ID: 1023156286

View in Genome Browser
Species Human (GRCh38)
Location 7:37255879-37255901
Sequence CTCTCTCACCAGAAGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023156275_1023156286 2 Left 1023156275 7:37255854-37255876 CCGAGGCAGCCTCCCCCAGGCCC 0: 1
1: 0
2: 9
3: 80
4: 764
Right 1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 130
1023156277_1023156286 -10 Left 1023156277 7:37255866-37255888 CCCCCAGGCCCCACTCTCTCACC 0: 1
1: 0
2: 4
3: 69
4: 689
Right 1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 130
1023156276_1023156286 -7 Left 1023156276 7:37255863-37255885 CCTCCCCCAGGCCCCACTCTCTC 0: 1
1: 1
2: 16
3: 119
4: 1321
Right 1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG 0: 1
1: 0
2: 0
3: 23
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023156286 Original CRISPR CTCTCTCACCAGAAGCCGTG GGG Intronic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900956350 1:5888355-5888377 CTCTCACATAAGAAGCAGTGTGG + Intronic
903773249 1:25777336-25777358 CTCTCACCCCAGGAGCCCTGGGG - Intronic
903913322 1:26744843-26744865 CTCTCTCACCCTAAGCTCTGAGG - Intronic
904053493 1:27655409-27655431 CTCTGACACCAGGAGCCATGGGG + Intergenic
904091787 1:27949997-27950019 CACTGTCACCATAAGCCTTGGGG + Intronic
905289282 1:36910550-36910572 CTCTCTCAGCAGCAGTGGTGGGG + Intronic
905740209 1:40363740-40363762 CTTCCCCACCAGCAGCCGTGTGG + Intronic
905853626 1:41292601-41292623 CTCTCCCACCATCAGCAGTGTGG + Intergenic
906198976 1:43947296-43947318 CTCTGTCCCCAGAATCTGTGTGG - Exonic
910428913 1:87141956-87141978 CTCTCTCACCAAATGGTGTGAGG + Intronic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
912965697 1:114235350-114235372 CTTTTTCTCCAGAAGCCCTGAGG + Intergenic
917309427 1:173663192-173663214 CTCTCTCAGCACAAGCCTGGGGG + Intronic
920380756 1:205533285-205533307 CTCCCTCCCCAGAAGCCAGGGGG - Intergenic
923564618 1:235067641-235067663 CTTCCCCACCAGAAGCCCTGGGG + Intergenic
1068854058 10:61779409-61779431 CTCTCTTACCACTAGCTGTGAGG + Intergenic
1073715486 10:106101788-106101810 CTCTCTCACCACCAACCCTGCGG - Intergenic
1073892987 10:108122276-108122298 CTCTCTCACCAGAAACAGTTAGG + Intergenic
1076014292 10:127015366-127015388 GTCTCCCACCAGGAGCCCTGTGG + Intronic
1076307320 10:129474370-129474392 CGCTCTCACCAGAAGCCACCAGG - Intronic
1076830812 10:132993279-132993301 CCCTCCCTCCTGAAGCCGTGGGG + Intergenic
1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG + Intronic
1077279422 11:1735421-1735443 GTCTCGCACCTGAAGCCGGGAGG + Exonic
1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG + Intergenic
1083430079 11:62609689-62609711 CTCTCTTCCCAACAGCCGTGGGG - Exonic
1085469519 11:76748347-76748369 CCCTCTCACCAGAACCTGGGAGG - Intergenic
1086824151 11:91475150-91475172 CTCTTTCACCAGAAGCCACTGGG - Intergenic
1089228794 11:116951020-116951042 CTCTCTCACATGAAGGCGTAAGG + Intronic
1089284086 11:117394587-117394609 CTCTCACTCCAGAAGCTGTCAGG - Intronic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1099610515 12:84862489-84862511 TTCTCTCACCAAAACCCTTGGGG - Intronic
1100813227 12:98360950-98360972 CTCTCTCTGCAGAGGCCCTGGGG + Intergenic
1101325275 12:103710043-103710065 CCCTCTCACCAGTAGCCTTGTGG + Intronic
1101592510 12:106137497-106137519 CTCTCTAGCCACAAGCAGTGTGG + Intronic
1102682795 12:114702061-114702083 GTCTCTCAACAGAAGCTATGTGG + Intergenic
1103112681 12:118294845-118294867 CACTCTGACCAAAAGCCTTGAGG - Intronic
1103195990 12:119044269-119044291 CGCTGTCACCAGAAGGCTTGGGG - Intronic
1104071578 12:125350302-125350324 CTCTCTGACCAGTAGCTCTGTGG + Exonic
1108999347 13:56778277-56778299 CTCCCTCCCCAGAAGCTGTATGG + Intergenic
1109721037 13:66277077-66277099 CCCTCTCATCACAAGCCCTGAGG + Intergenic
1110022270 13:70490478-70490500 CTCTCCCACCACAGGCCGGGAGG + Intergenic
1111431174 13:88149948-88149970 CTCTCTCACCAGAGACAGTTAGG + Intergenic
1116029418 14:39552831-39552853 CTCTCTGACCAGAAACCACGAGG + Intergenic
1125371816 15:38985664-38985686 CTCTCTTACCAGAAGCTGGCTGG - Intergenic
1126116838 15:45215740-45215762 TTCTCTCACCAGACGCCGGAAGG - Intergenic
1127756971 15:62102283-62102305 CTCTCTCCCGAGAAGGTGTGAGG - Intergenic
1128407220 15:67354940-67354962 GTCTCTTCCCAGAAGCCTTGGGG + Intronic
1130415509 15:83690945-83690967 TCCTCTCACCAGTAGCAGTGGGG + Intronic
1133148412 16:3807985-3808007 CTGTCTCACAAGAACCCCTGTGG - Intronic
1134492712 16:14707693-14707715 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1134498093 16:14746815-14746837 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1134582481 16:15382278-15382300 CTCCCTCAGCAGAAGTGGTGAGG - Intergenic
1135313800 16:21426329-21426351 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135366724 16:21858609-21858631 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1135445091 16:22512549-22512571 CTCCCTCAGCAGAAGCGGTGAGG + Intronic
1135524840 16:23206344-23206366 CTCTAACCCCAGAAGCTGTGGGG + Intronic
1136193813 16:28637088-28637110 CTCCCTCAGCAGAAGCGGTGAGG + Intergenic
1136310464 16:29405032-29405054 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136323912 16:29506820-29506842 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1136438597 16:30246803-30246825 CTCCCTCAGCAGAAGCGGTGAGG - Intronic
1139858148 16:69997418-69997440 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1142342890 16:89535701-89535723 CTCTCCCAGCAGAGGCGGTGGGG - Intronic
1147426759 17:40349486-40349508 CTGACTCACCAGCAGCCCTGAGG + Intronic
1150623009 17:66822554-66822576 GGCTCTTACCAGAAGCAGTGAGG - Intergenic
1152516005 17:80825283-80825305 CTCTCCCTCCAGAGGCCGCGTGG + Intronic
1154119594 18:11640690-11640712 CTCCCTCAGCAGAAGCGGTGAGG - Intergenic
1157242543 18:46024624-46024646 CTCTCTAGGAAGAAGCCGTGTGG - Exonic
1159442911 18:68504750-68504772 CTCTCTCAACAGAAGATCTGTGG - Intergenic
1160278409 18:77461920-77461942 CTCTCTCTGCTGAAGCCATGAGG + Intergenic
1160549363 18:79683533-79683555 CTCTCTCACCAAGAGCCACGGGG - Intronic
1161323881 19:3653701-3653723 CTCTCTCCCCAGAAGCCCTCGGG + Intronic
1164374427 19:27672923-27672945 CTCTCTCACTAGAATGCCTGGGG + Intergenic
1168107916 19:54175365-54175387 CTTTTGCACCAGAAGCCCTGGGG + Intronic
927683360 2:25154615-25154637 GTCTCTCAGGAGAAGCCGGGGGG + Exonic
935819700 2:106882595-106882617 ATCTCACACCAGAAGACATGTGG + Intronic
936232523 2:110715769-110715791 ATCTCTCTCCAGAAGCTGTCTGG + Intergenic
936324566 2:111493768-111493790 GTCTCTCAGCAGAAGCCCAGAGG + Intergenic
940460783 2:153959994-153960016 CTCTCTGACCAGCAGCCCAGTGG - Intronic
947138133 2:226995467-226995489 ATCTCTCACCAGAAGAAATGAGG + Exonic
948504078 2:238416104-238416126 GTCTCCCACCAGAAGTCATGTGG + Intergenic
1169488501 20:6052794-6052816 TTCTCTCCCCAGACGCCATGCGG - Exonic
1171207414 20:23291971-23291993 CTCTCACACCAGGAGCCGACAGG + Intergenic
1172845843 20:37929667-37929689 CTCTCTCACCTGCAACAGTGGGG - Intronic
1172943286 20:38669261-38669283 CTCTCTCACCAGCACCCATGTGG - Intergenic
1173163702 20:40671330-40671352 CTGTCTCACCACAAGGCATGTGG - Intergenic
1174866658 20:54143017-54143039 CTGTCTCACCAGAGCCAGTGAGG + Intergenic
1175760948 20:61562001-61562023 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175760963 20:61562049-61562071 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175760994 20:61562141-61562163 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175761023 20:61562237-61562259 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175761038 20:61562283-61562305 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175761052 20:61562331-61562353 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1175761067 20:61562379-61562401 CTCTCTCTCCGGGAGCCCTGGGG - Intronic
1176046542 20:63095906-63095928 CTTTCTGACCTGCAGCCGTGAGG - Intergenic
1176267306 20:64216951-64216973 CTTCCTCACCAGACGCTGTGAGG + Intronic
1178437947 21:32575915-32575937 CACTCCCAGCAGAAGGCGTGTGG - Intergenic
1178480642 21:32976992-32977014 CTCTCTCCCGAGAATCTGTGTGG + Intergenic
1180138769 21:45878210-45878232 CTCTCCCACCAGAGGACCTGTGG + Intronic
954621779 3:52000568-52000590 CTCCCTCACCTGAGGCCTTGTGG - Intergenic
955060543 3:55488653-55488675 CTCTTTCAGCAGATGCCGCGGGG - Intronic
962005177 3:131342171-131342193 CTCTCTCTCCAGAAGCAGGCAGG - Intronic
962619440 3:137162660-137162682 CTGTCCCACCACAAGCCCTGAGG - Intergenic
968383137 4:111932-111954 CCTCCTCACCAGAGGCCGTGAGG - Intergenic
968490270 4:886404-886426 CTCCCTCCCCAGCAGCTGTGGGG - Intronic
968958965 4:3733241-3733263 ATCTCTGCCCAGAAGCCCTGTGG - Intergenic
969115443 4:4868119-4868141 CTGTGTCACCAGAACCCCTGTGG - Intergenic
969564646 4:7970773-7970795 CTCCATCACCAGAGGCCCTGGGG + Intronic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
985888316 5:2697185-2697207 CTTTCTCACCAGCACCCGCGGGG + Intergenic
986319245 5:6614543-6614565 CTCTCTTTCCAGCAGCAGTGGGG - Intronic
986331352 5:6718221-6718243 GACTCTCACCAGACGCCTTGCGG - Intronic
991004024 5:61810275-61810297 ATCCCTCACCAGAAGCAGAGGGG + Intergenic
992185392 5:74239461-74239483 CTCTGTCACCACAGGCCATGTGG + Intergenic
998206966 5:140164656-140164678 AGCCCTCACCAGAAGCCGAGTGG + Intergenic
1002661627 5:180794753-180794775 CTCACTCACCAGAGGACGTTAGG - Intronic
1002684264 5:180995610-180995632 CTCTCTCACAAGAAACAGTGAGG - Intronic
1004322099 6:14639926-14639948 CTCTCAGACCAGAAGCCCTGGGG - Intergenic
1004754716 6:18599528-18599550 CTATTTCACCAGAAGCTATGGGG + Intergenic
1006511415 6:34523543-34523565 TTCTCTCACCAGTGGCTGTGAGG - Intronic
1007107201 6:39291946-39291968 CTATCTCACCAGGAGAAGTGGGG + Intergenic
1009469889 6:64019243-64019265 CACTCTCTCCAGAAGTCCTGAGG - Intronic
1009840101 6:69060268-69060290 CTCTCTCAGCAAAAGCCATAGGG + Intronic
1012686786 6:102260414-102260436 CTTAATCACCAGAAGCCGGGAGG - Intergenic
1013194899 6:107836471-107836493 ATCTCTCACCACAAGGCCTGGGG + Intergenic
1015810406 6:137156810-137156832 AGCTCTCACCAGAAGCCAAGTGG - Exonic
1016589456 6:145728870-145728892 CCCTCTCACCACAAGCCTGGAGG + Intronic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1020123555 7:5519582-5519604 CTCTCACACCATGAGCTGTGGGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021853833 7:24834202-24834224 CTCTTTCTCCAGAAGCCTTCTGG - Intronic
1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG + Intronic
1023164512 7:37330063-37330085 CTCTCCCATCAGAAGCCATGTGG - Intronic
1024924794 7:54601308-54601330 CTCCCTCACCAGCAGTCATGTGG + Intergenic
1029464440 7:100716502-100716524 CTCTCTCTCCAGAAGCCCCAGGG + Intergenic
1034282669 7:149864781-149864803 CTCCCACAGCAGAAGCAGTGAGG + Exonic
1034429907 7:151036061-151036083 CTCTCTCACCAGGCGCTATGGGG + Exonic
1034674773 7:152884502-152884524 CTCTGTCACAGGAAGCAGTGAGG - Intergenic
1035114440 7:156511554-156511576 ATTTCTCACCAGAAACCATGTGG + Intergenic
1036676625 8:10839533-10839555 CTCTCTCACTAGCAGACCTGCGG + Intronic
1037254730 8:16941082-16941104 ATCTCCCACCAGCAGCCATGTGG + Intergenic
1040283695 8:46088870-46088892 CTCTCTTTCCAGAAGCCCTGGGG + Intergenic
1040296499 8:46151718-46151740 CTCACTTGCCAGAAGCCCTGGGG - Intergenic
1048469517 8:134695057-134695079 CTCCCTCCCCTGAAGCCCTGAGG - Intronic
1051754683 9:20385999-20386021 CTGTCTCACCAGAACCAGAGTGG - Intronic
1054744085 9:68836785-68836807 CTGTCTTACCAGAAGCCAGGTGG + Intronic
1059971787 9:119675897-119675919 TTCTCTCAACAGAAGCCTTTTGG - Intergenic
1061289315 9:129641808-129641830 CTTTATCACCACAAGCCGGGCGG - Intronic
1061627504 9:131849696-131849718 CTCTCTCACCAGAAATTGGGAGG - Intergenic
1062179752 9:135185046-135185068 CTCCCTCACCAGTGACCGTGTGG + Intergenic
1186117318 X:6318547-6318569 ATCTCCCACCAGAAACCGTGGGG + Intergenic
1193797176 X:85891353-85891375 CTCTCTCACCATAGGCCTAGAGG + Intronic
1195032340 X:100938275-100938297 CTCTCTCACAAACAGCAGTGTGG + Intergenic
1195394711 X:104398375-104398397 CTCTGGCACCAGCAGCTGTGGGG + Intergenic