ID: 1023159835

View in Genome Browser
Species Human (GRCh38)
Location 7:37286317-37286339
Sequence GCCCATCTGACACTAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023159835_1023159836 -7 Left 1023159835 7:37286317-37286339 CCAGACACTAGTGTCAGATGGGC 0: 1
1: 0
2: 0
3: 10
4: 63
Right 1023159836 7:37286333-37286355 GATGGGCCTGATCCAAAACTTGG No data
1023159835_1023159840 21 Left 1023159835 7:37286317-37286339 CCAGACACTAGTGTCAGATGGGC 0: 1
1: 0
2: 0
3: 10
4: 63
Right 1023159840 7:37286361-37286383 CCAGTAACAGCTTTGTCACCTGG No data
1023159835_1023159842 29 Left 1023159835 7:37286317-37286339 CCAGACACTAGTGTCAGATGGGC 0: 1
1: 0
2: 0
3: 10
4: 63
Right 1023159842 7:37286369-37286391 AGCTTTGTCACCTGGGAATTTGG No data
1023159835_1023159841 22 Left 1023159835 7:37286317-37286339 CCAGACACTAGTGTCAGATGGGC 0: 1
1: 0
2: 0
3: 10
4: 63
Right 1023159841 7:37286362-37286384 CAGTAACAGCTTTGTCACCTGGG 0: 1
1: 0
2: 2
3: 24
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023159835 Original CRISPR GCCCATCTGACACTAGTGTC TGG (reversed) Intronic
903667590 1:25017408-25017430 GTCCATCTGAGACCAGGGTCAGG - Intergenic
908291667 1:62673287-62673309 TCCCATCTGACACTATTTTGGGG + Intronic
916278601 1:163023643-163023665 TCCCAGCAGACCCTAGTGTCAGG - Intergenic
916713583 1:167432414-167432436 GTTCTTCTGACTCTAGTGTCAGG - Intronic
922458002 1:225792289-225792311 GCACATCTGACACTAATGCCAGG - Intergenic
922900580 1:229133450-229133472 GCCCAGCTGAAACCAGTCTCTGG - Intergenic
922994170 1:229942991-229943013 GCCCACCTGACAACAGTGGCTGG + Intergenic
1066988901 10:42493861-42493883 GCACATCTGACATTAATGACAGG + Intergenic
1072112395 10:92335488-92335510 GCTAATCTTAGACTAGTGTCTGG + Intronic
1072447084 10:95508587-95508609 GCTGATCTGACATTCGTGTCTGG - Intronic
1075852312 10:125599327-125599349 GACCAGCTGACACCAGTGCCAGG + Intronic
1078448815 11:11425128-11425150 GCCCATCTGACACTGTTGTTGGG + Intronic
1083961330 11:66016471-66016493 GCCCATCTGGCCCAAGAGTCAGG - Intergenic
1089974849 11:122723620-122723642 GCCCATCAGACAACAGTGGCAGG + Intronic
1094879953 12:34711194-34711216 GCCCATCACAAACTAGTTTCTGG + Intergenic
1101806092 12:108065218-108065240 GCCCATCTGACACTTTTATTGGG - Intergenic
1105469392 13:20678992-20679014 GCACATCTGACGCTAATGCCAGG - Intronic
1110831547 13:80037463-80037485 GCCCATTTGACTATAGTGGCAGG - Intergenic
1111190477 13:84800340-84800362 CACCCTCTGACACTAGTGACAGG + Intergenic
1113677328 13:112215623-112215645 GCCCACCTGACACTGGTCACTGG - Intergenic
1121844103 14:97158206-97158228 CCCCATCTGACACTGGGGTCAGG - Intergenic
1122419764 14:101568048-101568070 GCCCGTCTGACCCCAGTGTCTGG + Intergenic
1128632391 15:69280085-69280107 ACCCAGCTGACACTAATGTTTGG + Intergenic
1141174330 16:81709360-81709382 GCCCATCTGACTCTAGTCCCTGG - Intronic
1143157327 17:4846243-4846265 TCCAATCTGACACTATTGTGAGG - Intronic
1152056157 17:78028527-78028549 GTCTATCTGTCACTAGTGCCTGG - Intronic
1153359698 18:4180244-4180266 GCACTCCTGACACTAGTGTTTGG + Intronic
1154076965 18:11212885-11212907 GCCTAACTGACACGAGTGTAAGG + Intergenic
1154102808 18:11491430-11491452 CACCTTCTGACATTAGTGTCAGG - Intergenic
1157633357 18:49123528-49123550 GGGAATCTGGCACTAGTGTCTGG + Intronic
1161268004 19:3373949-3373971 GCCCATCCGGCACCAGCGTCAGG - Intronic
1161614542 19:5262767-5262789 CCCCAGCTGGCACTAGTGTGCGG - Intronic
1163294110 19:16401213-16401235 GCTCATCTGTCTCTTGTGTCTGG - Intronic
928809752 2:35208697-35208719 GCCCATCTCACACTTTTATCTGG + Intergenic
931766871 2:65464677-65464699 GGCCCTCTGACACTTGTGGCTGG + Intergenic
932301026 2:70667096-70667118 TCCCATCTGACCCTAGTTCCTGG - Intronic
937154353 2:119708075-119708097 TCACATCTGACACTAATCTCAGG + Intergenic
941634759 2:167924747-167924769 CCCCACCTGCCACAAGTGTCAGG + Intergenic
944107862 2:196098870-196098892 GCCCATCTGACACTGGTCACAGG - Intergenic
1169116413 20:3069208-3069230 GCTCATCTGACCCTAGTCACTGG - Intergenic
1169490584 20:6068124-6068146 GCCCAACTCTCACTAGTGTGTGG - Intergenic
1170698606 20:18683177-18683199 GCGCATATGACAGTAGGGTCTGG + Intronic
1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG + Exonic
1177653162 21:23983646-23983668 GCCCATCTGGCAGCAGTGTCTGG - Intergenic
1183433486 22:37780104-37780126 GGCCATCTGACACCAGAGCCTGG - Intergenic
952939019 3:38426474-38426496 GCACATCTGACACTAATGCCAGG + Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
962093487 3:132269785-132269807 TCCCATCTAACACAAGTGCCTGG + Intronic
969292110 4:6246386-6246408 GCCCAGCTGGCACCAGGGTCCGG - Intergenic
971151636 4:24038803-24038825 GCCCATCTCAGTGTAGTGTCTGG - Intergenic
981011664 4:139931565-139931587 GTCCATCCTAAACTAGTGTCAGG - Intronic
984060461 4:174983553-174983575 GCACATCTGACGCTAATGCCAGG - Intergenic
1007740503 6:44006681-44006703 GCCCATCAGACACTGATGACAGG + Intergenic
1017439371 6:154449085-154449107 ACCCATGTGATTCTAGTGTCAGG + Intronic
1018193932 6:161338047-161338069 ACACATCTGCCACTACTGTCTGG + Intergenic
1020342692 7:7129860-7129882 GCCCAGCTGAATCTAGTGTTTGG + Intergenic
1020759429 7:12249930-12249952 GCCCATCTGACACTTCATTCTGG - Intergenic
1023159835 7:37286317-37286339 GCCCATCTGACACTAGTGTCTGG - Intronic
1023632731 7:42179908-42179930 GCCCATCAGACACTTCTGTTTGG - Intronic
1027230118 7:76267626-76267648 GCCCACCTGGCCCTGGTGTCAGG + Intronic
1028482579 7:91323918-91323940 GGCCAGCTGACCCCAGTGTCTGG + Intergenic
1032256213 7:130299115-130299137 GCCCATTTCACAATTGTGTCTGG - Intronic
1034509753 7:151524075-151524097 GCCCTTCTGACACTGATTTCCGG + Intergenic
1034896162 7:154877809-154877831 GTCCGTCTGACACCAGTGTGGGG + Intronic
1036619927 8:10418036-10418058 GCCCATCGGAAATTAGGGTCGGG - Intronic
1039806289 8:41002439-41002461 GCCCATCTGACTCCACTGTGGGG + Intergenic
1041671768 8:60499075-60499097 GCACATCTGACACTAATGCCAGG + Intergenic
1044631659 8:94285822-94285844 GCCCAACAGACAGAAGTGTCTGG + Intergenic
1059325646 9:113502578-113502600 GCCCCTGCGACACTAGCGTCTGG + Intronic
1062001532 9:134218329-134218351 GGCCATCAGAGACCAGTGTCCGG - Intergenic
1186660877 X:11666035-11666057 GCCCATCTGACACCAGTGGGTGG - Intergenic
1187737762 X:22322112-22322134 GCCAATATGTCAATAGTGTCCGG + Intergenic
1189963172 X:46344509-46344531 GCCCGGCTGACATTAGTGGCGGG - Intergenic
1200448379 Y:3293628-3293650 GGCCATGTGACCCTAGTGGCTGG + Intergenic