ID: 1023162587

View in Genome Browser
Species Human (GRCh38)
Location 7:37311673-37311695
Sequence CTGTGGGTGTGCATGTGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 790}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023162587_1023162590 3 Left 1023162587 7:37311673-37311695 CCGTGACACATGCACACCCACAG 0: 1
1: 0
2: 2
3: 67
4: 790
Right 1023162590 7:37311699-37311721 TGCCCAGTGACAGCTGCATGAGG 0: 1
1: 0
2: 2
3: 25
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023162587 Original CRISPR CTGTGGGTGTGCATGTGTCA CGG (reversed) Intronic
900489205 1:2938469-2938491 CTCTGTGTGTGCATGTGTGGGGG - Intergenic
900875475 1:5339669-5339691 CTGTGGGTTTTAATGTGTGAAGG + Intergenic
901138368 1:7012114-7012136 CTGCGGGTGTGCTGATGTCACGG + Intronic
901343676 1:8518994-8519016 GTGTGGGTGTGACAGTGTCATGG - Intronic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902482143 1:16717675-16717697 CTGTGGGTGGCCATGAGACATGG - Intergenic
902511927 1:16971401-16971423 GTGTGTGTGTGCATGTGTGACGG - Intronic
903325151 1:22564957-22564979 CTGTGTGTGTGCTTGTGTGTAGG - Intronic
903659984 1:24971008-24971030 TTGTGTGTGTGCATGTGTGTGGG + Intergenic
903940528 1:26927287-26927309 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
904272687 1:29360964-29360986 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
905285901 1:36880239-36880261 GTGTGAGTGTGCAAGTGTGAGGG + Intronic
905347199 1:37319212-37319234 GTGTGCGTGTGTATGTGTCTGGG + Intergenic
905353500 1:37364162-37364184 CTGTGTGTGTGTGTGTGTCTAGG - Intergenic
905480188 1:38256443-38256465 GTGCGTGTGTGCATGTGACATGG - Intergenic
905892580 1:41526566-41526588 GTGTGGGGGTGTATGTGTGAGGG - Intronic
906273171 1:44497334-44497356 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
906581260 1:46936827-46936849 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
906974497 1:50555242-50555264 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
907005345 1:50907604-50907626 TTGGGAGGGTGCATGTGTCAAGG + Intronic
907199551 1:52714705-52714727 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
907244118 1:53096735-53096757 CTGGGTGTGTGAATGTATCAAGG - Intronic
908063898 1:60381833-60381855 CTGGGAGAGTGTATGTGTCAAGG - Intergenic
908066951 1:60416269-60416291 GTGTGTGTGTGTATGTGTTAGGG - Intergenic
908414836 1:63903054-63903076 CTGAGGGTGGTCATGTGACATGG - Intronic
908807037 1:67942534-67942556 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
909975499 1:82041999-82042021 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
911063721 1:93769391-93769413 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
911797783 1:102095897-102095919 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
912245875 1:107961343-107961365 CTGGGGGTGTGCCTGTGGAAGGG - Intronic
913018554 1:114764103-114764125 CTGTGAGTGTGCAGAAGTCAAGG + Intergenic
913690127 1:121271736-121271758 ATGTGTGTGTGCATGTGTGTTGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
914147413 1:145008227-145008249 ATGTGTGTGTGCATGTGTGTTGG - Intronic
914675443 1:149904329-149904351 ATATGTGTGTGCATGTGCCATGG - Exonic
914750222 1:150529932-150529954 CTGTGTGTGTGCATTTTTCTGGG + Intergenic
914864568 1:151415808-151415830 CTGTGTGTGTGCATTTTTCAAGG - Intronic
914893202 1:151646831-151646853 CTGTGTGTGTGCGTGTGTCAAGG + Intronic
915088732 1:153406525-153406547 TTCTGGGTGTGCAGGTGTCAGGG - Intergenic
915096166 1:153464310-153464332 TTCTGAGTGTGCAGGTGTCAGGG + Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915923246 1:159994653-159994675 GTGTGTGTGTGTATGTGGCAGGG - Intergenic
915942212 1:160125538-160125560 CTGTGTGTGCGCATGCGTAAGGG - Intronic
916559967 1:165926200-165926222 GTGTGTATGTGCATGTGTCAGGG + Intergenic
916628446 1:166585417-166585439 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
916990128 1:170234353-170234375 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917418728 1:174839326-174839348 GTGTGGATGTGCATGTGAGAGGG - Intronic
917520046 1:175740774-175740796 CTGTGGCTCTGAATGTGGCAAGG - Intronic
917779188 1:178373479-178373501 GTGTATGTATGCATGTGTCAGGG - Intronic
918003151 1:180517146-180517168 CTGTGTGTGTGTGTGTGTGATGG - Intergenic
918080968 1:181207358-181207380 CTGTGGGTTTGAAGGTGTCTTGG + Intergenic
918217681 1:182407278-182407300 CTGTGGGTGTGACTTTGTGATGG + Intergenic
918793378 1:188859486-188859508 GTGTGTGTGTGTATGTGTTATGG + Intergenic
919287535 1:195583414-195583436 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
919445406 1:197698827-197698849 CTGGGAGTGTGTATGTGTCCAGG - Intronic
919647321 1:200108098-200108120 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
920453060 1:206074906-206074928 TTGTGGGTGTGCCTGGGTGAAGG - Intronic
920477449 1:206290217-206290239 ATGTGTGTGTGCATGTGTGTTGG + Intronic
920543995 1:206800590-206800612 ATGTGAGTGTGCATGTGTTTAGG + Intronic
920590175 1:207210155-207210177 TTGGGAGGGTGCATGTGTCAAGG - Intergenic
920914921 1:210251802-210251824 CAGTGGGTGTGGGTGTGTCCGGG + Intergenic
921314975 1:213881895-213881917 TTGTGTGTGTGCATGTGCAAGGG - Intergenic
921334108 1:214069003-214069025 TTGGGGATGTGCATATGTCATGG + Intergenic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921853488 1:219955204-219955226 CTTTGTGTGTGCATGTGTTTCGG - Intronic
922030638 1:221794241-221794263 GTGTGTGTGTGTATGTGTAAAGG - Intergenic
922888956 1:229045948-229045970 CTCGTGGTCTGCATGTGTCACGG + Intergenic
922982606 1:229840429-229840451 GTGTGTGTCTGCGTGTGTCATGG + Intergenic
923038103 1:230299742-230299764 CTGTGCCTGTGCATTTGGCAAGG + Intergenic
923252372 1:232189490-232189512 CTGTGGGTGATGGTGTGTCAAGG + Intergenic
924947439 1:248855891-248855913 CTTTAGGTGTGCAGGTGACAGGG + Exonic
1062800309 10:374106-374128 GTGTGGGTGTGCATCTGTGTAGG + Intronic
1062932182 10:1360640-1360662 CTGTGGGTGTGCATGGGGAGCGG + Intronic
1063054563 10:2490334-2490356 CTGTGTGTGCGCATGTGTGGTGG - Intergenic
1063266342 10:4455271-4455293 GTGTGTGTGTGCATCTGTGATGG - Intergenic
1063663000 10:8046675-8046697 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1064120683 10:12615718-12615740 GTGTGAGTGTGCATGTGTGTGGG + Intronic
1064630912 10:17309653-17309675 GTGTGGGTGTGAATGTGTCCTGG + Intergenic
1065897475 10:30176788-30176810 CTTTGCATGTGGATGTGTCAGGG - Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1066308974 10:34176953-34176975 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1066471674 10:35703862-35703884 GTGTGTGTGTGCAAGTGTGATGG - Intergenic
1066508157 10:36066489-36066511 GGCTGGGTGTGCATGTGCCAAGG + Intergenic
1067046584 10:42988666-42988688 CTGTGGCTGTGCATCTGGCCTGG + Intergenic
1067328093 10:45288833-45288855 CTGAGGCTGTGCATGGGTCAAGG + Intergenic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1068407593 10:56611000-56611022 TTGTGTGTGTGCATGTGTGTGGG - Intergenic
1068629432 10:59284553-59284575 GTGAGGGTGTGTATGTGGCAGGG - Intronic
1069282964 10:66678427-66678449 ATGTGTGTGTGTATGTGACAGGG - Intronic
1069573837 10:69511301-69511323 TTGTGGGGGTGTATGTGTCCAGG + Intergenic
1069736469 10:70658446-70658468 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1069893640 10:71667171-71667193 CTGTGAGTGTGCGTGCGTGACGG + Intronic
1070198917 10:74184527-74184549 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1070680745 10:78447489-78447511 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1071531978 10:86397227-86397249 CTGATGCTGTGCAGGTGTCATGG - Intergenic
1071701217 10:87939214-87939236 CTGGGGGTATGCATGGGACAGGG - Intronic
1071717412 10:88111268-88111290 GTGTGTGTGTACCTGTGTCAGGG + Intergenic
1072321698 10:94256478-94256500 CAATGGGTGAGCATGGGTCAAGG + Intronic
1072639518 10:97201178-97201200 GTGTGTGTGTGTATGTGTAAAGG - Intronic
1072682580 10:97517525-97517547 CTGAGGTTGTGCATGTCACAGGG + Intronic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1072856426 10:98952342-98952364 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1073932698 10:108594442-108594464 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074010893 10:109478422-109478444 CTTTATGTGTGCATGTGTGAGGG - Intergenic
1074509087 10:114096900-114096922 ATGTGTGTGTGCATGTGTTGGGG + Intergenic
1074979307 10:118606839-118606861 GTGTGGGTGTGCATGTATTCGGG + Intergenic
1075082685 10:119394394-119394416 CTGTGTGTGGGCATGTGTGTGGG + Intronic
1075137911 10:119802456-119802478 TTGTGTATATGCATGTGTCAAGG - Intronic
1076192475 10:128492348-128492370 CTGAGGCTGTGCAAGTGCCAGGG + Intergenic
1076535835 10:131176285-131176307 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535844 10:131176491-131176513 CTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535849 10:131176583-131176605 CTGTGTGTGTGCATGTGTTTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535859 10:131176767-131176789 CTCTGTGTGTCCATGTGTCTTGG - Intronic
1076749412 10:132535201-132535223 GTGTGGGTGTGCACGTGTGGCGG + Intergenic
1076770373 10:132659619-132659641 CGGTGGGTGTGCATCAGCCACGG - Intronic
1077020415 11:414781-414803 CTCTGAGTGAGCCTGTGTCAGGG - Intronic
1077054005 11:581377-581399 CTGTGGCGGTGGATGTGACACGG + Intronic
1077123525 11:922099-922121 TTGTGGGTGTGGATGTGTTGGGG + Intergenic
1077221529 11:1420166-1420188 GTGCGTGTGTGCATGTGTGATGG + Intronic
1077314930 11:1915048-1915070 GTGTGTGTGTGTATGTGTTATGG + Intergenic
1077870165 11:6255548-6255570 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1077870862 11:6260225-6260247 CTGTGGGGGTGAAGGTGTGAGGG - Intronic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078123464 11:8534584-8534606 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
1078381262 11:10843253-10843275 CTGTAGAGGTCCATGTGTCAAGG + Intronic
1079330360 11:19527933-19527955 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1079399241 11:20092491-20092513 CTTGGGGTGTGTATGTGTCTGGG + Intronic
1079831786 11:25278055-25278077 CTGTGAGGGTGTATGTGTCGAGG + Intergenic
1080275561 11:30499654-30499676 ATGTGTGTGTGTATGTGTCAAGG - Intronic
1080559330 11:33448140-33448162 ATGTGGGTATACATGTGCCATGG + Intergenic
1080811225 11:35706178-35706200 TTGGGAGGGTGCATGTGTCAAGG - Intronic
1081096650 11:38944148-38944170 TTGGGGGAGTGTATGTGTCAAGG + Intergenic
1081489135 11:43553838-43553860 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1082027422 11:47583052-47583074 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1082270689 11:50166682-50166704 CTGTGGGTGTGCAGAAGGCAAGG + Intergenic
1082557203 11:54577008-54577030 CTGGGAGTGTGTATGTGTCGAGG - Intergenic
1082662544 11:55930175-55930197 TTGTGTGTGTGCATGTGTGTAGG + Intergenic
1083766538 11:64844165-64844187 GTATGTGTGTGCATGTGTCGGGG + Intronic
1083889726 11:65589774-65589796 CTGTGGGTGGGCCTGGGGCAGGG - Exonic
1084439245 11:69161939-69161961 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1084564051 11:69919702-69919724 CTGTGTGTATGCATGTGTGGTGG - Intergenic
1084609163 11:70190772-70190794 CTGTGTGTGTGCATATGTGCCGG + Intergenic
1084609169 11:70190971-70190993 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609171 11:70191015-70191037 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609173 11:70191099-70191121 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1084609176 11:70191223-70191245 GTGTGTGTGTGCATGTGTGCTGG + Intergenic
1085339931 11:75724450-75724472 CTGTGGGAGGGCCTGTGTCTAGG + Intronic
1085433593 11:76479400-76479422 CTGTGGAAGTGCTTGTGTGAGGG - Intronic
1085784175 11:79437238-79437260 GTGTGTGTGTGCATGTGTTGGGG - Intronic
1086158987 11:83699926-83699948 GTGTGTGTGTGCATGTGTGGTGG - Intronic
1086243969 11:84728815-84728837 ATGTGAGGGTGCATGTGTCCAGG + Intronic
1087013208 11:93532630-93532652 CTGTGTCTGTGTATGAGTCAGGG - Intronic
1087267492 11:96076706-96076728 CTGTGGGTCTGCATGAGTTGTGG - Intronic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1088510297 11:110566666-110566688 CTATGGGTGTGCATGGGTGAGGG - Intergenic
1088590067 11:111395480-111395502 CTGTGGGTGTCCGAGAGTCAGGG + Intronic
1088947805 11:114532776-114532798 AGGTGTGTGTGCATTTGTCATGG + Intronic
1089069221 11:115686598-115686620 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1089325588 11:117654756-117654778 GGGTGGGTGTGCATGTGCCTGGG - Intronic
1089589612 11:119531997-119532019 CTGTGGGTGTGCAATGGACAAGG - Intergenic
1089725792 11:120478527-120478549 GTGTGTGTGTGCCTGTGGCATGG - Intronic
1089912404 11:122114790-122114812 CTGTGGGTAGGTATGGGTCAGGG + Intergenic
1091054195 11:132403041-132403063 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1091114735 11:133002694-133002716 GTGTGGGTGTGAATGTGTATAGG + Intronic
1091469251 12:712694-712716 CTGTGGGTGTGTGTATGTCACGG + Intergenic
1091590684 12:1841212-1841234 CTGTGAGTCTGCGTGAGTCAGGG + Intronic
1091710853 12:2739125-2739147 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1091803228 12:3338284-3338306 CTGTGAGTGTGCAGGTGCCCAGG - Intergenic
1092206555 12:6617990-6618012 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1093083824 12:14844330-14844352 CTGTGTGTGTGTATGTCTAAGGG - Intronic
1093894623 12:24562462-24562484 CTGTGTGTGTGCGTGTGTGCCGG + Intergenic
1094101821 12:26772798-26772820 ATATAGGTGTACATGTGTCATGG + Intronic
1094473423 12:30823584-30823606 GTGTGTGTGCGCATGTGTGAGGG + Intergenic
1094489839 12:30952914-30952936 GTGTGGGTGTGCAGGTGCCCAGG + Intronic
1096189540 12:49606482-49606504 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1096267501 12:50135333-50135355 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1096373906 12:51091631-51091653 GTATGTGTGTGCATGTGTGATGG + Intergenic
1097265067 12:57739734-57739756 CTGTGGGTAGCCAGGTGTCAGGG - Intronic
1097371875 12:58793312-58793334 TTATGTGTGTGCATGTGTCAGGG + Intronic
1097737623 12:63199638-63199660 CTGAGGGTGTCTATGTGTCTAGG - Intergenic
1097923133 12:65098656-65098678 CTGTGTGTGTGTGTGTGTAATGG + Intronic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1098611581 12:72465285-72465307 CTGTGTGTATACATGTGTTAAGG - Intronic
1099324419 12:81196074-81196096 GTGTGGGTATGCAAGTGTCACGG - Intronic
1099368938 12:81806288-81806310 TTGTGGGTGTGCATGAGTAGGGG + Intergenic
1099668024 12:85655726-85655748 GTGTGTGTGTGTATGTGTGATGG + Intergenic
1100354555 12:93817309-93817331 CTGTGTGTGTGCTTGTGTTGTGG + Intronic
1100988913 12:100231305-100231327 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1101453847 12:104808792-104808814 CTGGGAGGGTGTATGTGTCAAGG + Intronic
1101553452 12:105784946-105784968 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1101819636 12:108173838-108173860 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1101915853 12:108895301-108895323 ATGTGTGTGTGCATGTGTGAGGG + Intronic
1101915855 12:108895321-108895343 GGGTGTGTGTGCATGTGTGAGGG + Intronic
1102579716 12:113878628-113878650 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1102866078 12:116375421-116375443 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1103224653 12:119276419-119276441 CTGAGGGTGTCCATGGGCCATGG - Intergenic
1103257152 12:119551526-119551548 CTGTGGTTGAGCCTCTGTCAAGG + Intergenic
1103260814 12:119586834-119586856 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1103279376 12:119742862-119742884 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1103667170 12:122578009-122578031 CTGTGGGTTAGCAGGTGTCTTGG + Intronic
1103950133 12:124545931-124545953 GTGTGGCTTTGCATGTGTCCTGG - Intronic
1103975909 12:124702411-124702433 CTGAGGGTGTGCAGGTCCCATGG - Intergenic
1104658405 12:130591454-130591476 CGGTGAGTGGGAATGTGTCAAGG - Intronic
1104685207 12:130780465-130780487 CTGTGGTTCTGCATGGGGCAGGG - Intergenic
1104843277 12:131834604-131834626 CTGTGGGTGGGAGTGGGTCAGGG + Intronic
1105328045 13:19388092-19388114 CTGTGGCTGTGCTTCTATCATGG + Intergenic
1105603288 13:21906620-21906642 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1105880956 13:24606526-24606548 CTGTGGTTTTGCATTTGTCTGGG - Intergenic
1106229935 13:27813968-27813990 ATGTGTGTGTGTGTGTGTCAGGG - Intergenic
1106676151 13:31960601-31960623 CTGGGGGCCTGCATCTGTCATGG + Intergenic
1106702821 13:32248140-32248162 CTTTGGGGGTTCATGAGTCATGG - Intronic
1107022053 13:35762038-35762060 GTGTAGGTGTGCATGTGTGTAGG - Intergenic
1107215638 13:37915121-37915143 CTCTTAATGTGCATGTGTCAGGG + Intergenic
1107324509 13:39226710-39226732 ACATGCGTGTGCATGTGTCATGG + Intergenic
1107834946 13:44405527-44405549 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108623512 13:52206136-52206158 GTGTGGGTGTTGATGTCTCAGGG + Intergenic
1108639375 13:52368439-52368461 CTGTTGGTGTGAATGTATAATGG + Intergenic
1108815934 13:54290138-54290160 CTGAGTGTGTGTATTTGTCAGGG + Intergenic
1110057751 13:70998057-70998079 GTCTGTGTGTGCATGTGTGATGG + Intergenic
1110457526 13:75706592-75706614 CTGTGTGTGTGCATGGGTGTAGG - Intronic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110712122 13:78661481-78661503 ATATGTGTGTGCATGTGTGAGGG - Intergenic
1112113547 13:96328906-96328928 TTGGGGGAGTGTATGTGTCAAGG + Intronic
1112439337 13:99414509-99414531 GTGTGAGTGTGCATGTGTTTGGG - Intergenic
1114472591 14:22974114-22974136 ATGGGGGTCTGCATGTTTCAGGG - Exonic
1114493397 14:23117244-23117266 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
1114992613 14:28306335-28306357 GTGTGTGTGTGCATGTGTGAAGG + Intergenic
1115385787 14:32795050-32795072 TTGTGAGGGTGCATGTGTCCAGG - Intronic
1116273455 14:42801457-42801479 CTGTGGGTGTCTATGAGGCAAGG + Intergenic
1116593203 14:46806896-46806918 CTTTGGGTTTGCCTGAGTCATGG + Intergenic
1117322611 14:54638213-54638235 CTGTGTGTCTGCATGATTCATGG + Intronic
1118177973 14:63461837-63461859 GTGTGTGTGTGTATGTGTGAGGG - Intronic
1118327419 14:64791122-64791144 GGGTGGGTGTGTATGTGTGATGG - Intronic
1118866099 14:69704837-69704859 CTGTGGGTCTGTGTGTGTCCAGG + Intronic
1119635874 14:76273067-76273089 CTCTGTGTGTGCATGTGTGTGGG - Intergenic
1120363563 14:83537262-83537284 TTGTGTGTGTGTGTGTGTCATGG + Intergenic
1120435306 14:84474325-84474347 GTGTGTGTGTGCATGTGTTGTGG + Intergenic
1120522011 14:85534609-85534631 CTGTGTGTGTGCGTGTGTTTGGG + Intronic
1120784828 14:88523712-88523734 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1120801638 14:88695990-88696012 CTATGGGTGTGCATGTTTACAGG + Intronic
1121044216 14:90776136-90776158 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1121518185 14:94567865-94567887 CTGTGGGTGTTCAGGTGCCCAGG - Intronic
1122318344 14:100838700-100838722 CTGGGTGGGTGCAAGTGTCAGGG + Intergenic
1122370604 14:101227083-101227105 CTGTGGGTCTGCTTGTCTCTAGG - Intergenic
1122888430 14:104721920-104721942 CTGTGGGTGTCTGTGTGTCCTGG + Intronic
1122986771 14:105215463-105215485 GTGTGTGTGTGCATGTGTTCTGG - Intronic
1123054532 14:105562780-105562802 GTGTGGGTGTGTGTGTGTGAGGG + Intergenic
1123125975 14:105946265-105946287 ATGTGTGTGTGCGTGTGTCTTGG - Intergenic
1123434444 15:20244856-20244878 CTGTGGGGGTGCCTGTGCCGCGG - Intergenic
1123449419 15:20350703-20350725 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250890 15:28106055-28106077 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124448191 15:29758698-29758720 CTGTGTGTGTGTATGTGTTGCGG + Intronic
1125073018 15:35578577-35578599 CTCCAGGTGTGCATGTGTGAAGG + Intergenic
1125151899 15:36542067-36542089 CAGTGGGAGAGCATGTGTGAAGG + Intergenic
1125797530 15:42414519-42414541 CTGTGTGTGTGCAAGTGTGCAGG - Exonic
1126568566 15:50126129-50126151 GTGTGGGTGTGGAGGTGTCACGG + Intronic
1126927186 15:53602751-53602773 CTTTGAGGGTGCATGTGTCCAGG - Intronic
1127354727 15:58187448-58187470 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1127482299 15:59388919-59388941 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1127695288 15:61440992-61441014 CAGTGGGTGTGCAGGTTTCCTGG - Intergenic
1127736669 15:61846959-61846981 CTGAGGGTGTGCATCTGAGAAGG + Intergenic
1128674016 15:69595674-69595696 CTGTGGGAGGGCATGGGGCAGGG + Intergenic
1129689463 15:77705170-77705192 GTGTGTGTGTGTGTGTGTCATGG - Intronic
1130512860 15:84603708-84603730 CTGTTGGTTTGCATATGTAAGGG + Intronic
1130520642 15:84658351-84658373 GTGTGGGTGTGCAGGTCTCTGGG - Exonic
1130596794 15:85254680-85254702 CTGTGGGTAGGCAGGTGCCAAGG + Intergenic
1131884784 15:96900641-96900663 GTGTGTGTGTCCATGTGTTAGGG + Intergenic
1132166838 15:99601841-99601863 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1132172332 15:99672991-99673013 TTGTGGATGTGCTTGTGTGAGGG + Intronic
1132225795 15:100140448-100140470 CTGTGTGTGTGTGTGTGTCTTGG - Intronic
1132422746 15:101687521-101687543 GTGTGGGTGTGTGTGTGGCAGGG + Intronic
1132580358 16:681910-681932 CTGTGTGTGTGCACGTGGCGTGG + Exonic
1132866215 16:2093910-2093932 CTGTGGCTGTGGCTGTCTCAGGG - Exonic
1132940086 16:2502104-2502126 CTGTGGCTGGCCACGTGTCAGGG + Exonic
1133389543 16:5398490-5398512 TTGTGGGTGTGCATGTGAGCAGG + Intergenic
1133753460 16:8743336-8743358 GTGTGTGTGTGTGTGTGTCACGG + Intronic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134253842 16:12595077-12595099 TTGTGAGGGTGTATGTGTCAAGG - Intergenic
1134346312 16:13394975-13394997 TTGTGTGTGTGCATGTGTAGGGG + Intergenic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135608481 16:23843950-23843972 GTGTGTGTGTGCATGTGTGATGG - Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136020905 16:27439179-27439201 GCGTGAGTGTGCATGTGTCTGGG - Intronic
1136186330 16:28590910-28590932 CTGTGGGGGCGCATGGATCAGGG - Exonic
1136228005 16:28871993-28872015 GTGTGAGTGTGCATGTCTCCAGG + Intronic
1136850170 16:33606247-33606269 CTGTGGGGGTGCCTGTGCCGCGG + Intergenic
1138338389 16:56270415-56270437 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1138568197 16:57849391-57849413 CTGTGTGTGTGTATCTGTGACGG + Intronic
1139072652 16:63402339-63402361 CTTTTGGTGGGCATGTGTCTTGG + Intergenic
1139543130 16:67633777-67633799 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1140000825 16:71023384-71023406 ATATGGGTGTACATGTGCCATGG + Intronic
1140244282 16:73234041-73234063 GTGTGTGTGTGCGTGTGTGAAGG + Intergenic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141759699 16:86019825-86019847 GTGTGTGTGTGCATGTGTTCAGG - Intergenic
1141928858 16:87187020-87187042 ATGTGTGTGTGCATGTGTGTGGG + Intronic
1141929003 16:87188385-87188407 GTGTGCGTGTGCATGTGTGTGGG + Intronic
1142106398 16:88305595-88305617 GGGTGTGTGTGCATGTGTGAGGG - Intergenic
1142289937 16:89189254-89189276 CTGTGTGTGGGCATGTGTGTGGG - Intronic
1142410622 16:89914450-89914472 CTGTGTGTGTGCCTGTGTGTGGG + Intronic
1203111783 16_KI270728v1_random:1454700-1454722 CTGTGGGGGTGCCTGTGCCGCGG + Intergenic
1142477400 17:197441-197463 GTGTGGGTGTGCATCTGGAATGG - Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143679091 17:8462808-8462830 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1144212192 17:13025054-13025076 CTGTGTGTGTGTATGTGTGTGGG + Intergenic
1144679155 17:17181388-17181410 CTGTGGGTGTGCCTGAGAAAGGG - Intronic
1144827412 17:18113793-18113815 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1145234886 17:21201435-21201457 CTGTGACTGTGCCAGTGTCACGG + Intronic
1145264244 17:21371920-21371942 GTGTGGGTGTGACTGTGTCCTGG + Intergenic
1145302226 17:21648717-21648739 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145348087 17:22054599-22054621 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1145386297 17:22414212-22414234 CTGTGTGTGTGTGTGTGTAAAGG + Intergenic
1145415493 17:22710787-22710809 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146341971 17:32027469-32027491 CTGTGTGTGTGCTTGTGTGTGGG + Intronic
1147147624 17:38494555-38494577 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1147339115 17:39743370-39743392 CTGTGGGTAGACAAGTGTCAGGG - Intronic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147585510 17:41651976-41651998 TTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147608802 17:41789256-41789278 ATGTGTGTGTGCATGTGTGGAGG - Intergenic
1148253344 17:46105902-46105924 GTGTGTGTGTGTGTGTGTCAAGG - Intronic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1149625949 17:58081359-58081381 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1150346838 17:64411144-64411166 CAGTGGGTGAGCATATGTGATGG + Intronic
1150346963 17:64411771-64411793 CAGTGGGTGGGCATATGTGATGG + Intronic
1150346972 17:64411822-64411844 CAGTGGGTGGGCATATGTCATGG + Intronic
1150411269 17:64943389-64943411 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1152512413 17:80799364-80799386 GTGTGGATGTGCAGATGTCAGGG + Intronic
1152575459 17:81138581-81138603 GTGTGGGTGTGCACGTGTGTGGG - Intronic
1152603783 17:81278769-81278791 CTGGGGGTAAGCACGTGTCATGG - Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153376631 18:4387920-4387942 GTGTGTGTGTGTATGTGTGATGG - Intronic
1153579603 18:6558975-6558997 ATGTGGGTGTGTATGTGTGTGGG + Intronic
1153769054 18:8400876-8400898 ATGTGTGTGTGCATGTGTTGGGG + Intronic
1153880931 18:9421269-9421291 AGGTGGCTGTGCATGGGTCAGGG - Intergenic
1153960351 18:10134958-10134980 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1153961648 18:10145269-10145291 GTGTGTCTGTGCATGTGGCAGGG - Intergenic
1154351864 18:13590007-13590029 GTGTGGCTGTGCATGTGTATGGG + Intronic
1155061582 18:22233472-22233494 GTGTTCGTGTGCCTGTGTCAAGG + Intergenic
1155703759 18:28782078-28782100 GTGTGTGTGTGCTTGTGTGAGGG + Intergenic
1155705309 18:28803109-28803131 CTGTGTGTGTGTGTGTGTCTGGG - Intergenic
1156476271 18:37407503-37407525 ATGTGTGTGTGCATGTGTACAGG + Intronic
1156596407 18:38552746-38552768 GTGTGTGTGTGTATGTCTCAGGG + Intergenic
1156628509 18:38939458-38939480 GTGTGTGTGTGTATGTGACAGGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157110059 18:44812193-44812215 GTGGGGGTGTGCATGTGCCATGG - Intronic
1157284536 18:46368477-46368499 CTGTGGGTCTGCGTGTGCCCAGG + Intronic
1158435184 18:57430407-57430429 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1158910836 18:62060289-62060311 CTCAAGGTGTGCATGTGTGATGG + Intronic
1159771847 18:72555448-72555470 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1159827918 18:73237817-73237839 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1160083557 18:75753680-75753702 CTGTGGGTCTGACTGAGTCAGGG + Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1160795125 19:941791-941813 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1161064474 19:2230935-2230957 CTGTGGGTGTGCTGGGGCCAGGG + Exonic
1161394137 19:4035749-4035771 GTGTGGGTGTGTGTGTGTGATGG - Intronic
1161397796 19:4054019-4054041 GTGTGGGTGCGGATGTGTCGCGG + Exonic
1161738229 19:6004704-6004726 GTGTGTGTGTGTTTGTGTCAAGG - Intronic
1162149099 19:8632258-8632280 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1162198103 19:9001160-9001182 GTGTGGGTGTGCATGAATGAGGG - Intergenic
1162777965 19:12991002-12991024 GGGTGGGTGTGTGTGTGTCAGGG - Intergenic
1163520389 19:17788261-17788283 CTGTGGGGGTGCAGCTGTGAGGG - Exonic
1164519480 19:28967630-28967652 TTGTGAGTGTGCATGTGTGTGGG + Intergenic
1164746475 19:30619622-30619644 CTGGGGGTGTGCATGTGAGTCGG - Intronic
1164972124 19:32541600-32541622 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1165030673 19:32995978-32996000 CTGTGGGGGTGCCTGTGCCGCGG - Intronic
1165098584 19:33424568-33424590 GTGTGGTGGTGCATGTGTGATGG + Intronic
1165705338 19:37972189-37972211 GTGTGTGTGTGTGTGTGTCATGG + Intronic
1167093103 19:47358149-47358171 CGGGGGGTCTGCATGAGTCAGGG + Intronic
1167618869 19:50550490-50550512 CTGGGGGTGAGCCTGTGTCGGGG - Intronic
1168109346 19:54183380-54183402 GTGAGGGTGGGCATGTGTCTGGG - Intronic
1168499046 19:56878048-56878070 CTGTGTGTGTGTCTGTGTCCTGG + Intergenic
924998997 2:389102-389124 ATGTGTGTGTGCATGTTTAAGGG + Intergenic
924999043 2:390347-390369 ATGTGTGTGTGCATGTTTAAGGG + Intergenic
924999048 2:390453-390475 GTGTGTGTGTGCATGTTTAAGGG + Intergenic
925056112 2:858631-858653 CTGTGTGTGTGTGTGTGTGAAGG + Intergenic
925451846 2:3975834-3975856 GTGTGGGTGTGTGTGTGTAAGGG - Intergenic
925459371 2:4046887-4046909 CTGTGGGTGCACATCTGCCATGG + Intergenic
926054400 2:9765933-9765955 CCTTGTGTGTGCATGTGTAAGGG + Intergenic
926230035 2:10995486-10995508 ATGAGGCTGTGCATGTGGCATGG + Intergenic
926317414 2:11721292-11721314 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
926367887 2:12150265-12150287 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
926464809 2:13175324-13175346 CTCTGGGTCTCCAAGTGTCATGG - Intergenic
926491950 2:13535278-13535300 CTGTGTGTGTGTGTGTGTCAAGG - Intergenic
927349702 2:22094659-22094681 CTGTGGGTGTGCAGCTGACATGG + Intergenic
927516275 2:23673552-23673574 ATGTGTGTGAGCATGTGGCATGG - Intronic
927681984 2:25145814-25145836 GGGAGGCTGTGCATGTGTCAGGG - Intronic
928015602 2:27654056-27654078 CTGTGGTTGTGCATGTCTTTGGG - Intronic
928171299 2:29005154-29005176 GTGTGTGAGTGCATGTGTAAGGG + Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928923695 2:36554106-36554128 CTGTCTGTGTGCATGTGTTGTGG - Intronic
929450375 2:42032965-42032987 GTGTGTGTGTGTATGTGTGACGG - Intergenic
929625847 2:43405937-43405959 CTGTGGTTGGGCTTGTCTCAAGG - Intronic
929734173 2:44527847-44527869 CTTTGGGTGATAATGTGTCAAGG - Intronic
929949161 2:46393202-46393224 CTGTGAGTGTGCATGTATGTTGG - Intergenic
931239645 2:60440806-60440828 GTATGGGTGTGCATGTGTGTTGG - Intergenic
931533510 2:63245164-63245186 TTGTGGGTGTGCTTGTGTGAGGG - Intronic
931545744 2:63384486-63384508 GTGTGTGTGTGTATGTGTAAAGG - Intronic
931587117 2:63841102-63841124 CTCAAGGTGTGCATGTGTGAGGG + Intronic
931704854 2:64938770-64938792 GAGTGTGTGTGCATGTATCAGGG + Intergenic
931733762 2:65176356-65176378 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
931937330 2:67213810-67213832 CTGTGGGTGTTTATGTGTGTGGG - Intergenic
931937367 2:67214093-67214115 ATGTGGGTGTGTATGTGTGTGGG - Intergenic
931937449 2:67214596-67214618 GTGTGGGTGTGTATGTGTCGGGG - Intergenic
932857494 2:75252101-75252123 CTGTTGGTGTGAATGTGAAACGG - Intergenic
933720389 2:85393988-85394010 CTGGGGGTGAGGATGAGTCAGGG + Intergenic
933857104 2:86426376-86426398 CTATGGGTATGTATGTGCCAAGG + Intergenic
934033621 2:88069435-88069457 GTGTGTATGTGTATGTGTCAGGG + Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
935360131 2:102239573-102239595 CTGGGGGTATCCCTGTGTCATGG + Exonic
936075703 2:109400609-109400631 GTGTGGGTGTGTATGTGGAAGGG - Intronic
936384716 2:112019011-112019033 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
936628993 2:114179933-114179955 TTGTGTGTGTGCATGTGTTGCGG - Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
937054478 2:118921627-118921649 TTGTGGATGTGCTTGTGTCAGGG - Intergenic
937117060 2:119415140-119415162 TTGTGGGTGTGCTTGTGTGAAGG + Intergenic
937290683 2:120779926-120779948 TTGTGTGTGCGTATGTGTCACGG + Intronic
937688930 2:124731806-124731828 GTGTGAGTGTGCATGTATGAGGG + Intronic
937870684 2:126783885-126783907 GTGTGTGTGTGCACTTGTCAGGG - Intergenic
938077562 2:128347827-128347849 CTGTGGGTGTGCACGTGAATGGG - Intergenic
938090214 2:128426342-128426364 CTGAGGGTGTGCATGTGTATGGG + Intergenic
938212161 2:129477501-129477523 CTGTGGTTGTGAATTTATCAAGG + Intergenic
938939422 2:136156212-136156234 GTGTGTGTGTGTATGTGTGAAGG + Intergenic
939178151 2:138774640-138774662 CTGTGAGTGTGTATGTGTCTTGG - Intronic
940797853 2:158099496-158099518 GTGTGTGTGTGCATGTGTAAGGG + Intronic
941101941 2:161306641-161306663 CTTAGGGTGTGCATATGTCTAGG - Intergenic
941404021 2:165066558-165066580 CTGTGTGTGTGTATGTGGGAGGG + Intergenic
941668387 2:168264047-168264069 GAGAGGCTGTGCATGTGTCAGGG - Intergenic
942422948 2:175826898-175826920 TTGGGGATGTTCATGTGTCAAGG - Intergenic
942432274 2:175925144-175925166 GTGTGGATGTGCGTGTGTCAGGG - Exonic
942561672 2:177226535-177226557 GTGTGTGTGTGCATGTGTGGAGG - Intergenic
943097794 2:183451033-183451055 TTGGGAGGGTGCATGTGTCAAGG + Intergenic
943368679 2:186988684-186988706 CTGGGAGGGTGCATGTGTCTAGG + Intergenic
944221396 2:197308148-197308170 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
944857665 2:203784129-203784151 ATGTGGGTGTGCACGAGTGATGG + Intergenic
945338401 2:208619833-208619855 GTGTGTGTGTGCATGTGTGCTGG + Intronic
945500787 2:210571899-210571921 GTGTGTGTGTGTATGTGTAATGG + Intronic
946125872 2:217562156-217562178 CTGAGGCTGTGGCTGTGTCACGG + Intronic
946414980 2:219535451-219535473 GTGTGGGTGTGTATGTGTGTGGG + Intronic
946449457 2:219767351-219767373 CTGTGTGTGTGCATGTGTGTGGG + Intergenic
947201524 2:227618606-227618628 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
947691279 2:232138730-232138752 CTGTGGGTGCGAAAGTGTTATGG + Intronic
947774580 2:232697518-232697540 CTGTGGGTGTCCATGCGGCCGGG - Intronic
948125799 2:235564007-235564029 GTGGGAGAGTGCATGTGTCATGG + Intronic
948256954 2:236575412-236575434 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948256969 2:236575549-236575571 CTGTGTGTGTGTGTGTGTCTGGG + Intronic
948271013 2:236673218-236673240 ATGTGGGTATGCATGTGTGTGGG + Intergenic
948279542 2:236736339-236736361 TGGTGGGTGTGTATGTGGCAGGG + Intergenic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
948534117 2:238633316-238633338 TTGTGGGTGTGCATGCATGAAGG + Intergenic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948741125 2:240046611-240046633 CTGTGGATGTGCCTGAGTCTGGG - Intergenic
948767201 2:240228768-240228790 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
948794076 2:240393249-240393271 ATGTGTGTGTACGTGTGTCAAGG - Intergenic
948950900 2:241250701-241250723 CTCTGCGTGTGCATGTGTTTGGG - Intronic
1169076686 20:2764313-2764335 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1169135020 20:3191968-3191990 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1169205625 20:3738848-3738870 GTGTGTGTGTGCATGTGTGCAGG + Intronic
1169414544 20:5404811-5404833 CAGTAGGTGGGCAAGTGTCAGGG + Intergenic
1169434645 20:5575134-5575156 CAGTGTGTGTGTCTGTGTCATGG - Intronic
1171255567 20:23686899-23686921 ATGTAGGTGTGCATGTGGAAAGG - Intronic
1171262908 20:23748827-23748849 ATGTAGGTGTGCATGTGGAAAGG - Intronic
1171346076 20:24467789-24467811 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1171370801 20:24660991-24661013 CTGTGGGGGTGCAGCTGCCATGG - Intronic
1171518810 20:25760145-25760167 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1171558044 20:26096065-26096087 GTGGGGGAGTGCATGTTTCAGGG - Intergenic
1171779372 20:29405376-29405398 CTGTGGCTGAGCTTGTGTCCAGG - Intergenic
1172007732 20:31828996-31829018 CTGAGGGTTTGCATGTGTGAGGG + Intronic
1172311865 20:33924672-33924694 GTGTGCGCGTGCATGTGTGATGG + Intergenic
1173162048 20:40660105-40660127 ATTTGGCTGTACATGTGTCAAGG + Intergenic
1173941715 20:46916489-46916511 ATGTGTGTGTGCATGTGTGATGG + Intronic
1174799499 20:53551382-53551404 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1175139458 20:56849247-56849269 ATGTGTGTGTGCATGTGTGCAGG + Intergenic
1175786269 20:61713574-61713596 CGGTGGATGTGCAGGTGTGAGGG + Intronic
1175932805 20:62500970-62500992 GTGTGGGTGTTCATGTGTGCGGG + Intergenic
1175932839 20:62501409-62501431 GTGTGGGTGTTCATGTGTGCGGG + Intergenic
1175937168 20:62519167-62519189 CGTTGGGTGTGCATGGGTCTTGG + Intergenic
1176141685 20:63547690-63547712 CTGTCGGTGTGCCTGAGGCAGGG - Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176244805 20:64092358-64092380 CTGTGGGTGGACACGTGTCCTGG + Intronic
1176266768 20:64213448-64213470 CTGTGTGTGTGGGTGTCTCACGG - Intronic
1176411389 21:6451240-6451262 CTGTGCGTGTGAGTGTGTGAGGG - Intergenic
1176597145 21:8757932-8757954 ATGTGGGAGTGCATGTGAAACGG - Intergenic
1176652958 21:9566552-9566574 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1176926550 21:14757262-14757284 CTGTGTGTGTGTAATTGTCAAGG - Intergenic
1176987312 21:15452577-15452599 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1178118763 21:29446230-29446252 ATGTGAGTGTGCATGTGTGTGGG - Intronic
1179062469 21:37991707-37991729 GTGTGAATGTGCATGTGTAAGGG - Intronic
1179342766 21:40528152-40528174 CTATGGCTGTGCTTATGTCATGG - Intronic
1179686882 21:43059562-43059584 CTGTGCGTGTGAGTGTGTGAGGG - Intronic
1179731280 21:43369026-43369048 ATGTGTGTGTGCATGTGTGTGGG + Intergenic
1179798423 21:43799051-43799073 CTGTGGGGCAGCATGTGACAAGG - Intronic
1181291442 22:21797038-21797060 CTGTTGGTGTGCCTTTGTCCTGG - Intronic
1181749967 22:24982551-24982573 TTGTGGGTCTGCATGGGTGAGGG + Intronic
1181911510 22:26242001-26242023 CAGTGGGTGGGCAGGTGTTAGGG + Intronic
1181914788 22:26271077-26271099 CTTTGGGTGCACATGTGTCTGGG + Intronic
1181936515 22:26442693-26442715 CTGTGTGTGTATATGTGTTATGG - Intronic
1182063704 22:27415896-27415918 GTGTGTGTGTGCATGTGAAAAGG - Intergenic
1182770737 22:32794480-32794502 CTGTTGGGGTGAATGTGTGACGG + Intronic
1182819068 22:33198632-33198654 GTGTGTGTGTGTGTGTGTCACGG - Intronic
1182948818 22:34352001-34352023 TTGTGTGTGTGCATGTGTGTTGG + Intergenic
1182971203 22:34579795-34579817 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
1183103947 22:35602652-35602674 CTGTGTGTGTGCGTGTCTCTGGG - Intergenic
1184400202 22:44269380-44269402 GTGTGGGTGTCTGTGTGTCATGG - Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
1185080153 22:48705222-48705244 CTGTGGGTGTGAAGGTGCCGGGG + Intronic
1185192764 22:49449006-49449028 GTGTGTGTGTGTATGTGACAGGG - Intronic
1185199476 22:49492639-49492661 CTGTGGGTGAGCGTGGGTGACGG - Intronic
1185285660 22:49998885-49998907 ATGTGTGTGTGCATGTGTATGGG + Intronic
949407452 3:3729467-3729489 CTGTGTGTGTGTATGTGTGTGGG - Intronic
949665588 3:6335110-6335132 GTGTGTGTGTGCGTGTGGCAGGG + Intergenic
949949297 3:9216095-9216117 CTCTGAGTGTGCATTAGTCAGGG - Intronic
950137091 3:10589103-10589125 CTGTAGGTGGGGATGGGTCAGGG + Intronic
950204218 3:11065580-11065602 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
950672887 3:14537771-14537793 GTGTGGGTGTACATGTGTGAAGG - Intronic
951477967 3:23128844-23128866 GTGTGGGTGTGGATAGGTCAAGG - Intergenic
951807373 3:26661137-26661159 ATGTGTGTGTGCAAGTGTTAGGG - Intronic
951813619 3:26728376-26728398 CTGGGAGGGTGTATGTGTCAAGG + Intergenic
951848882 3:27116400-27116422 GTGTGTGTGTGTATGTGTTAAGG + Intronic
951929023 3:27942947-27942969 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
952089056 3:29862609-29862631 GTGTGTGTGTGCATGTGTGGTGG + Intronic
952211993 3:31237268-31237290 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
952226345 3:31380678-31380700 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
952747428 3:36794449-36794471 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
953255851 3:41289877-41289899 GTGTGTGTGTGTATGTGTGACGG + Intronic
953758482 3:45667595-45667617 CTGTGTGTGTGTATGTGTTTAGG + Intronic
953867918 3:46600109-46600131 CACTGGGTGTGCCTGTGCCATGG - Intronic
955030535 3:55212528-55212550 CTGGGAGGGTGTATGTGTCAAGG - Intergenic
955049133 3:55392095-55392117 CTGGGAGGGTGTATGTGTCAAGG - Intergenic
956988801 3:74737910-74737932 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
957398251 3:79673320-79673342 GTGTGGGTGTGGGTGTGTGAGGG + Intronic
957478456 3:80757768-80757790 TTGTGTGTGTGTGTGTGTCACGG - Intergenic
958157316 3:89771445-89771467 CTGTGAGTGTGCAGAAGTCAAGG - Intergenic
958455331 3:94323982-94324004 TTGTGGGTGTGCTTGTGTAGGGG + Intergenic
958829567 3:99071278-99071300 TTGTGGGTGTGCTTGTGTGTGGG + Intergenic
959639736 3:108619268-108619290 CTGTGTGTGTGTATGTGTGTGGG + Intronic
960448860 3:117781393-117781415 CTGGGAGGGTGTATGTGTCAAGG - Intergenic
960571130 3:119186326-119186348 CTTTGGGTTTCCATTTGTCATGG + Intronic
960645397 3:119875494-119875516 GTGTGTGTGTGTGTGTGTCACGG - Intronic
960894561 3:122489068-122489090 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
961370744 3:126428516-126428538 CTGTGGGTGATAATGTGTCCAGG + Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
962089531 3:132228870-132228892 ACGTGTGTGTGTATGTGTCATGG + Intronic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
962424188 3:135254941-135254963 TTGGGAGAGTGCATGTGTCAAGG + Intronic
963358072 3:144235694-144235716 CTGTAGGTGTGCAGGGGACAGGG - Intergenic
963431283 3:145207618-145207640 GTGTGTGTGTGCATGTGTGCGGG + Intergenic
963723459 3:148891471-148891493 GTGTGTGTGTGTATGTGACAGGG - Intronic
964425407 3:156547861-156547883 TTGTGGGTTTCCAGGTGTCAGGG - Intronic
965154011 3:165022590-165022612 GTGTGTGTGTGTATGTGTGATGG - Intronic
965348656 3:167585416-167585438 GTGTGTGTGTGTGTGTGTCATGG + Intronic
965382729 3:168010680-168010702 TTGTGGGTGTGCATGTGTATAGG - Intronic
965831674 3:172797036-172797058 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
966656948 3:182369795-182369817 TTGTGTGTGTGCATGTGTATAGG + Intergenic
967477119 3:189935059-189935081 AGCTGGGTGTGCATGTGTCCTGG + Intergenic
967774710 3:193374636-193374658 GTGTGTGTGTGTGTGTGTCATGG - Intronic
968194321 3:196694514-196694536 GTGTGGGTGTGGGTGTGTAATGG - Intronic
968194522 3:196695419-196695441 CTGTGGGTGTGGGTGTGTGTGGG - Intronic
968933279 4:3595724-3595746 CTGTGCATGTTCATTTGTCATGG + Intergenic
968945294 4:3660377-3660399 CTGTGGGGTTGCTTGTATCAGGG + Intergenic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
968962793 4:3753706-3753728 CTGGGGGAGTGCATGGGGCAGGG + Intergenic
969184230 4:5463672-5463694 CTGTAGGTGGGCATGTGGTAGGG - Intronic
969301408 4:6299444-6299466 GGGTGGGTGTGCATGTGTGAGGG + Intronic
969426691 4:7128568-7128590 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
969671950 4:8594534-8594556 CAGTGGCTGTGCCTGGGTCAGGG - Intronic
970055033 4:11962002-11962024 CTGGGAGTGTGTATGTGTCCAGG + Intergenic
970735734 4:19165267-19165289 GTGTGTGTGTGCATGCGTGAAGG - Intergenic
971247348 4:24941812-24941834 TTGGGAGAGTGCATGTGTCAAGG - Intronic
974342248 4:60629079-60629101 CTGGGAGGGTGCATGTGTCCAGG + Intergenic
974653537 4:64786849-64786871 GTGTGGGTGTGCATGTCTGTCGG + Intergenic
974764527 4:66325444-66325466 GTGTGTGTGTGTATGTGTGAGGG - Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
976035221 4:80810347-80810369 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976445296 4:85124095-85124117 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
978068065 4:104430923-104430945 CTGTGTGTGTGTGTGTGTTAGGG + Intergenic
979291008 4:118978788-118978810 GTGTGTGTGTGTGTGTGTCATGG - Intronic
980240572 4:130168887-130168909 CTGTGAGTGTCTGTGTGTCATGG - Intergenic
980545621 4:134258459-134258481 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
981007864 4:139894076-139894098 ATGTGAGTGTTCAGGTGTCAGGG - Intronic
981138745 4:141242079-141242101 CTATGGGTGTCCGTGTGTGAGGG + Intergenic
981182103 4:141757964-141757986 ATGTGTGTGTGTATGTGTGACGG - Intergenic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
981691132 4:147510245-147510267 CTCTGGGTTTGCAGGTGTCTAGG + Intronic
982298361 4:153853436-153853458 GTGTGTGTGTGTGTGTGTCATGG - Intergenic
982684003 4:158465923-158465945 TTGGGGGGGTGTATGTGTCAAGG + Intronic
982807472 4:159784197-159784219 ATGAGGGTCTTCATGTGTCAAGG - Intergenic
983313447 4:166096227-166096249 GTGTGTGTGTGTGTGTGTCACGG + Intronic
983513456 4:168632860-168632882 CTGGGGGTGTTCAGGTGCCAGGG - Intronic
983641699 4:169949331-169949353 TGGTGTGTGTCCATGTGTCAGGG - Intergenic
983706109 4:170661407-170661429 GTGTTTGTGTGCATGTGTGAAGG + Intergenic
983925083 4:173391901-173391923 CTGTGTGTGTGTGTGTGTCAAGG - Intronic
984218232 4:176941266-176941288 GTGTGTGTGTGTATGTGTAAAGG + Intergenic
985085051 4:186304781-186304803 GTGTGGGTGTGTGTGTATCAAGG + Intergenic
985781517 5:1874165-1874187 CTGTGGGGGTGCCTAGGTCATGG + Intergenic
985872664 5:2569757-2569779 CTGTGGGCTTGGATGTCTCAAGG + Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
986806470 5:11312661-11312683 GTGTGAGTGTGCATGTGGGATGG - Intronic
986834251 5:11617073-11617095 CTGTGGCTATGCATGTGCCAAGG + Intronic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
987947356 5:24628841-24628863 GTGTGTGTGTGTGTGTGTCAAGG - Intronic
988276155 5:29083268-29083290 CTGTTGGTGTGCAGGGGACAAGG + Intergenic
988329441 5:29815907-29815929 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
988520621 5:31942387-31942409 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
988712200 5:33789746-33789768 CTGTGTTTGTTCATTTGTCAGGG - Intronic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989310730 5:40014301-40014323 CTGTGTGTGTGTATGTGTGTGGG - Intergenic
990396024 5:55379569-55379591 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
990728565 5:58783981-58784003 CTGTGGGTGAGCATATGGGAAGG + Intronic
991000487 5:61777788-61777810 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
994190013 5:96859046-96859068 GTGTGTGTATGCATGTGGCAGGG - Intronic
994265873 5:97715659-97715681 CTGTGTGTGTGCATGTTTGGTGG - Intergenic
994793630 5:104264768-104264790 TTGAGGCTATGCATGTGTCAGGG + Intergenic
994839907 5:104910239-104910261 GTGTGCATGTGCATGTGTTACGG - Intergenic
994889049 5:105605514-105605536 CTGTGAGTCTGCAAGAGTCACGG + Intergenic
995448638 5:112275564-112275586 CTGTGTGTGTGTATGTGTCGAGG - Intronic
995914783 5:117231694-117231716 GTGTGTGTGTGCATGTGTTGGGG + Intergenic
997304531 5:132827942-132827964 GAGTGGGTGTGCCTGGGTCAGGG + Intronic
997432559 5:133850792-133850814 ATGTGGGTGTGCTGGTGTCATGG - Intergenic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
997707006 5:135965121-135965143 GTGTGTATGTGCATGTGTGAAGG - Intergenic
998173414 5:139885702-139885724 CTGTGGGTGTGTGTGTGTGGTGG + Intronic
998236831 5:140405003-140405025 GTGTGTGTGTGTATGTGTAATGG + Intronic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999077468 5:148810272-148810294 GTGTGGGTGTGTGTGTGTGAGGG - Intergenic
999309282 5:150541427-150541449 CTGGGGGTGGGGATGTGACAAGG + Intronic
999892856 5:155998025-155998047 CATTGTGTGTGCACGTGTCAGGG + Intronic
1000039849 5:157477494-157477516 CTGTGCGTTTGTATGTGTCTGGG - Exonic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1000704760 5:164496980-164497002 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1000725008 5:164758851-164758873 GTGTGTGTGTGTCTGTGTCAAGG - Intergenic
1000964386 5:167638127-167638149 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001592741 5:172877570-172877592 ATGTGTGTGTCCCTGTGTCAGGG - Intronic
1001716718 5:173822498-173822520 GTGTGGGTGTGTATGTGTGTGGG + Intergenic
1001953319 5:175831100-175831122 CTGTGTGTGTGTGTGTGTCTCGG + Intronic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1002103961 5:176870753-176870775 CAATGGGTGTGCATGAATCAAGG - Intronic
1002133081 5:177093112-177093134 CTGTGTGTGTCCATGTGCGAGGG + Intronic
1002135279 5:177103900-177103922 CTCTGGGTGTGCATGAAGCAGGG + Intergenic
1002175375 5:177398443-177398465 CGGTGTGTGTGCATGTGTGGGGG + Exonic
1003113043 6:3264878-3264900 CTGTGTGTGTGACTGTGTAAGGG + Intronic
1003237241 6:4306562-4306584 AGGAGGCTGTGCATGTGTCAGGG - Intergenic
1003332547 6:5142005-5142027 CTGTTTCTGTGCATGTGTCGGGG + Intronic
1003469901 6:6419941-6419963 AGTTGGGTGTGCATGTGTGAGGG - Intergenic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1006508666 6:34508617-34508639 CTGTTGGTGGGAATGTGTAATGG - Intronic
1006844930 6:37055616-37055638 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1007394547 6:41570075-41570097 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1007770427 6:44187549-44187571 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1007832435 6:44648746-44648768 GTGTGCATGTGCATGTGTAAAGG - Intergenic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008297327 6:49794207-49794229 CTGGGAGAGTGTATGTGTCAAGG + Intergenic
1008361368 6:50623256-50623278 TTGGGAGGGTGCATGTGTCAAGG - Intergenic
1008843024 6:55927647-55927669 ACGTAGGTGTGCATGTGCCATGG + Intergenic
1008856926 6:56099663-56099685 ATGTGGGTGTGCGTGTATGAGGG - Intronic
1009717954 6:67425179-67425201 TTGGGGGTGTGCATGTGTGCAGG + Intergenic
1009873531 6:69476854-69476876 CTATGGTTGTGCATGTAGCATGG - Intergenic
1011018038 6:82780831-82780853 TTGTGGGTGTGCTTTTGTGAGGG + Intergenic
1011156780 6:84341834-84341856 GTGTGTGTGTGTATGTGTCCTGG + Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012271732 6:97220953-97220975 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1012953887 6:105548011-105548033 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1013645051 6:112129192-112129214 GTGTGTGTGTGTATGTGTGATGG + Intronic
1013935748 6:115590890-115590912 TTGTGTATGTGCATGTGTGAAGG - Intergenic
1014568629 6:122981678-122981700 CTGTGTGTGTGCACGTGTGCAGG - Intergenic
1014757044 6:125312880-125312902 CTGTGTGTGTGCATGTTAGAGGG - Intergenic
1015467846 6:133567631-133567653 CTCTGGGTGTGGCAGTGTCATGG - Intergenic
1015577958 6:134692754-134692776 GTGTGTTTGTGTATGTGTCAGGG - Intergenic
1015777362 6:136827532-136827554 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1015870434 6:137770635-137770657 CTGTTGGTGAGCTTGTGCCAAGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017000333 6:149992027-149992049 CTGTGGCTTTGCAGCTGTCATGG + Intergenic
1017738841 6:157386832-157386854 CTGTATGTGTGCATATGTCAGGG - Intronic
1017744856 6:157437033-157437055 CTGTGACTGTGCATGTGACATGG + Intronic
1017982813 6:159417092-159417114 CTGTGGTTGTGCATGTGCGCAGG - Intergenic
1018014168 6:159697030-159697052 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1019116468 6:169767707-169767729 CTGTGTGTGTATATGTGGCATGG - Intronic
1019129594 6:169864043-169864065 CTGTGTGTGTGCCTGTGTGTGGG - Intergenic
1019352988 7:563856-563878 TTGTGGGTGTGCATGGGTTGTGG + Intronic
1019433757 7:1011504-1011526 GTCTGGGTGTGGGTGTGTCAGGG - Intronic
1019492033 7:1318804-1318826 CGGTGGGTGTGATTGTGTCGGGG - Intergenic
1020561352 7:9731645-9731667 ATGTGTGTGTGCATGTGGAATGG + Intergenic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021379688 7:19952576-19952598 ATGTGTGTCTGCATGTGACATGG + Intergenic
1022517496 7:30985236-30985258 GTGTGTGTGTGTATGTGTGAGGG + Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023620225 7:42064210-42064232 ATGTGGGCATGCATGTGTCAGGG + Intronic
1024314112 7:47998169-47998191 CTGTGGGTGAGAATGTAACATGG - Intronic
1024473641 7:49788671-49788693 CTGTGAGTGTGGGTGTGTGAGGG + Intronic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1024866711 7:53911588-53911610 TTGTGTGTGTGCGTGTGTCGGGG - Intergenic
1024970781 7:55068112-55068134 GTGTGTGTGTGCATGTGTGGTGG + Intronic
1025160312 7:56653708-56653730 CTGTGGGTGTGGCGGTTTCAAGG - Intergenic
1025279298 7:57615273-57615295 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1025305433 7:57850227-57850249 GTGTGGGAGTGCATGTTTCAGGG - Intergenic
1025755227 7:64331984-64332006 CTGTGGGTGTGGTGGTTTCAGGG + Intronic
1025942983 7:66087266-66087288 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1026389546 7:69886793-69886815 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026975648 7:74496288-74496310 ATGTGGGTGTGCATGTGTGTGGG + Intronic
1026975683 7:74496568-74496590 GTGTGGGTGTGCATGTGTGTGGG + Intronic
1026975689 7:74496594-74496616 GTGTGGGTGTGCATGTATGTGGG + Intronic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1028224179 7:88230921-88230943 CTGTGTGCGTGCATGTGTGTGGG - Intergenic
1028965121 7:96793667-96793689 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1029614659 7:101648707-101648729 TTGAGGGGGTGCATGTGTCTTGG - Intergenic
1029818519 7:103122248-103122270 GTGTGTGTGTGCACGTGTGAGGG - Intronic
1029946729 7:104541099-104541121 GTGTGTGTGTGTGTGTGTCATGG - Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030401189 7:109052477-109052499 CTGTGTGTGTGCATGTGGTATGG + Intergenic
1031075550 7:117208927-117208949 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1031144051 7:117978229-117978251 TTGTGTGTGTGGATGTGTGAGGG - Intergenic
1031997824 7:128244242-128244264 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1032013438 7:128361169-128361191 CTGTGTGTGTGAATGTGTGTAGG - Intronic
1032086684 7:128887378-128887400 CTGTGGCTGTGTATGTGTGGAGG - Intronic
1033608228 7:142942858-142942880 CTGCAGGTATGCAAGTGTCAAGG - Exonic
1033824152 7:145169138-145169160 CTGTGAGTGTGCATGAGTATCGG - Intergenic
1034400444 7:150858267-150858289 CTGGGGCTGTGCATGGGGCAAGG + Intronic
1034690851 7:153012534-153012556 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1034937154 7:155207664-155207686 GTGTGGGAGTGCATGTGTGTGGG + Intergenic
1035467357 7:159088456-159088478 CGGTGGGTGTGCAGGTGTTCAGG - Intronic
1035881394 8:3247222-3247244 CTGTGAATGTACATTTGTCAAGG - Intronic
1036101361 8:5789503-5789525 ATGTGTGTGTGTATCTGTCATGG - Intergenic
1036715090 8:11114763-11114785 GTGTGTGTGTGTATGTGCCAGGG + Intronic
1036715420 8:11118533-11118555 CTGGGAGAGTGTATGTGTCAAGG + Intronic
1037806481 8:22060434-22060456 GTGTGCGTGCGCATGTGTGAGGG - Intronic
1038388701 8:27174423-27174445 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1038648737 8:29383159-29383181 GTGGGGGTGTGCATGTGTGTGGG + Intergenic
1039427016 8:37494558-37494580 CTGTGTGTGTGCGTGTGTTAGGG + Intergenic
1039442394 8:37604214-37604236 ATGTGTGTGTGCATGTGTGTTGG - Intergenic
1039442396 8:37604278-37604300 ATGTGCGTGTGCATGTGTGTGGG - Intergenic
1039586189 8:38709081-38709103 CTGTGTGTTTGTGTGTGTCAAGG - Intergenic
1039588578 8:38728053-38728075 ATGTGGGTGTGTATGTTTCTTGG + Intergenic
1040486951 8:47882652-47882674 ATGTGGGTGTGCATGTATGATGG - Intronic
1040583986 8:48722761-48722783 CTGTGTGTGTGTGTGTGTAATGG - Intronic
1041195472 8:55397625-55397647 ATGTGTGTGTGCATGTGTGGTGG - Intronic
1041212511 8:55566985-55567007 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1043495382 8:80795102-80795124 CTGTGTGTGCGCTTGTGTGAGGG - Intronic
1043654371 8:82643370-82643392 GTGTGTGTGTGTTTGTGTCAGGG - Intergenic
1044069068 8:87733541-87733563 GTGTGTGTGTGCATGTGTGCAGG - Intergenic
1044088024 8:87965853-87965875 GTGAGGTTGTGCATGTGTGAGGG - Intergenic
1044164294 8:88962168-88962190 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1045402838 8:101835728-101835750 GTGTGAGTGTGCATGTGGCCAGG + Intronic
1045565794 8:103313786-103313808 GTGTGTGTGTGTGTGTGTCAGGG + Intronic
1045798656 8:106076794-106076816 CAGTGGGTGTGGATGTGTTGTGG + Intergenic
1045839651 8:106564400-106564422 GTGTGTGTGTGTATGTGTCCAGG - Intronic
1046175844 8:110573994-110574016 GTGTGGGTGTGTCTGTGTGATGG - Intergenic
1047138115 8:122104220-122104242 CTGTGTGTGTGTGTGTGTGACGG - Intergenic
1047190803 8:122677584-122677606 GGGAGGCTGTGCATGTGTCAGGG + Intergenic
1048118149 8:131548165-131548187 TTGTGAGGGTGTATGTGTCAAGG + Intergenic
1048493724 8:134918353-134918375 CTGTGTGTGTGCATGCAACACGG + Intergenic
1048856600 8:138691573-138691595 GTGTGCGTGTGCATTTGTGAAGG + Intronic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049296354 8:141842102-141842124 CTATGGGTGTTCATGTTTGATGG + Intergenic
1049420998 8:142516614-142516636 GTGTGTGTGTGCATGTGTGCGGG + Intronic
1049525374 8:143122982-143123004 GTGGGGGTGTTCATGTGTGAGGG - Intergenic
1049525440 8:143123569-143123591 ATGTGTGTTTACATGTGTCATGG - Intergenic
1050055820 9:1652794-1652816 CAGTGGCTGTGCATATGTGAGGG + Intergenic
1050583301 9:7083731-7083753 GTGTGTGTGTGTGTGTGTCAAGG + Intergenic
1050616132 9:7403509-7403531 GTGTCTGTGTGCATGTGACATGG - Intergenic
1051105647 9:13576760-13576782 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1052275116 9:26666678-26666700 CTCTGGGTGTTCATGTCTGAAGG - Intergenic
1052412290 9:28137194-28137216 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1052587329 9:30446116-30446138 TTGTGTGTGTGCATTTATCATGG - Intergenic
1053268017 9:36730036-36730058 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1053397754 9:37789778-37789800 GTGTGTGTGTGCCTGTGTCATGG + Intronic
1053438613 9:38095094-38095116 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1053547729 9:39041489-39041511 CTGTGTGTGTGTATGTGTGTAGG - Intergenic
1054456856 9:65436085-65436107 CTGTGCATGTTCATTTGTCATGG - Intergenic
1055070350 9:72159666-72159688 ATAAGGGTGTGCATGTGTGAGGG - Intronic
1055629056 9:78204343-78204365 CTGAGAGGGTGTATGTGTCAAGG - Intergenic
1055901910 9:81249397-81249419 TTGTGGGTGTGTTTGTGTGAGGG - Intergenic
1055989402 9:82089514-82089536 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1056456438 9:86765565-86765587 CTGAGTGTGTGGATGTGTCTGGG + Intergenic
1056470945 9:86903937-86903959 CTGTGTGTGTGTGTGTGGCAGGG - Intergenic
1056687324 9:88777392-88777414 GTGTGTGTGTGCATGTGTACGGG + Intergenic
1056778969 9:89535105-89535127 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778971 9:89535129-89535151 CTGTGTGTGTGTATGTGTGTAGG + Intergenic
1056778980 9:89535249-89535271 CTGTGTGTGTGTATGTGTATAGG + Intergenic
1057191913 9:93093115-93093137 GTGGGGGTGTGTGTGTGTCAGGG + Intergenic
1058531554 9:105910629-105910651 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1059463262 9:114448861-114448883 CTGTGGGTGAGGAAGTGACAAGG - Intronic
1059945552 9:119405213-119405235 GTGTATGTGTGCATGTCTCAGGG - Intergenic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1061453093 9:130679168-130679190 CTGTGCCTGTGTGTGTGTCAGGG + Intronic
1061504123 9:131021353-131021375 CTGTGGGTGGGAATGTGAAATGG - Intronic
1061974273 9:134060583-134060605 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1062237674 9:135519791-135519813 ATGTGGGTGTGCATGTGTATGGG + Intergenic
1062316170 9:135968146-135968168 CTGTGTGTGTGAATGACTCAGGG + Intergenic
1062432898 9:136533833-136533855 CTGTGGGGGAGCCTGTTTCAGGG + Intronic
1203378637 Un_KI270435v1:5913-5935 GTTGGGGAGTGCATGTGTCAAGG + Intergenic
1203630687 Un_KI270750v1:70093-70115 GTGTGGGAGTGCATGTTTCAGGG + Intergenic
1185480165 X:440018-440040 CTGTGGGTGTGAACGTGTACAGG - Intergenic
1185480182 X:440250-440272 CTGTGGGTGTGAACGTGTACAGG - Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1185879730 X:3730458-3730480 TTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1186269548 X:7870913-7870935 GGGTGGCTGGGCATGTGTCAGGG + Intergenic
1188236052 X:27732500-27732522 GTGTGTGTGTGTGTGTGTCAAGG + Intronic
1189504517 X:41598130-41598152 GTGTGTGTGTGTGTGTGTCAGGG - Intronic
1189631256 X:42956099-42956121 ATGTGTGTGTGTATGTGTCTTGG + Intergenic
1191032517 X:55989928-55989950 TTGGGGGGGTGTATGTGTCAAGG + Intergenic
1191087426 X:56584246-56584268 TTGGGAGGGTGCATGTGTCAAGG + Intergenic
1191146429 X:57170707-57170729 GTGTGTGTGTGTGTGTGTCATGG + Intergenic
1191681209 X:63842042-63842064 TTGGGAGGGTGCATGTGTCAAGG - Intergenic
1191763342 X:64667693-64667715 TTGGGAGTGTGTATGTGTCAAGG + Intergenic
1191804641 X:65121375-65121397 TTGGGAGGGTGCATGTGTCAAGG + Intergenic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192180543 X:68913068-68913090 GTGTGTGTGTGTGTGTGTCAGGG - Intergenic
1192213025 X:69139739-69139761 GTGTGGGTGCGCCTGTGTGAGGG - Intergenic
1192584788 X:72310403-72310425 GTGTGTGTGTGTGTGTGTCAAGG - Intergenic
1192804177 X:74495190-74495212 CTGTGTGTGTGTGTGTGGCAGGG + Intronic
1193191501 X:78576290-78576312 GTGTGTGCGTGCATGTGTGAAGG - Intergenic
1193461929 X:81800781-81800803 TTGTGTGTGTGCATGTGTGTCGG + Intergenic
1194661681 X:96634671-96634693 CTGTGGGTGTGTAGGTGTAGGGG + Intergenic
1194880793 X:99249549-99249571 CTTTGTGTGTGCATGTGTTGTGG + Intergenic
1195453379 X:105040606-105040628 CTGGGAGAGTGTATGTGTCAAGG + Intronic
1196333177 X:114496260-114496282 GTGTGTGTGTGTATGTGTAATGG - Intergenic
1196563595 X:117178753-117178775 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1197123984 X:122923113-122923135 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1197491188 X:127119426-127119448 TTGGGGGAGTGTATGTGTCAAGG + Intergenic
1198018489 X:132635378-132635400 CTGGGGGTGTGGAAGTGGCATGG - Intronic
1198316991 X:135477867-135477889 GTGTGTGTGTGTGTGTGTCAGGG + Intergenic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1199548501 X:149032843-149032865 CTGTGTGTGTGTATATGTCTAGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200140724 X:153901679-153901701 GTGAGGGTGTGCGTGTGTGAGGG - Intronic
1200241997 X:154501436-154501458 CAGTGGGAATGCATGTGCCATGG + Intergenic
1200864580 Y:8029293-8029315 TTGGGGGTGTGTATGTGTCAAGG + Intergenic
1201164145 Y:11192246-11192268 GTGTGTGTGTGTATGTGTTATGG - Intergenic
1201262263 Y:12171039-12171061 TTGGGAGGGTGCATGTGTCAAGG + Intergenic
1201263575 Y:12184244-12184266 TTGGGAGGGTGCATGTGTCAAGG - Intergenic
1201340243 Y:12925618-12925640 GTGTGCGTCTGCACGTGTCAGGG + Intergenic
1201450700 Y:14110417-14110439 GGGTGACTGTGCATGTGTCAGGG - Intergenic
1201751966 Y:17442409-17442431 TTGTGAGGGTGCATGTGTCCAGG + Intergenic
1201780125 Y:17711759-17711781 TTGTGAGGGTGTATGTGTCAAGG - Intergenic
1201821430 Y:18194233-18194255 TTGTGAGGGTGTATGTGTCAAGG + Intergenic
1202327590 Y:23707881-23707903 CTGGGAGGGTGTATGTGTCAAGG - Intergenic
1202361167 Y:24111799-24111821 CAGTGGCTGTGCATTTGTCATGG + Intergenic
1202509611 Y:25558319-25558341 CAGTGGCTGTGCATTTGTCATGG - Intergenic
1202543180 Y:25962171-25962193 CTGGGAGGGTGTATGTGTCAAGG + Intergenic
1202603811 Y:26621525-26621547 CTGTGGCTGTGCTTCTATCATGG - Intergenic