + Intergenic
1185543999 X:926938-926960 ATAGAGATGAAGGCAGAGACTGG - Intergenic
1185561252 X:1062055-1062077 ATGGAGATGGAGGCAGAGACTGG - Intergenic
1185567449 X:1106458-1106480 AGAGAGAAGGAGACAGAGAGAGG + Intergenic
1185568520 X:1114932-1114954 ATGGAGACGGAGGCAGAGACTGG + Intergenic
1185579875 X:1203603-1203625 ATGGAGACGGAGGCAGAGACTGG + Intronic
1185613739 X:1407906-1407928 AGAGAAAGAGAGACAGAGGCCGG + Intronic
1185629045 X:1502805-1502827 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185629103 X:1503132-1503154 GTGGAGACGGAGACAGAGCCTGG + Intronic
1185644203 X:1605525-1605547 AGAGAGGAGGAGAGACAGGCCGG - Intergenic
1185680459 X:1884645-1884667 ATGGAGATGGAGGCAGAGACTGG - Intergenic
1185680510 X:1884984-1885006 ATGGAGACGGAGGCAGAGACTGG - Intergenic
1185683944 X:1911491-1911513 AGAGGGAAGGAGAGAGAGGGAGG - Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185764622 X:2715451-2715473 ACGGAGAAGGAGGCAGAGACTGG - Intronic
1185792671 X:2939226-2939248 ATAGAGACGGAGGCAGAGACTGG + Intronic
1185831051 X:3303463-3303485 ATGGAGATGGAGGCAGAGACTGG + Intergenic
1185958081 X:4514186-4514208 AGAGAGAAAGAGAGAGAGGGAGG + Intergenic
1185966840 X:4615084-4615106 AGAGAGAAAGAGACAGAGAGAGG + Intergenic
1186175581 X:6922782-6922804 GTAGAGAAGGAGAGAGAAGCTGG - Intergenic
1186383863 X:9089589-9089611 AGAGAGAGAGAGAGAGAGGCAGG + Intronic
1186726533 X:12364619-12364641 ATAGAGATGGTGAGGGAGGCAGG + Intronic
1186891286 X:13961423-13961445 AGAGAGAGAGAGAGAGAGGCAGG + Intergenic
1186935437 X:14445538-14445560 ATAGAGAGAGAGAGAGAGGTGGG - Intergenic
1187147922 X:16654772-16654794 AGAGAGAGGGAGGCTGAGGCAGG + Intronic
1187272482 X:17791740-17791762 AGAGAGAAAGAGAGAGAGGAAGG + Intergenic
1187352049 X:18528581-18528603 AGAGAGAGAGAGAGAGAGGCAGG - Intronic
1187405049 X:18996501-18996523 ATAGGGAGGGAGGGAGAGGCAGG - Intronic
1187416699 X:19099507-19099529 ACAGACAAGGAAACTGAGGCAGG + Intronic
1187492077 X:19761286-19761308 AGAGAGAAAGAGAGAGAGGGAGG + Intronic
1188373165 X:29393522-29393544 AGAGAGAGAGAGAGAGAGGCAGG - Intronic
1188381281 X:29495862-29495884 AGAGAGAGGAAGACAGAGACAGG - Intronic
1188425240 X:30038768-30038790 AGAGAGAAGGAGTCAGTGCCTGG + Intergenic
1188817395 X:34731876-34731898 AGAAAGAAGGAGGGAGAGGCTGG + Intergenic
1189120914 X:38393978-38394000 CTAGAGAATAAGAGAGAGGCAGG - Intronic
1189242409 X:39535535-39535557 ATAGAGAGAGAGAGAGAGACAGG - Intergenic
1189739662 X:44105003-44105025 ACAGAAAAGGAAACTGAGGCGGG - Intergenic
1189793042 X:44621516-44621538 AGAGAGAAGGAGTCAGACACTGG + Intergenic
1190153811 X:47971207-47971229 AGACAGACAGAGACAGAGGCAGG + Intronic
1190214720 X:48472420-48472442 ATAGGAAAGGAGACAGAGGCTGG - Intergenic
1190459741 X:50660587-50660609 AGAGAGAGGGAGAGAGAGGGAGG - Intronic
1190764346 X:53463734-53463756 AGAGAGAGAGAGACAGAGGAAGG - Intergenic
1190867614 X:54397876-54397898 ATAAAGAAGTAGATACAGGCTGG - Intergenic
1190950973 X:55142390-55142412 ATCGAGGAGGAGACAGAGTCTGG + Intronic
1193301924 X:79899452-79899474 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1194538529 X:95140863-95140885 ATAGAGAGAGAGAGAGAGGGAGG + Intergenic
1195116743 X:101706961-101706983 ATAGAGTAGTAGCCAGGGGCGGG + Intergenic
1195331195 X:103802257-103802279 AGAGAGAGAGAGAGAGAGGCGGG + Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195375706 X:104225569-104225591 AGAGAGAGAGAGACAGAAGCAGG - Intergenic
1195517077 X:105789345-105789367 AGAGAGACAGAGACAGAGGAAGG + Intergenic
1196203111 X:112908623-112908645 ACAGAGATGGAGACAGAGTTGGG + Intergenic
1196841493 X:119863579-119863601 ATAGAGAGAGAGAAAGAGACAGG - Intergenic
1197127849 X:122968993-122969015 ATAGAGAAGTAGACAAAGACAGG + Intergenic
1197606796 X:128594574-128594596 ATAAAGAAGTAAAGAGAGGCCGG - Intergenic
1198213793 X:134538230-134538252 ATAGAGAAAGACAGAGAGACAGG - Intergenic
1198217444 X:134568945-134568967 AGAGAGAAAAAGAGAGAGGCAGG - Intronic
1198649017 X:138840482-138840504 GTAGAGAAGTATACAGTGGCAGG - Intronic
1198653800 X:138891971-138891993 ATAGAGAGAGAGACAGAGATTGG - Intronic
1198970891 X:142278226-142278248 GTAGAGAAGGAGAGGGAGCCAGG - Intergenic
1199145729 X:144363945-144363967 ATAGAGAAAGAGATAGGGGTAGG + Intergenic
1199301242 X:146216494-146216516 ACAGAGAAGGAAAAAAAGGCTGG - Intergenic
1199482801 X:148316183-148316205 AGAGAGAGAGAGAGAGAGGCGGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1200139663 X:153893210-153893232 ATAAAGAAGAACAGAGAGGCTGG + Intronic
1200227961 X:154429483-154429505 ATAGATGAGAAGACTGAGGCTGG + Intronic
1200401231 X:156021653-156021675 ATGGAGAAGATCACAGAGGCTGG - Intergenic
1201231511 Y:11869131-11869153 ATCCAGGAGGAGACAAAGGCAGG - Intergenic
1201271134 Y:12255060-12255082 ATAGACAAGCAGACAGAGAGGGG + Intergenic
1201271794 Y:12262992-12263014 AAAGAGAAGGAGACAGACAGAGG - Intergenic
1201280528 Y:12338469-12338491 ATAGAGACAGAGGCAGAGACTGG - Intergenic
1201280573 Y:12338797-12338819 ATGGAGATGGAGGCAGAGACTGG - Intergenic
1201516616 Y:14825190-14825212 AGAGGGAGGGAGACAGAGTCAGG - Intronic
1201578391 Y:15484977-15484999 AGAGAGAAAGAGAGAGAGGGAGG - Intergenic
1201599328 Y:15710810-15710832 AAACTGAAGGAGACAGAGACAGG - Intergenic
1201682519 Y:16663702-16663724 AGAGAGAGAGAGACAGAGCCAGG + Intergenic
1201741154 Y:17325723-17325745 AGAGAGAGGGAGAGAGAGGGAGG + Intergenic
1201755730 Y:17483809-17483831 ATAAAGCAGGAGGCAGAGTCAGG - Intergenic
1201845822 Y:18422176-18422198 ATAAAGCAGGAGGCAGAGTCAGG + Intergenic
1201862617 Y:18615886-18615908 GCAGAGAAGGAGCGAGAGGCTGG - Intergenic
1201870706 Y:18704494-18704516 GCAGAGAAGGAGCGAGAGGCTGG + Intergenic