ID: 1023164512

View in Genome Browser
Species Human (GRCh38)
Location 7:37330063-37330085
Sequence CTCTCCCATCAGAAGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 885
Summary {0: 1, 1: 0, 2: 3, 3: 87, 4: 794}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023164512_1023164513 -5 Left 1023164512 7:37330063-37330085 CCACATGGCTTCTGATGGGAGAG 0: 1
1: 0
2: 3
3: 87
4: 794
Right 1023164513 7:37330081-37330103 GAGAGCCTCACAGATCCAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023164512 Original CRISPR CTCTCCCATCAGAAGCCATG TGG (reversed) Intronic
900384091 1:2401424-2401446 CTCTCCCATCCCCAGCCTTGTGG + Intronic
900956350 1:5888355-5888377 CTCTCACATAAGAAGCAGTGTGG + Intronic
902115284 1:14116254-14116276 CTCTCCCATCACAGGCCCAGAGG + Intergenic
902292998 1:15447174-15447196 CCCTGCCAACAGCAGCCATGGGG - Intronic
902564038 1:17298160-17298182 CACACCCAGCAGAAGTCATGAGG - Intergenic
903265696 1:22156698-22156720 CTCTCCCATCCATAGGCATGCGG + Intergenic
904053493 1:27655409-27655431 CTCTGACACCAGGAGCCATGGGG + Intergenic
904610790 1:31725214-31725236 CAGTCCCATCAGGAACCATGGGG - Intergenic
905221291 1:36449994-36450016 CTCTCCCATTTGAAGAGATGGGG + Intronic
906369647 1:45241675-45241697 CCCTCCCATCACAGGCCAGGAGG - Intronic
906770003 1:48475418-48475440 CTCTCCCATCACAGGCCCCGAGG + Intergenic
907749197 1:57246197-57246219 CTCTCCCATCACAGGCCTAGAGG + Intronic
908004379 1:59712778-59712800 CCCTCCCATCACAAGCCTGGAGG - Intronic
908624827 1:66028395-66028417 CCCTCCCATCACAGGCCTTGAGG - Intronic
908932330 1:69331817-69331839 CTCTCCCATCACAAGCCTGGAGG - Intergenic
908933006 1:69340188-69340210 CCCTCCCATCACAAGCCTGGAGG + Intergenic
909265312 1:73550331-73550353 CCCTCCCATCACAAGCCCAGAGG - Intergenic
909574512 1:77159030-77159052 CCCTCCCATCACAGGCCCTGAGG + Intronic
909579980 1:77222652-77222674 CCCTCTCATCACAAGCCAGGAGG - Intergenic
909632985 1:77786284-77786306 CCCTCCCATCACCAGCCAGGAGG - Intronic
909757095 1:79240072-79240094 CCCTCCCATCACAAGCCTGGAGG - Intergenic
910083617 1:83372031-83372053 CCCTCCCATCACAGGCCAGGAGG - Intergenic
910273287 1:85420183-85420205 CCCTCCCATCACAGGCCCTGAGG - Intronic
910895422 1:92064436-92064458 CTTTCCCATAAGAAGCCTTAAGG + Intergenic
911007662 1:93243456-93243478 CTCTCCCATCACAGGCCTGGAGG - Intronic
911331371 1:96529470-96529492 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
911530420 1:99037008-99037030 CCCTCCCATCACAAGCCTGGAGG - Intergenic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
911830998 1:102551095-102551117 CTCTCCCATCACAAGCCAGGAGG - Intergenic
912861189 1:113215225-113215247 CTCTCCCATCACAGGCCCAGAGG - Intergenic
913170421 1:116227162-116227184 GTCTCCCCTTAGAAGCCATGTGG - Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
915719237 1:157971903-157971925 CCCTCCCATCACAGGCCAAGAGG - Intergenic
916384806 1:164255481-164255503 CCCTCCCATCACAAGCCTGGAGG + Intergenic
917443022 1:175083496-175083518 CCATCCCATCAGAGGCCATGTGG - Intronic
918831618 1:189405591-189405613 CCCTCCCATCACAGGCCCTGAGG - Intergenic
918935157 1:190912309-190912331 CCCTCCCATCACAAGCCTCGAGG - Intergenic
919125583 1:193388877-193388899 CTCTCCCATCACAGGCCCTGAGG - Intergenic
919233528 1:194807353-194807375 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
920783668 1:209020043-209020065 CCCTCCCATCACAAGCCTGGAGG + Intergenic
921549753 1:216520679-216520701 CACTGTCCTCAGAAGCCATGAGG - Intronic
921880463 1:220249661-220249683 CTCTCCCATCACAGGCCCGGAGG + Intronic
922827132 1:228529630-228529652 CTCTCCCATTAGAATGCATGGGG + Intergenic
922827261 1:228530399-228530421 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922827639 1:228532798-228532820 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922827692 1:228533076-228533098 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922827725 1:228533251-228533273 CTCTCCCATTAGAATACCTGGGG + Intergenic
922827820 1:228533807-228533829 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922827945 1:228534613-228534635 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922827982 1:228534856-228534878 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922828287 1:228536787-228536809 CTCTCCCATTAGAATGCTTGGGG + Intergenic
922828391 1:228537484-228537506 CTCTCCCATTAGAATACCTGGGG + Intergenic
922828527 1:228538357-228538379 CTCTCCCATTAGAATGCATGGGG + Intergenic
922828899 1:228540691-228540713 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922829025 1:228541528-228541550 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922829056 1:228541730-228541752 CTCTCCCATTAGAACGCCTGGGG + Intergenic
922829417 1:228544022-228544044 CTCTCCCATTAGAATGCCTGTGG + Intergenic
922829516 1:228544636-228544658 CTCTCCCATTAGAATGCCTGAGG + Intergenic
922829534 1:228544741-228544763 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922829734 1:228545952-228545974 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922829852 1:228546715-228546737 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922829992 1:228547568-228547590 CTCTCCCATTAGAATGCCTGAGG + Intergenic
922830026 1:228547862-228547884 CTCTCCCATTAGAATGCTTGGGG + Intergenic
922830539 1:228551214-228551236 CTCTCCCATTAGAATGCCTGGGG + Intergenic
922830635 1:228551945-228551967 CTCTCCCATTAGAACGCCTGGGG + Intergenic
922830651 1:228552015-228552037 CTCTCCCATTAGAATGCCTGGGG + Intergenic
923333207 1:232944956-232944978 TTCTCCCATCAGCACCCCTGGGG + Intergenic
923564618 1:235067641-235067663 CTTCCCCACCAGAAGCCCTGGGG + Intergenic
923919388 1:238546343-238546365 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1063572146 10:7225632-7225654 CTCTACCATTCAAAGCCATGTGG + Intronic
1063808934 10:9681449-9681471 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1065159946 10:22909068-22909090 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1065534173 10:26701373-26701395 CCCTCCCATCACAGGCCAGGAGG + Intronic
1065984866 10:30939672-30939694 CTCTCCCATCAGAAGCTTCTTGG - Intronic
1066105528 10:32153506-32153528 ATTTCTCATCAGAAACCATGAGG - Intergenic
1066395032 10:35011809-35011831 CTCTACCCTAAGAAGCCCTGAGG + Intronic
1066480004 10:35786398-35786420 CACTCCCATCACAGGCCCTGAGG - Intergenic
1067206057 10:44215098-44215120 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1067524678 10:47031128-47031150 CTCACCTATCAGAAACCCTGAGG + Intergenic
1067922717 10:50476614-50476636 CTCTCCCATCACAGGCCAGGAGG + Intronic
1068284160 10:54913223-54913245 CCCTCCCATCACAGGCCCTGAGG + Intronic
1069093408 10:64229402-64229424 GTCTCCCATCAGGAGGCATGGGG + Intergenic
1069519501 10:69107424-69107446 CTCAACCATCAGAAGCCAAGAGG + Intergenic
1069577597 10:69541873-69541895 CCCTCCCATCAGAGGCCCAGGGG - Intergenic
1069804984 10:71116624-71116646 CTCTCCCATCACAGGCCAAGAGG + Intergenic
1070413630 10:76168420-76168442 CTCTGGAAACAGAAGCCATGAGG - Intronic
1071109371 10:82136911-82136933 ATCTCCCAGCAGCAGCCACGTGG - Intronic
1073922912 10:108480361-108480383 CTCTCCCATCACAGGCCCAGTGG + Intergenic
1074223583 10:111462029-111462051 CCCTCCCATCACAAGCCCGGAGG + Intergenic
1074638065 10:115344406-115344428 CACTGCCATCAAAGGCCATGGGG + Intronic
1074916192 10:117957854-117957876 CTCTCCTATTAGACTCCATGGGG - Intergenic
1075347671 10:121696112-121696134 CTCCCCCAGCTAAAGCCATGTGG + Intergenic
1076014292 10:127015366-127015388 GTCTCCCACCAGGAGCCCTGTGG + Intronic
1076042840 10:127266017-127266039 CTCTCCCATCCTAAGGCAAGCGG - Intronic
1076352373 10:129825971-129825993 CTATCCCATCTGGTGCCATGTGG + Intergenic
1076384055 10:130044653-130044675 CCCTTCCATCAGAAGCCAAATGG - Intergenic
1076874239 10:133208104-133208126 CTCTCTGAGCAGAGGCCATGGGG + Intronic
1077193438 11:1266015-1266037 CCCTCCCATCAGAAACCTGGAGG - Intergenic
1078651015 11:13191987-13192009 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1078687381 11:13546257-13546279 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1078769664 11:14337021-14337043 ATTTCTCATCAGAAACCATGGGG + Intronic
1079546786 11:21642968-21642990 CCCTCCCATCACAAGCCAGGTGG + Intergenic
1079686310 11:23363388-23363410 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1079949479 11:26784129-26784151 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1080306743 11:30844685-30844707 CTCTCCCATCACAGGCCCAGAGG - Intronic
1080720980 11:34848367-34848389 CTCAACCATCAGAAGCAAGGTGG + Intergenic
1080843380 11:36004997-36005019 CCCTCCCATCACAGGCCAGGAGG - Intronic
1080903944 11:36522203-36522225 CCCTCCCATCACAAGCCCAGAGG + Intronic
1080959904 11:37146022-37146044 CCCTCCCATAACAAGCCAGGAGG - Intergenic
1081002769 11:37695433-37695455 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1081120088 11:39255572-39255594 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1081386589 11:42480014-42480036 CCCTCCCATCACAAGCCAGGAGG + Intergenic
1081594028 11:44446872-44446894 CCCTCTCAGCAGAAGCCCTGGGG + Intergenic
1083337868 11:61936719-61936741 ATTTCTCATCAGAAACCATGGGG + Intergenic
1084357801 11:68651396-68651418 CACTGCCATCAGAATCCCTGGGG - Intergenic
1085987086 11:81800705-81800727 CTCCCCCATCACAGGCCAAGAGG + Intergenic
1086893914 11:92290359-92290381 CTGTCCCATAATAAGCCATCAGG + Intergenic
1087336546 11:96851661-96851683 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1087385468 11:97463803-97463825 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1088040557 11:105375927-105375949 CCCTCCAATCACAAGCCAGGAGG - Intergenic
1088349041 11:108864292-108864314 TTCTCCCATCAGAATCATTGGGG + Intronic
1088427000 11:109714992-109715014 CCCTCCCATCAGAGGCCTGGAGG - Intergenic
1088484761 11:110329717-110329739 CCCTCCCATCATAAGCTCTGAGG - Intergenic
1088567087 11:111183894-111183916 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
1089829980 11:121318757-121318779 CTCTTCTCTCAGATGCCATGTGG - Intergenic
1091811903 12:3406291-3406313 CCCTCCCATCACAGGCCAAGAGG - Intronic
1092109052 12:5945880-5945902 CTCTCCCATGAGACGCTAGGAGG + Intronic
1092853131 12:12648492-12648514 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1093192623 12:16092220-16092242 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1093321032 12:17715781-17715803 CTCTCCAATCAAAAGACATAGGG - Intergenic
1093353065 12:18128001-18128023 CCCTCCCATCACAGGCCCTGAGG + Intronic
1093426374 12:19033037-19033059 CCCTCCCATCACAAGCCCAGTGG - Intergenic
1093536701 12:20231141-20231163 CCCTCCCATCACAGGCCTTGAGG - Intergenic
1093537246 12:20237246-20237268 CCCTCCTATCACAAGCCAGGAGG + Intergenic
1093967310 12:25340952-25340974 CTCTCCCATCACAGGCCCGGAGG - Intergenic
1095039663 12:37427254-37427276 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1095300877 12:40582145-40582167 CACTCCCATCAGAGGCCTGGAGG - Intergenic
1095544183 12:43345270-43345292 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1096960293 12:55570261-55570283 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1097146523 12:56943254-56943276 CTCTCCCATCATAGGCCAGGAGG + Intergenic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1097401688 12:59135042-59135064 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1097522793 12:60689448-60689470 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1097735378 12:63176398-63176420 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1098203744 12:68084095-68084117 CCCTCCCATCATAAGCCAGGAGG - Intergenic
1098434039 12:70450388-70450410 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1098610679 12:72453668-72453690 CCCTCCCATCACAGGCCCTGAGG + Intronic
1098628400 12:72700082-72700104 CCCTCGCATCACAAGCCAGGAGG - Intergenic
1098741617 12:74179448-74179470 CCCTCCCATCACAAGCCTGGAGG - Intergenic
1098939591 12:76518887-76518909 CTCTCCCATCACAGGCCCAGAGG - Intronic
1099898717 12:88681369-88681391 CTCTCCTATCAGAGGCCTGGTGG + Intergenic
1099907793 12:88792376-88792398 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1100086281 12:90914282-90914304 CTCTCCCATCACAGGCCCAGAGG - Intronic
1100348375 12:93754286-93754308 CTCTCCCATCACAGGCCCAGAGG - Intronic
1101033883 12:100685816-100685838 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1101113220 12:101506572-101506594 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1101258014 12:102998434-102998456 CTCTCCCATCACAAACCTGGAGG - Intergenic
1102318267 12:111907941-111907963 CTCTCTAATCAAAAGACATGGGG + Intergenic
1102523134 12:113491952-113491974 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1102682795 12:114702061-114702083 GTCTCTCAACAGAAGCTATGTGG + Intergenic
1104227657 12:126851638-126851660 CCAGCCCTTCAGAAGCCATGGGG - Intergenic
1105530208 13:21212295-21212317 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1105586819 13:21752932-21752954 CTAACCCATAAGAAGCTATGAGG - Intergenic
1106048137 13:26165035-26165057 CACTCCCATCATAAGCCTGGAGG + Intronic
1106180978 13:27369164-27369186 CTCACCCAACAGCGGCCATGGGG + Intergenic
1106362911 13:29049272-29049294 CTGTCCCATCATAAGGCATTGGG + Intronic
1106496826 13:30286265-30286287 CCCTCCCATCACAAGCCCAGAGG + Intronic
1106502749 13:30345214-30345236 TTCTCCCAGCAGAAGTAATGAGG + Intergenic
1107039496 13:35933748-35933770 CCCTCCCATCACAAGCCTGGAGG - Intronic
1107234660 13:38153708-38153730 CCCTCCCATCACAGGCCTTGAGG - Intergenic
1107951905 13:45470497-45470519 TTCTCCCATCAGAGTTCATGAGG - Intronic
1108768345 13:53663311-53663333 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1108930158 13:55807591-55807613 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1109130218 13:58575097-58575119 CTCTCCCATCATAGGCCCTGAGG - Intergenic
1109294497 13:60513311-60513333 CCCTCCCATCACAAGCCAGGAGG - Intronic
1109583961 13:64373840-64373862 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1109721037 13:66277077-66277099 CCCTCTCATCACAAGCCCTGAGG + Intergenic
1109810665 13:67509171-67509193 CCCTCCCATCACAGGCCAGGGGG + Intergenic
1110187569 13:72693041-72693063 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1110955378 13:81546793-81546815 CTCTCCCATCAGAGGTCTGGAGG - Intergenic
1111042501 13:82767877-82767899 CTCTCCCATCACAGACCCTGAGG + Intergenic
1111083457 13:83342768-83342790 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1111336882 13:86836762-86836784 CTCTCCCGTCACAGGCCAAGAGG - Intergenic
1111385421 13:87521279-87521301 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1111419805 13:87998207-87998229 CCCTCCCATCACAGGCCAAGAGG + Intergenic
1111507598 13:89214611-89214633 CTCTCACAGCAGAGACCATGTGG - Intergenic
1111687272 13:91517039-91517061 CTCTCCCATCACAGGCCCAGAGG - Intronic
1112720987 13:102244770-102244792 CCATCCCAGCAGAGGCCATGTGG + Intronic
1112744161 13:102508571-102508593 CCCTACCATCACAAGCCCTGAGG + Intergenic
1112825085 13:103382585-103382607 CCCTCCCATCACAAGCCCTGAGG - Intergenic
1113162414 13:107396801-107396823 CTCTCACATCAGGAGCTCTGCGG + Intronic
1114383473 14:22232667-22232689 CCCTCCCATCACAGGCCTTGAGG - Intergenic
1114745053 14:25137410-25137432 GTCTCCCATCAGGAGGCACGGGG - Intergenic
1114839719 14:26249020-26249042 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1114918574 14:27297081-27297103 CCCTCCCATCACAAGTCCTGGGG - Intergenic
1114948360 14:27715715-27715737 CACTCCCATCACAGGCCCTGAGG + Intergenic
1115113627 14:29854724-29854746 CTCTCCCATCACAGGCCCAGAGG + Intronic
1115724551 14:36198862-36198884 CTTTCCCCCCAGAATCCATGGGG + Intergenic
1116138685 14:40959844-40959866 CCCTCCCATCACAAGCCCAGGGG - Intergenic
1116369306 14:44109626-44109648 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1116625140 14:47254119-47254141 CTCTCCCATCACAGGCCTGGAGG - Intronic
1118452219 14:65913356-65913378 CTTTCCCAGCACCAGCCATGGGG + Intergenic
1118836015 14:69478309-69478331 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1118951866 14:70442475-70442497 CACTCCCCTGAGAAGCCATTTGG - Intergenic
1119880742 14:78097478-78097500 CCCTCCCATCAAAAGCCCAGAGG - Intergenic
1120013871 14:79448220-79448242 CTCCTCCTTCAGAAGACATGGGG + Intronic
1120132597 14:80824243-80824265 CCCTCCCATCACAAGCCCAGTGG - Intronic
1120417979 14:84243808-84243830 CTCTCCCATCACAGGCCTTGTGG - Intergenic
1120623227 14:86791962-86791984 CTCTCCCATCACAAGCCTGGAGG + Intergenic
1120997968 14:90430983-90431005 CTCTCCCAAGAGAAGCTAAGGGG - Intergenic
1121128779 14:91427039-91427061 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1121318751 14:92978519-92978541 CCCTCCCATCACAGGCCAGGAGG + Intronic
1121499009 14:94418933-94418955 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1121707713 14:96011344-96011366 CCCTCCCATCACAGGCCTTGAGG - Intergenic
1121735179 14:96213424-96213446 CTCCAGCATCAGGAGCCATGTGG + Intronic
1123099645 14:105788103-105788125 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1123628878 15:22247190-22247212 CCCTCCCATCACAAGCCCGGAGG + Intergenic
1124066246 15:26346914-26346936 CTCTACCATCACAAGCCCAGAGG + Intergenic
1124444926 15:29722238-29722260 CCCTCCCATCACAAGCCTGGAGG + Intronic
1124556108 15:30727327-30727349 CCCTCCCATCACAAGCCAGGAGG - Intronic
1124675163 15:31678443-31678465 CCCTCCCATCACAAGCCAGGAGG + Intronic
1125585119 15:40814289-40814311 CTCTCCCATCGGACGTCCTGTGG - Exonic
1125806635 15:42498555-42498577 CCCTCCCATCACAAGACCTGAGG - Intronic
1126203798 15:46019695-46019717 CGCTCCCATCACAAGCCTGGAGG + Intergenic
1126266220 15:46756501-46756523 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1127387810 15:58481200-58481222 CCCTCCCACCACAAGTCATGAGG - Intronic
1128716489 15:69912366-69912388 CTCTCCCCTCAGACAACATGAGG + Intergenic
1130046613 15:80450730-80450752 CTCTGCCATCATCAGCTATGTGG - Intronic
1130053230 15:80501610-80501632 CTCTCCCTCCAGCAGCCAGGAGG + Intronic
1131123454 15:89837917-89837939 CTCTCCCCTCAGCAGCGAGGTGG + Intronic
1132000915 15:98179406-98179428 CTCTCCCCACATCAGCCATGTGG + Intergenic
1132388132 15:101416597-101416619 CCCTCCCATCAGAGGCCCAGAGG + Intronic
1133868935 16:9670016-9670038 CTGCCCCACCAGAAGCCATTGGG + Intronic
1134409937 16:13995487-13995509 CACTCCCTTCAGAATCAATGGGG - Intergenic
1135817605 16:25649826-25649848 CTGTCCCATCAGAAACTAAGTGG - Intergenic
1137047544 16:35683414-35683436 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137047600 16:35683767-35683789 CTCTCCCATTAGAGTCCCTGGGG + Intergenic
1137047742 16:35684625-35684647 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137047855 16:35685318-35685340 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137047956 16:35685948-35685970 CTCTCCCATTAGAATGCCTGAGG + Intergenic
1137048347 16:35688377-35688399 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137048508 16:35689416-35689438 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137049188 16:35693689-35693711 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137049383 16:35694869-35694891 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137049478 16:35695428-35695450 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1137050930 16:35712654-35712676 CTCTCCTATTAGAAGGCCTGGGG + Intergenic
1137050996 16:35713108-35713130 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137051141 16:35714006-35714028 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137051203 16:35714355-35714377 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137051292 16:35714914-35714936 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137052430 16:35725425-35725447 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137052606 16:35726540-35726562 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137052743 16:35727412-35727434 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137053104 16:35729727-35729749 CTCTCCCATTAGAATCCCTGGGG + Intergenic
1137053352 16:35731453-35731475 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1137053408 16:35731799-35731821 CTCTCCCATTAGAATTCCTGGGG + Intergenic
1137053436 16:35731904-35731926 CACTCCCATTAGAATTCATGTGG + Intergenic
1137053530 16:35732479-35732501 CTCTCCCATTAGAATACCTGGGG + Intergenic
1137053603 16:35732951-35732973 CTCTCCCATTAGAATGCCTGAGG + Intergenic
1137778734 16:51078332-51078354 CTCTCCCATCAGAATCCCAGAGG - Intergenic
1137981544 16:53074489-53074511 CTCTCCCATCACAGGCCCAGAGG + Intronic
1139005050 16:62559539-62559561 ATCCCCCAGCAGCAGCCATGTGG - Intergenic
1141294728 16:82757033-82757055 CTTGCCCATCAGGATCCATGGGG + Intronic
1141413696 16:83854011-83854033 CTCCCCCATCCTCAGCCATGTGG + Intergenic
1141975206 16:87511068-87511090 CCCTCCCATCACAAGCCTGGAGG - Intergenic
1142342890 16:89535701-89535723 CTCTCCCAGCAGAGGCGGTGGGG - Intronic
1143434382 17:6912869-6912891 CTCTCCAATCAGAAGAAGTGTGG + Intronic
1144285514 17:13770283-13770305 CCCTCCCCTCACAAGCCCTGAGG - Intergenic
1145082387 17:19905439-19905461 CTTTCCCTTCAGAATACATGTGG - Exonic
1145378211 17:22371194-22371216 CCCTCCCATCACAAGCCTGGAGG - Intergenic
1145772193 17:27501489-27501511 CTCTCCCATCACAGGCCTGGAGG + Intronic
1145978163 17:28996290-28996312 CTCTCCCATCGGCAGGCAGGAGG + Intronic
1146451989 17:32981816-32981838 CCCTCCCATCACAGGCCAGGAGG - Intronic
1148801029 17:50225922-50225944 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1149110264 17:53019614-53019636 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1149668191 17:58381227-58381249 GTCTCTCCTCAGAAGCCATTGGG + Intronic
1150550232 17:66203398-66203420 CTTCCCCATCAGTGGCCATGTGG + Intergenic
1150687336 17:67331444-67331466 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1151032617 17:70758594-70758616 TTCTCCCATCACAAGCCCAGAGG - Intergenic
1151661969 17:75524014-75524036 CTCACCCAGCAGAAGGGATGTGG + Intronic
1152201705 17:78951045-78951067 CTGTCCCAGCTGATGCCATGTGG + Intergenic
1152548011 17:81012679-81012701 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1153388641 18:4529823-4529845 CTCTCCAATCAAAAGACATGGGG - Intergenic
1153539121 18:6135254-6135276 CTCTCCCATCACAGGCCTGGAGG - Intronic
1154092915 18:11381503-11381525 CCCTCCCATCAGAGGCCCAGAGG - Intergenic
1154411603 18:14144934-14144956 CTCACCCAGCAGATGCCATGTGG - Intergenic
1155849466 18:30752832-30752854 CTGTACCATCAGAGGCCCTGAGG + Intergenic
1155988161 18:32252642-32252664 CCCTCCCATCAGAGGCCAGGAGG - Intronic
1156081373 18:33340536-33340558 CCCTCCCATCACAAGCCTGGAGG + Intronic
1156207942 18:34906300-34906322 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1156322291 18:36038209-36038231 CTCTCCCATCACAGGCCCAGAGG + Intronic
1156817485 18:41328461-41328483 TCCTCCCATCAGAGGCCAGGAGG + Intergenic
1157599952 18:48887779-48887801 CTCTCCCACCTGAGGTCATGAGG + Intergenic
1159152006 18:64533727-64533749 CTATGCCATCACAAGCCAGGAGG + Intergenic
1159705378 18:71679662-71679684 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1159811762 18:73025582-73025604 TTCTCCCATCACAAGCCCAGAGG + Intergenic
1160196488 18:76759539-76759561 CTCTCCCATCAGCCACCCTGAGG - Intergenic
1160278409 18:77461920-77461942 CTCTCTCTGCTGAAGCCATGAGG + Intergenic
1160295263 18:77631456-77631478 CCCTCCCAACACAAGCCAGGAGG - Intergenic
1162479268 19:10919235-10919257 CTCTCCCATCAAAGACCATGCGG - Intronic
1163116597 19:15192370-15192392 CTCTCACCTCGGAAGCCACGGGG + Exonic
1164369811 19:27634761-27634783 CTCTCCCATTGGAATGCATGTGG + Intergenic
1164369831 19:27634901-27634923 CTCTCCCATTAAAATCCCTGGGG + Intergenic
1164370121 19:27636658-27636680 CTCTCCCATTAGAATTCTTGAGG + Intergenic
1164371486 19:27647813-27647835 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164371543 19:27648233-27648255 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164371811 19:27650063-27650085 CTCTCCCATTAGAATGCTTGGGG + Intergenic
1164372024 19:27651534-27651556 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164372363 19:27653714-27653736 CTCTCCCATTAGAATGCCTGAGG + Intergenic
1164372640 19:27655556-27655578 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164372706 19:27655935-27655957 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164372747 19:27656178-27656200 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164374248 19:27671738-27671760 CTCTCCCATCAGAATCCCTAAGG + Intergenic
1164374265 19:27671878-27671900 CTCTCCCATTAGAATGCTTGGGG + Intergenic
1164374362 19:27672475-27672497 CTCTCCCATTAGAATGCTTGTGG + Intergenic
1164374440 19:27673028-27673050 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164374461 19:27673238-27673260 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164374599 19:27674075-27674097 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164375252 19:27678382-27678404 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164375319 19:27678986-27679008 CTCTCCCATTAGAATTCCTGGGG + Intergenic
1164375438 19:27679818-27679840 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164375485 19:27680098-27680120 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164376245 19:27690759-27690781 CTCTCCCATTAGAAAACCTGGGG + Intergenic
1164376338 19:27691413-27691435 CTCTCCCATTAGAATCCCTGAGG + Intergenic
1164376423 19:27691935-27691957 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164376692 19:27693774-27693796 CTCTCCCATTAGAATACCTGTGG + Intergenic
1164376729 19:27694017-27694039 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164376789 19:27694436-27694458 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164376847 19:27694814-27694836 CTCTCCAATGAGAAGACCTGGGG + Intergenic
1164376889 19:27695121-27695143 GTCTCCCATTAGAATGCATGGGG + Intergenic
1164379053 19:27716809-27716831 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164379205 19:27717961-27717983 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164379508 19:27719976-27719998 CTCTCCCATTAGAATGCCTGAGG + Intergenic
1164379534 19:27720145-27720167 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164379606 19:27720525-27720547 CTCTCCCATTAGAATCACTGGGG + Intergenic
1164380563 19:27734084-27734106 CTCTCCCATCAGAATGCATGAGG + Intergenic
1164380581 19:27734189-27734211 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164380632 19:27734534-27734556 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164380709 19:27735023-27735045 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164380845 19:27735967-27735989 GTCTCCCATTAGAATGCATGTGG + Intergenic
1164380940 19:27736625-27736647 CTCTCCCATTAGAATCACTGGGG + Intergenic
1164381233 19:27738516-27738538 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164381246 19:27738586-27738608 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164381672 19:27741361-27741383 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164381743 19:27741884-27741906 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164381848 19:27742644-27742666 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164382059 19:27743970-27743992 CTCTCCCATTAGAATGCCTGTGG + Intergenic
1164382072 19:27744040-27744062 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164382197 19:27744779-27744801 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164382253 19:27745129-27745151 CTCTCCCATTAGAATACCTGGGG + Intergenic
1164383111 19:27752112-27752134 CTCTCCCATTAGAATGCATGTGG + Intergenic
1164383254 19:27752975-27752997 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164383307 19:27753354-27753376 CTCTCACATTAGAAGGCCTGGGG + Intergenic
1164383341 19:27753564-27753586 CTCTCCCATGAGAATGCCTGGGG + Intergenic
1164383429 19:27754123-27754145 CTCTCCCATCAGAATGCCTGGGG + Intergenic
1164384007 19:27758246-27758268 TTCTCCCATTAGAATACATGAGG + Intergenic
1164384174 19:27759420-27759442 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164384301 19:27760220-27760242 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164384350 19:27760535-27760557 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164384505 19:27761554-27761576 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164384818 19:27763626-27763648 CTCTCCCATTAGAATCACTGGGG + Intergenic
1164384946 19:27764433-27764455 CTCTCCCATTAGAATTCCTGTGG + Intergenic
1164384974 19:27764570-27764592 CTCTCCCATAAAAATCCCTGGGG + Intergenic
1164385001 19:27764745-27764767 CTCTCCCATAATAAGGCCTGTGG + Intergenic
1164385352 19:27767005-27767027 CTCTCCCATTAGAAAGCCTGGGG + Intergenic
1164385376 19:27767145-27767167 CTCTCCCATCAAAATGCCTGGGG + Intergenic
1164385869 19:27770329-27770351 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1164395667 19:27861049-27861071 CTCTCCCATTAGAATGCTTGAGG - Intergenic
1164395762 19:27861671-27861693 CTCTCCCATCAAAATGAATGAGG - Intergenic
1164553556 19:29232608-29232630 CTCTCCCTGCAGTAGCCAAGAGG - Intergenic
1164871524 19:31648508-31648530 CTCGCCCATGAGAGGCCAAGTGG + Intergenic
1165731205 19:38146347-38146369 CTCACCCATCAAAAGACATTTGG + Intronic
1165906119 19:39196052-39196074 CTCCCCCATCAGAGGTCACGAGG - Intergenic
1166017470 19:39993769-39993791 CCCTCCCATCACAAGCCCCGAGG + Intronic
1168596543 19:57682276-57682298 CTCCCCCAGCAGAAGCCTTAAGG + Intronic
1168655421 19:58123849-58123871 CCCTCCCATCACAAGCCTGGAGG - Intergenic
925160131 2:1677735-1677757 GGCTCCCCTCAGCAGCCATGAGG + Intronic
925805200 2:7641485-7641507 CTCTCCCATCACAGGCCTGGAGG - Intergenic
926393435 2:12417589-12417611 TTCTCCCATCAGAAGACATAGGG - Intergenic
926476447 2:13328468-13328490 CTCAGCCATCAGAAGCCCAGTGG - Intergenic
926734662 2:16063668-16063690 CCCTCCCATCACAAGCCTGGAGG - Intergenic
926816750 2:16805068-16805090 CCCTCCCATCATAAGCCTGGAGG - Intergenic
927020319 2:19010004-19010026 CCCTCCCATAAGTAGCCAGGAGG + Intergenic
928494795 2:31820534-31820556 CCCTCCCATCACAGGCCCTGAGG - Intergenic
928722586 2:34137564-34137586 ATCATCCATCAGAATCCATGGGG - Intergenic
929640323 2:43571679-43571701 ATTTCCCATCAGAAGGCATAGGG - Intronic
930293989 2:49530435-49530457 CCCTCCCATCACAGGCCAAGAGG - Intergenic
930404810 2:50941944-50941966 CCCTCCCATCAGAGGCCTTGAGG + Intronic
930742446 2:54845798-54845820 TTCTGCCATCAGAAGGGATGGGG - Intronic
930940877 2:57013355-57013377 CACTCCCATCACAAGCCCAGAGG + Intergenic
931079404 2:58752670-58752692 CCCTCCTATCAAAAGCCAGGAGG + Intergenic
931096076 2:58942716-58942738 CCCTCCCATCAGAAGCCCAGAGG + Intergenic
931119331 2:59199107-59199129 CCCTCCCATCACAGGCCAAGAGG + Intergenic
931494155 2:62783739-62783761 CCCTCCCATCACAGGCCAGGAGG - Intronic
932139241 2:69261049-69261071 CTTACCCATCAGAAGCAATATGG + Intergenic
933397930 2:81755077-81755099 CCCTCCCATCACAGGCCAAGAGG - Intergenic
933640747 2:84756798-84756820 CCTTTCCATCAGAAGCCATCTGG - Intronic
935240032 2:101170376-101170398 CCCTCCCATCACAGGCCCTGAGG + Intronic
935448826 2:103187046-103187068 CCCTCCCATCACAAGCCCAGAGG + Intergenic
935819700 2:106882595-106882617 ATCTCACACCAGAAGACATGTGG + Intronic
936169331 2:110154994-110155016 CCCTCCCATCACAGGCCAGGAGG + Intronic
936257493 2:110929645-110929667 CCCTCCCATCACAAGCCAGGAGG + Intronic
936484743 2:112916338-112916360 CTGTCCAATCAGAGGCCAGGAGG + Intronic
936511415 2:113150466-113150488 ATCCCCCAGCAGCAGCCATGTGG - Intergenic
936543972 2:113374198-113374220 CCCTCCCATCACAGGCCAGGAGG - Intergenic
936734802 2:115427638-115427660 CCCTCCCATCAGAGGCCCAGGGG - Intronic
936897547 2:117445620-117445642 CCCTCCCATCACAAGCCTGGGGG + Intergenic
937032319 2:118751046-118751068 CTCTACCATCACAAGCCATAGGG - Intergenic
937134553 2:119541688-119541710 AGCTGCCATCAGAGGCCATGAGG - Intergenic
937554026 2:123132170-123132192 CCCTCCCATAAGAAGCCAGGAGG + Intergenic
937680066 2:124634012-124634034 CTCTCCCATCACAAGCCTGGAGG - Intronic
937995149 2:127688669-127688691 ATGTCTCATCAGAAGCAATGGGG - Intergenic
938510468 2:131936834-131936856 CCCTCCCATCATAAGCCCAGAGG - Intergenic
938619313 2:133032331-133032353 CACTGCCATCCCAAGCCATGAGG - Intronic
939405193 2:141746501-141746523 ATCTCCCAGCAGCAGCCACGTGG - Intronic
939519981 2:143217769-143217791 TTCTTCCCTCAGCAGCCATGTGG + Intronic
940355671 2:152738720-152738742 CTCTCCCATCACAAGCTGGGAGG - Intronic
940426775 2:153540086-153540108 CTCTCCCATCAGAGGCCTGAAGG + Intergenic
941165536 2:162079167-162079189 CCCTTCCATCACAAGCCAGGAGG - Intergenic
941346196 2:164372343-164372365 CCCTCCCATCACAAGCCTGGAGG + Intergenic
943017244 2:182528655-182528677 CCCTCCCATCACAAGCCTGGAGG + Intergenic
943795963 2:191994543-191994565 CTTTTCCATTAGAAGACATGAGG + Intronic
943817772 2:192277708-192277730 CTCTCCCATCACACGCCTGGAGG - Intergenic
943998033 2:194796897-194796919 CCCTTCCATCACAAGCCAGGAGG + Intergenic
944250158 2:197573711-197573733 CCCTCCCATCACAAGCCTGGAGG + Intronic
945231963 2:207600737-207600759 CTATCCCATCAGATGTCATCTGG + Exonic
945900629 2:215533894-215533916 CCCTCCCATCACAAGCCTGGAGG + Intergenic
946574300 2:221057419-221057441 CCCTCCCATCACAGGCCAGGAGG - Intergenic
947008492 2:225538604-225538626 CTCTCCCATTACAAGCCTAGAGG - Intronic
947889684 2:233605839-233605861 CCCTCCCATCACAAGCCTTGAGG - Intergenic
948209834 2:236184869-236184891 CCCTCCCATCACAAGCCCAGAGG + Intergenic
948504078 2:238416104-238416126 GTCTCCCACCAGAAGTCATGTGG + Intergenic
1169344714 20:4821267-4821289 ACCTCCAAACAGAAGCCATGTGG + Intronic
1169858046 20:10124459-10124481 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1170019264 20:11817598-11817620 GCTTCCCATCAGAAACCATGAGG + Intergenic
1170062437 20:12273154-12273176 CTCTCCCATCACAAGCCCAGAGG - Intergenic
1170750394 20:19139795-19139817 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1170828714 20:19820751-19820773 CTATCGCATCAGAAACCCTGAGG - Intergenic
1170884445 20:20328004-20328026 CTCTCCAGTCAGAATCCATGCGG + Intronic
1170938502 20:20829842-20829864 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1170953021 20:20953759-20953781 GTCTCCCAGCAGAAGCAATGAGG + Intergenic
1171118760 20:22549798-22549820 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1171571439 20:26255360-26255382 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1171879015 20:30602987-30603009 CTCTCCCCTCAGCAGCCTTGGGG + Intergenic
1172110391 20:32541278-32541300 CTCTGTCCTCAGTAGCCATGAGG - Intronic
1172886110 20:38231974-38231996 CTCTCCCCACAGGAGTCATGAGG + Intronic
1172943286 20:38669261-38669283 CTCTCTCACCAGCACCCATGTGG - Intergenic
1173905883 20:46628406-46628428 CTCTGCCGTCAGAAGCCAGTGGG + Intronic
1174000189 20:47369013-47369035 ATCTCCCATCCCAAGCCCTGTGG + Intergenic
1174147521 20:48462542-48462564 CTTTACCTTCAGAAGCCATGGGG + Intergenic
1174453447 20:50633640-50633662 CCTTCCCATCAGAAGCCTTCTGG + Intronic
1175358737 20:58390157-58390179 CAATCCCATCAGAAGTCCTGAGG - Intronic
1177261237 21:18732956-18732978 CCCTCCCATCAGATGCCCAGAGG + Intergenic
1177484981 21:21745767-21745789 CCCTCCCATCACTAGCCCTGAGG + Intergenic
1177504347 21:22000970-22000992 CCCTCCCATCACAGGCCCTGAGG - Intergenic
1177771179 21:25518515-25518537 ATCCCCCAGCAGCAGCCATGTGG + Intergenic
1177981005 21:27915270-27915292 CCCTCCCATCATAAGCCCAGAGG + Intergenic
1178437947 21:32575915-32575937 CACTCCCAGCAGAAGGCGTGTGG - Intergenic
1179374454 21:40837269-40837291 CTCTCCCATCCTCAGCAATGGGG + Intronic
1179936638 21:44610283-44610305 CCCTCCCATCAGAGGCCTGGAGG + Intronic
1180138769 21:45878210-45878232 CTCTCCCACCAGAGGACCTGTGG + Intronic
1181174795 22:21029331-21029353 CTCACCCATCAGCAGCCAGATGG + Exonic
1181635206 22:24171279-24171301 CTCTCCCATGAGTGGCCATTGGG + Intronic
1182284637 22:29238320-29238342 CTGTCACCTCAGAAGCCTTGAGG + Intronic
1184435909 22:44475954-44475976 ATTTCTCATCAGAAACCATGCGG - Intergenic
1185366599 22:50439689-50439711 CTCCCCCAGCAGGCGCCATGTGG + Exonic
949464452 3:4329620-4329642 CCCTCCCATCAGAAACCTGGAGG - Intronic
949611740 3:5709887-5709909 CCCTCCCATCACAAGCCCAGAGG - Intergenic
950137419 3:10591414-10591436 CTCTGGCCTCAGAGGCCATGGGG - Intronic
950468453 3:13170047-13170069 CCCTCCCATCACAAGCCCAGAGG + Intergenic
950697304 3:14712990-14713012 ATTTCTCATCAGAAACCATGGGG - Intronic
951324528 3:21286322-21286344 CTCTCCCATCATAGGCCCAGAGG + Intergenic
952397034 3:32930332-32930354 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
952480271 3:33754017-33754039 CCCTCCCATCACAAGCCTGGAGG - Intergenic
952541233 3:34370494-34370516 CCCTCCCATCACAAGCCCAGAGG + Intergenic
952596838 3:35028309-35028331 CCCTCCCATCACAGGCCAGGAGG - Intergenic
953503713 3:43462732-43462754 CCCTCCCATCACAGGCCAGGAGG + Intronic
953842310 3:46398801-46398823 CTCTCCAATCAGGAGACAAGTGG - Intergenic
953972681 3:47359455-47359477 CCCTCCCATCACAGGCCCTGAGG + Intergenic
953988356 3:47463293-47463315 CTCTCCCATCACTGACCATGGGG + Intronic
954389621 3:50261724-50261746 TCCTGACATCAGAAGCCATGGGG - Intergenic
954909396 3:54090586-54090608 CTCTGCCACCTGAAGCAATGAGG - Intergenic
955396902 3:58563980-58564002 CTTTCCCATCAGAAGCCTATTGG - Intergenic
955436386 3:58903743-58903765 CTCTCCCACCACAACACATGGGG + Intronic
956688134 3:71851147-71851169 CTATTCAATCAAAAGCCATGTGG + Intergenic
956714222 3:72063876-72063898 CCCTCCCATCACAGGCCCTGAGG - Intergenic
956745338 3:72306694-72306716 CTCTGTCATTAGAAGCCATTGGG + Intergenic
956938640 3:74132115-74132137 CCCTCCCATCACAAGCCCAGAGG - Intergenic
956946719 3:74231583-74231605 CTCCTCCATCAGGAGGCATGTGG + Intergenic
957260667 3:77897352-77897374 CTCTCCCATCACAGGCCCAGAGG - Intergenic
957988219 3:87597480-87597502 CCCTCCCATCACAGGCCAGGAGG - Intergenic
958560533 3:95743020-95743042 CGCTCCCATCACAGGCCTTGAGG - Intergenic
958610108 3:96414312-96414334 CTCTCCTGTCTGAAGCCATTGGG - Intergenic
958831730 3:99098552-99098574 CCCTCCCATCAGAAGTCTGGAGG + Intergenic
958887216 3:99739739-99739761 CTCTCCCATCACAGGCCCAGAGG - Intronic
958956513 3:100470222-100470244 CTCTCCCATCACAGGCCCAGAGG - Intergenic
958973923 3:100644364-100644386 CTCTACCATCACAAAGCATGTGG - Intronic
959202980 3:103271787-103271809 CCCTCCCATCACAGGCCAAGAGG - Intergenic
959303526 3:104631484-104631506 CCCTCCCATCACAGGCCAGGAGG - Intergenic
959342588 3:105149437-105149459 CTCTCCCATCACAGGCCTGGAGG - Intergenic
959453522 3:106532103-106532125 CCCTCCCATCACAGGCCCTGAGG + Intergenic
959508255 3:107178361-107178383 CTCTCCCATCACAGGGCCTGGGG - Intergenic
959809226 3:110595159-110595181 CCCTCCCATCACAAGCCCAGAGG - Intergenic
960496688 3:118383883-118383905 CCCTCCCATCACAAGCCTGGAGG + Intergenic
960564452 3:119118534-119118556 CCCTCCCATCAGAGGCCTGGAGG - Intronic
960581404 3:119282466-119282488 CCCACCCATCACAAGCCAGGAGG + Intergenic
961067845 3:123891196-123891218 CCCTCCCATCACAGGCCAGGAGG - Intergenic
961073195 3:123956620-123956642 CTCTACCATCACAAGCTCTGAGG - Intronic
961445756 3:126980637-126980659 CTCTGCCTTCACCAGCCATGAGG + Intergenic
961572944 3:127813448-127813470 GTCTCCCATGGGAAGCCATTTGG - Intronic
961985954 3:131134820-131134842 ATCTCACTGCAGAAGCCATGTGG + Intronic
962339539 3:134570116-134570138 CTCTCCCATCACAGGCCTGGAGG - Intronic
962619440 3:137162660-137162682 CTGTCCCACCACAAGCCCTGAGG - Intergenic
963494544 3:146042965-146042987 CCCTCCCATCACAAGCCCAGAGG - Intergenic
963816691 3:149838691-149838713 CTCTCCCATCACAGGCCCAGAGG - Intronic
964090907 3:152874343-152874365 CCCTCCCATCACAAGCCTGGAGG - Intergenic
964179213 3:153864233-153864255 ATCTCCCAGCAGCAGCCATGTGG + Intergenic
964371303 3:156003540-156003562 GTCTCCCAGCAGGAGGCATGGGG + Intergenic
965189226 3:165506664-165506686 CCCTCCCATCACAGGCCAAGAGG - Intergenic
965301603 3:167011649-167011671 CCCTCCCATCATAGGCCCTGAGG - Intergenic
966059279 3:175734811-175734833 CCCTCCCATCACAAGCCTGGAGG - Intronic
966164807 3:177005894-177005916 CCCTCCCATCATAGGCCCTGAGG + Intergenic
967208503 3:187145660-187145682 CCCTCCCATCACAAGCCCAGAGG - Intronic
967462333 3:189761082-189761104 CTCTCCCATCACAGGCCTGGAGG - Intronic
967558977 3:190895952-190895974 CTCTCCCATCACAGGCCCAGAGG + Intergenic
968265530 3:197360253-197360275 CCCTCCCATCACAAGCCCAGAGG + Intergenic
969103579 4:4788486-4788508 CTCTCCCATCAAAAGCCTAGAGG + Intergenic
970540567 4:17074179-17074201 CGGTGCCATCAGAATCCATGTGG - Intergenic
970656418 4:18235324-18235346 CCTTACCATCAGAAGCCAAGTGG + Intergenic
971593520 4:28498220-28498242 CCCTCCCATCAGAGGCCCAGGGG - Intergenic
971601322 4:28595711-28595733 CCCTCCCATCACAAGCCTGGAGG + Intergenic
971793704 4:31199878-31199900 CTCTCCCATCACAGGCCTGGAGG - Intergenic
972370600 4:38419650-38419672 CTCTCCCATCACAGGCCTGGAGG - Intergenic
972748824 4:41968722-41968744 CTCTCCCATCACAGGCCCAGAGG + Intergenic
973063918 4:45763717-45763739 CCCTCCCATCACAAGCCCAGAGG - Intergenic
973580820 4:52342321-52342343 TCCTCCCATCACAAGCCCTGAGG - Intergenic
974219508 4:58948100-58948122 CCTTCCCATCACAAGCCAGGAGG - Intergenic
974455815 4:62128383-62128405 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
974606376 4:64156986-64157008 CCCTCCCATCAAAGGCCTTGAGG - Intergenic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
975038181 4:69710387-69710409 CTCTCCCATCACAAGTCTGGAGG - Intergenic
975040489 4:69739584-69739606 CTCTCCCATCACAGGCCCAGAGG - Intronic
975361358 4:73475365-73475387 CCCTCCCATCACAGGCCAGGAGG - Intergenic
975952303 4:79788787-79788809 CTCTCCCATCACAGGCCTGGAGG + Intergenic
976277126 4:83289425-83289447 CCCTCCCATCACAAGCCAGGAGG + Intergenic
976842323 4:89445797-89445819 CCCTCCCATCAGAGGCCTGGAGG - Intergenic
976949832 4:90814280-90814302 CTCTCCCATTACAGGCCAGGAGG - Intronic
977378275 4:96237197-96237219 CCCTCCCATCACAGGCCCTGTGG + Intergenic
978982062 4:114958662-114958684 TCCTCCCATCACAAGTCATGAGG - Intronic
979177096 4:117679056-117679078 CTCTCCCATCACAGGCCCAGAGG + Intergenic
979414249 4:120417189-120417211 CCCTCCCATCACAGGCCTTGAGG + Intergenic
979966838 4:127086411-127086433 CCCTCCCATCATAGGCCCTGAGG + Intergenic
980083655 4:128369458-128369480 CTCTCCCATCACAGGCCTGGAGG - Intergenic
980202739 4:129677075-129677097 CTCTCCCATCACAGGCCTGGAGG + Intergenic
980255992 4:130381889-130381911 TCCTCCCATCACAGGCCATGAGG + Intergenic
981308042 4:143267593-143267615 CTCTCCCATCACAAGCCTGGAGG + Intergenic
981335315 4:143562825-143562847 CTCTCCCTTCACAAGCCCAGAGG + Intergenic
981812626 4:148793015-148793037 CTATCCCCTTAGAAGCCAAGTGG - Intergenic
982261470 4:153497962-153497984 CTCTGCCATCAGAACCCTTAAGG - Intronic
982299836 4:153867537-153867559 CTCTCCCATCACAGGCCTGGAGG + Intergenic
982781022 4:159491786-159491808 CCCTCCCATCAGAGGACAAGAGG + Intergenic
982854411 4:160362700-160362722 CTGTCCCATCAAAAGCCCAGAGG - Intergenic
983298072 4:165891191-165891213 CCCTCCCATCACAAGCCAGAAGG - Intronic
983379073 4:166968375-166968397 CTCTCCCATCACAGGCCTGGAGG + Intronic
983554127 4:169044927-169044949 CACTCCCAGCTGAAGCCAAGTGG - Intergenic
983886750 4:172988634-172988656 CTCTCCCATCACAGGCCTGGAGG + Intronic
984116017 4:175682545-175682567 CTCTCCCATCACAGGCCCAGAGG + Intronic
984318609 4:178161526-178161548 CTCTCCCATCACAGGCCTGGGGG - Intergenic
984747932 4:183241028-183241050 CTCTCCCATGAGAGGCCCTGTGG - Intronic
984865485 4:184277132-184277154 CCCTCCCATCACAAGCCTGGAGG + Intergenic
986205706 5:5623324-5623346 CTCTCCCATCATAGGCCTAGAGG + Intergenic
986538283 5:8815643-8815665 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
986643212 5:9892041-9892063 CTTCCCCATCAGAACCCATATGG + Intergenic
986680142 5:10224828-10224850 CCCTCCCATCACAAGCCTGGAGG - Intergenic
986852405 5:11829351-11829373 CACTCCCATCACAGGCCAGGAGG + Intronic
987254647 5:16138169-16138191 CCCTCCCATCACAAGCCAGGAGG + Intronic
987433514 5:17865178-17865200 CTCTCCCATCATAGGCCTGGAGG + Intergenic
987602124 5:20084899-20084921 CCCTCCCATCACAAGCCTGGAGG - Intronic
987709082 5:21486215-21486237 CCCTCCCATCACAGGCCAGGAGG - Intergenic
988040988 5:25888491-25888513 CCCTCCCATGATAAGCCAGGAGG - Intergenic
988170693 5:27652153-27652175 CCCTCCCATCACAAGCCCAGAGG + Intergenic
988256183 5:28823116-28823138 CCCTCCCATCACAAGCCTGGAGG + Intergenic
988608652 5:32704209-32704231 ATCCCCCAGCAGCAGCCATGTGG - Intronic
988750530 5:34187938-34187960 CCCTCCCATCACAGGCCAGGAGG + Intergenic
988808867 5:34765812-34765834 CTCTCCCACCACAGGCCAGGAGG + Intronic
988956018 5:36320569-36320591 CTCTCCAATCAAAAGACATAGGG - Intergenic
989696878 5:44212266-44212288 CTCTCCCATCACAAGCCCAGAGG + Intergenic
989778159 5:45233363-45233385 CCCTCCCATCACAGGCCAGGAGG - Intergenic
989956017 5:50361051-50361073 CTCTGACATAAGAAGCCATTGGG - Intergenic
990083356 5:51944629-51944651 CTCTCCCATCACAGGCCTGGAGG + Intergenic
990701111 5:58475636-58475658 CCCTCCCATCAGAGGCCCGGAGG - Intergenic
990731085 5:58810175-58810197 GTCTCCCATCAGAAACCAGCTGG + Intronic
991107236 5:62858573-62858595 CTCTCCAATCAAAAGACATAGGG - Intergenic
991450672 5:66747875-66747897 CTCACCCTTCAGAAGACATGGGG - Intronic
991738792 5:69651136-69651158 CCCTCCCATCACAGGCCAGGAGG + Intergenic
991759405 5:69905291-69905313 CCCTCCCATCACAGGCCAGGAGG - Intergenic
991787930 5:70212827-70212849 CCCTCCCATCACAGGCCAGGAGG + Intergenic
991790367 5:70230877-70230899 CCCTCCCATCACAGGCCAGGAGG + Intergenic
991818252 5:70527253-70527275 CCCTCCCATCACAGGCCAGGAGG + Intergenic
991838633 5:70780357-70780379 CCCTCCCATCACAGGCCAGGAGG - Intergenic
991880376 5:71213191-71213213 CCCTCCCATCACAGGCCAGGAGG + Intergenic
992375699 5:76185727-76185749 CTCTCCCATCACAGGCCTGGAGG - Intronic
993084642 5:83348604-83348626 CCCTCCCATCACAGGCCAGGAGG - Intronic
993310889 5:86330899-86330921 CTCTCCCATCATAGGCCCAGAGG + Intergenic
993893756 5:93505795-93505817 CCCTCCCATCACAAGCCTGGAGG - Intergenic
994019245 5:95004482-95004504 CCCTCCCATCACAGGCCAGGAGG + Intronic
994267388 5:97734397-97734419 CTCTTCGAACAGAAGCAATGGGG + Intergenic
994325726 5:98442669-98442691 CCCTCCCATCACAGGCCCTGAGG - Intergenic
994421209 5:99527558-99527580 CCCTCCCATCACAGGCCAGGAGG - Intergenic
994485832 5:100386756-100386778 CCCTCCCATCACAGGCCAGGAGG + Intergenic
994823277 5:104680512-104680534 CCCTCCCATCACAAGCCTGGAGG + Intergenic
994895641 5:105698346-105698368 CTCTCCCATCACAGGCCCTAAGG - Intergenic
995591029 5:113699625-113699647 CCCTCCCATCACAGGCCCTGAGG - Intergenic
995591642 5:113705909-113705931 CTCTCCCATCACAGGCCCAGAGG - Intergenic
995705850 5:114989045-114989067 CTCTCTCTTCAGAAGGCATAAGG + Intergenic
997057263 5:130459680-130459702 CTCTCCCATCACAGGCCCAGAGG + Intergenic
997086422 5:130805903-130805925 CCCTCCCATCACAAGCCAGGAGG + Intergenic
997274667 5:132574471-132574493 CCCTCCCATCACAAGCCCAGAGG - Intronic
998141443 5:139701683-139701705 CCCTCCCCTAAGTAGCCATGTGG - Intergenic
998144620 5:139720118-139720140 CTCTCCCATCACAGGCCTGGAGG + Intergenic
998331437 5:141331317-141331339 CACCCCCATCAGAAGCTGTGAGG - Exonic
998980516 5:147697516-147697538 CTCTCCCATCACAGGCCTGGAGG + Intronic
998991519 5:147822575-147822597 CTGACCCATCAGAAAGCATGTGG - Intergenic
999635845 5:153621509-153621531 CCCTTACATCAGAAACCATGTGG + Intronic
999685720 5:154101342-154101364 CCCTCCCATCAGATGCTAGGAGG + Intronic
1000103074 5:158035431-158035453 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1000229148 5:159298643-159298665 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1000522366 5:162311785-162311807 CTTTCTCATCATAAACCATGAGG + Intergenic
1000675239 5:164113902-164113924 GGCTTCCATCAGAAGCTATGAGG + Intergenic
1000768378 5:165319365-165319387 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1002049121 5:176559773-176559795 CTCCCCCATCAGGAGACATCTGG + Intronic
1002315558 5:178341052-178341074 CTCCACCATCAGGAGCCATGTGG - Intronic
1002489259 5:179562458-179562480 CTCTCCCCACAAAAGCCAAGTGG - Intronic
1002794079 6:456637-456659 CCCTCCCATCATAGGCCCTGAGG - Intergenic
1003127988 6:3371284-3371306 CTCTAGCAGCAGATGCCATGTGG - Intronic
1003230081 6:4243769-4243791 CTCTCCCATCAGAGGCCCAGAGG - Intergenic
1003401800 6:5796593-5796615 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1004249674 6:14013368-14013390 GCCTCCCATCAGAAGGCAGGTGG + Intergenic
1004322099 6:14639926-14639948 CTCTCAGACCAGAAGCCCTGGGG - Intergenic
1004430182 6:15536315-15536337 CTCTCCCATCACAGGCCCTGAGG + Intronic
1004565208 6:16789517-16789539 CCCTCCCATCACAGGCCCTGAGG - Intergenic
1004834517 6:19516070-19516092 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1005548599 6:26894243-26894265 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1006062922 6:31439027-31439049 CTCTCCCATCACAAGCCCAGAGG + Intergenic
1006340356 6:33443348-33443370 CTGGCCCATCAGCAGCCATGTGG - Exonic
1007062740 6:38956456-38956478 CACTCCCATCTGAACCAATGAGG + Intronic
1007136928 6:39531536-39531558 CTCCTCTATCATAAGCCATGAGG + Intronic
1007166609 6:39832845-39832867 GTCTACCCTCAGAAGCCCTGGGG - Intronic
1007287603 6:40758788-40758810 CTCTTCCAAGAGAAGCCTTGGGG - Intergenic
1007836944 6:44681341-44681363 CTCTCCAATGACCAGCCATGGGG + Intergenic
1008727364 6:54438860-54438882 CTCTCCAATCAAAAGACATAGGG - Intergenic
1009019357 6:57935350-57935372 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1009490553 6:64284935-64284957 CTCTCCCATCACAGGCCCAGAGG - Intronic
1009547023 6:65033417-65033439 CACTCCCATCACAGGCCAGGAGG + Intronic
1009637073 6:66280362-66280384 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
1009710200 6:67308411-67308433 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1009723512 6:67506565-67506587 CCCTTCCATCATAAGCCAGGAGG - Intergenic
1009732130 6:67622174-67622196 CCCTCCCATCACATGCCCTGAGG + Intergenic
1009840101 6:69060268-69060290 CTCTCTCAGCAAAAGCCATAGGG + Intronic
1010055083 6:71556007-71556029 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1010344951 6:74800412-74800434 CTCTCCCATCACAGGCCTAGAGG + Intergenic
1010348425 6:74841088-74841110 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1010504990 6:76646067-76646089 CTCTCCCATGAGAAGAGATTAGG + Intergenic
1011218928 6:85033782-85033804 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1011287895 6:85744616-85744638 CTCTCCTATCATAAACCCTGAGG + Intergenic
1011942334 6:92857675-92857697 CCCTCCCATCACAGGCCCTGAGG - Intergenic
1011955982 6:93025818-93025840 CTCTCCCATCACAGGCCAAGGGG - Intergenic
1012097223 6:94977567-94977589 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1012118479 6:95334285-95334307 CCCTTCCATCATAAGCCTTGAGG - Intergenic
1012213794 6:96557131-96557153 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1012485850 6:99722206-99722228 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
1012780126 6:103546986-103547008 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1012968042 6:105696796-105696818 CTCTCACATCAGTGGCCATGTGG + Intergenic
1013747363 6:113361489-113361511 TTCTGCCCTCAGTAGCCATGCGG + Intergenic
1013904474 6:115198748-115198770 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1013910647 6:115272438-115272460 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1014116007 6:117669760-117669782 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1014469947 6:121801624-121801646 CCCTCCCATCAGAAGCCTGAAGG + Intergenic
1014721315 6:124921023-124921045 CCCTCCCATCACAAGCCAGGAGG - Intergenic
1014771750 6:125465460-125465482 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1015045227 6:128768418-128768440 CTCTCCCATCACAGGCCCAGTGG - Intergenic
1015891112 6:137970504-137970526 TTCTCATATCAGCAGCCATGAGG + Intergenic
1015901662 6:138074510-138074532 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1016470511 6:144370212-144370234 CCCTCCCATCCCAAGCCAGGAGG + Intronic
1016477407 6:144442028-144442050 CCCTCCCATCACAAGCCCAGAGG - Intronic
1018013318 6:159691951-159691973 CTCTCCCACCTGAAGTCAAGTGG + Intronic
1018457949 6:163969673-163969695 CTCTCTCATGTGAAGCCATTTGG + Intergenic
1018511098 6:164525906-164525928 CCCTCCCATCACAAGCCTAGAGG + Intergenic
1019397067 7:826694-826716 CGTTCCCATCAGAAACCGTGGGG - Intronic
1019464055 7:1176775-1176797 CTGACTCATCAGAAGCCAGGTGG - Intergenic
1019891423 7:3950263-3950285 AACTCCCATGAGAAGCCCTGGGG - Intronic
1020696491 7:11420245-11420267 CACTCCCATCACAAGCCCAGAGG + Intronic
1020730072 7:11869376-11869398 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021667808 7:23003921-23003943 CTCCCCAATCAGAAACTATGTGG + Intronic
1022204904 7:28154133-28154155 CCCTCCCATCCCAACCCATGAGG + Intronic
1022223710 7:28340979-28341001 ATCCCCCAGCAGTAGCCATGTGG - Intronic
1022533226 7:31079792-31079814 CTCTCCCATCTGAGGGCCTGGGG + Intronic
1022549661 7:31227142-31227164 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
1023156286 7:37255879-37255901 CTCTCTCACCAGAAGCCGTGGGG + Intronic
1023164512 7:37330063-37330085 CTCTCCCATCAGAAGCCATGTGG - Intronic
1024653447 7:51428657-51428679 CTCTCCCCTCTGATACCATGTGG - Intergenic
1024684967 7:51734828-51734850 CCTTCCCATCACAAGCCATGAGG - Intergenic
1024843923 7:53620285-53620307 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1025285730 7:57659396-57659418 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1026859814 7:73778494-73778516 CTCTAGCATCAGAAGAGATGAGG + Intergenic
1027300447 7:76828172-76828194 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1027979591 7:85200760-85200782 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1027990961 7:85360668-85360690 CTCTCCCATCACAAGCCTGGAGG + Intergenic
1028126056 7:87114834-87114856 CTTTCCCATCACAGGCCTTGAGG + Intergenic
1030459013 7:109807861-109807883 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1031175001 7:118338937-118338959 CCCTCCCATCAGAAGTCCAGAGG + Intergenic
1031435652 7:121728897-121728919 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1031703761 7:124958107-124958129 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1031791939 7:126117954-126117976 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
1031807573 7:126327034-126327056 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1032925801 7:136603703-136603725 CTCTCCCATCACAAGCCAGGAGG + Intergenic
1033757795 7:144409768-144409790 CAAACCCATGAGAAGCCATGAGG + Intronic
1034751095 7:153569550-153569572 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1034751286 7:153571369-153571391 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1035371380 7:158381069-158381091 CCCTCCCATCACAGGCCCTGAGG - Intronic
1035564309 8:631073-631095 CCCTCCCATGAGCAACCATGTGG + Intronic
1037081905 8:14797706-14797728 CCCTCCCATCACAGGCCCTGAGG + Intronic
1037254730 8:16941082-16941104 ATCTCCCACCAGCAGCCATGTGG + Intergenic
1037583840 8:20262990-20263012 CTCTCCCTACTGAAGTCATGTGG - Intronic
1040397243 8:47011457-47011479 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1042071668 8:64941677-64941699 CTCTCCCATCACAGGCCTAGAGG - Intergenic
1042073976 8:64967856-64967878 CTCTCCCATCACAGGCCCTGAGG - Intergenic
1042898260 8:73694746-73694768 CACTCCCAGCAGCAGCCATGTGG + Intronic
1043062244 8:75518762-75518784 CCCTCCCATCACAAGCCAGGAGG - Intronic
1043199056 8:77340150-77340172 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1043565674 8:81544759-81544781 CTCTCCCACCAGACCTCATGAGG - Intergenic
1044087248 8:87956059-87956081 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1044125341 8:88452446-88452468 CCCTCCCATCAGAGGCCCAGAGG - Intergenic
1044199186 8:89413749-89413771 GTCTCCCACCAGAAGTCAGGTGG + Intergenic
1044220486 8:89663680-89663702 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1044295086 8:90518549-90518571 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1045214218 8:100130415-100130437 CCCTCCCATCATAAGCCTGGAGG - Intronic
1045272107 8:100670826-100670848 CTCTGCCAGCAGAGGCCAGGAGG - Intergenic
1045315351 8:101039261-101039283 GTCTCCCATCAGGAGGCCTGGGG - Intergenic
1045646264 8:104302634-104302656 TTCTCCCATCTGAAGGCATGGGG - Intergenic
1046519721 8:115308920-115308942 CCCTCCCATTACAAGCCAGGAGG - Intergenic
1046703274 8:117424298-117424320 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1049009866 8:139880139-139880161 CTCTTCCCGAAGAAGCCATGTGG - Intronic
1049631169 8:143658437-143658459 CTCTCCCATCAGAGGCTCAGAGG - Intergenic
1049792097 8:144476820-144476842 CTCTCCCCTCAGACGCCACGTGG + Intergenic
1049864174 8:144922991-144923013 TTCTCCCAGCAGCGGCCATGTGG - Intergenic
1050643353 9:7692918-7692940 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1051644218 9:19251397-19251419 CTCTCCCATCACAGGCCCAGAGG - Intronic
1051743940 9:20276970-20276992 CCTTCCCATCACAAGCCAGGAGG - Intergenic
1051984291 9:23063908-23063930 CTCTCCCATCACAGGCCTGGAGG - Intergenic
1051991961 9:23162648-23162670 CTGTCCCAGCAGCAGCCATTCGG + Intergenic
1052210221 9:25894392-25894414 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1052594076 9:30536662-30536684 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1052637312 9:31121722-31121744 CTCTCCCATCACAGGCCAGGAGG - Intergenic
1053060638 9:35028562-35028584 CTCTCCCATCACAAGCTAAGAGG + Intergenic
1053084155 9:35203957-35203979 CTCTCCCATCACAGGCCCAGAGG + Intronic
1053175609 9:35920732-35920754 GTCTCCCATAACAAGCCTTGGGG + Intergenic
1053296041 9:36913507-36913529 CTCCCCCATCAGCAGGCCTGTGG + Intronic
1053625577 9:39867599-39867621 CCCTCCCATCAGAGGCCAGGAGG + Intergenic
1053879282 9:42575624-42575646 CCCTCCCATCACAGGCCAGGAGG - Intergenic
1053893377 9:42718734-42718756 CCTTCCCATCAGAGGCCAGGAGG + Intergenic
1054218311 9:62383102-62383124 CCCTCCCATCAGAGGCCAGGAGG - Intergenic
1054232407 9:62526073-62526095 CCCTCCCATCACAGGCCAGGAGG + Intergenic
1054860083 9:69942526-69942548 TACTCCTATCAGAAGCCCTGTGG + Intergenic
1055843331 9:80531729-80531751 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1056110203 9:83387867-83387889 CTCTTAAATCAGAATCCATGGGG - Intronic
1056828717 9:89896680-89896702 CTCTCCACTCAGAGGCAATGAGG - Intergenic
1056966538 9:91167140-91167162 CTCTCCCATTAGAATGCCTGGGG + Intergenic
1057233250 9:93338346-93338368 TCCTCCCATCACAAGCCCTGAGG + Intronic
1057542457 9:95988100-95988122 CCCTCCCATCACAGGCCCTGAGG - Intronic
1057845773 9:98521350-98521372 CTCACCCATCAGAGGCTGTGAGG - Intronic
1058780210 9:108325569-108325591 CACTCCCACCTGAGGCCATGAGG - Intergenic
1058826684 9:108781549-108781571 CTCGCCCCTCAGAAGGCATCAGG + Intergenic
1059570131 9:115425342-115425364 CCCTCCCATCAGAGGCCCAGAGG - Intergenic
1060019536 9:120117282-120117304 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1060308120 9:122434815-122434837 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1061649018 9:132031152-132031174 CTGCTCCATCAGAAGCCAGGTGG + Intronic
1062390837 9:136333261-136333283 CACACCCAGCAGATGCCATGGGG - Intronic
1203790233 EBV:147518-147540 CTGACCCAACAGAAGCCAGGTGG - Intergenic
1185797684 X:2981131-2981153 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1186117318 X:6318547-6318569 ATCTCCCACCAGAAACCGTGGGG + Intergenic
1186797697 X:13062546-13062568 CTCTACCATCACAAGCCCAGAGG - Intergenic
1187598364 X:20799981-20800003 CCCTCCCATCACAAGACAGGAGG + Intergenic
1187784386 X:22867368-22867390 GTCTCCCATGAGGAGGCATGGGG - Intergenic
1187830938 X:23380472-23380494 CTCTCCATTGAGCAGCCATGTGG + Intronic
1188587992 X:31800513-31800535 CCCTCCCATCACAAGCCCAGAGG - Intronic
1188794257 X:34442291-34442313 CCCTCCCATCACAAGCCAGGAGG - Intergenic
1188873182 X:35398754-35398776 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1189176609 X:38963702-38963724 CTCTCCCTTCACAAGCCCAGAGG - Intergenic
1189238805 X:39509570-39509592 CTCTCCCAGCTGCAGCCATCTGG + Intergenic
1189594424 X:42548767-42548789 CCCTCCCATCACAAGCCCTGAGG - Intergenic
1189637247 X:43023832-43023854 CCCTCCCATCAGAAGCCCAGAGG - Intergenic
1189656435 X:43249619-43249641 CTCTCCCATCACAGGCCTGGAGG + Intergenic
1191095032 X:56665027-56665049 CCCTCCCATCAGAGGCCCAGAGG + Intergenic
1191229068 X:58079823-58079845 CTCTCCCATTAGAATGAATGAGG - Intergenic
1191229235 X:58081025-58081047 CTCTCCCATTAGAACGAATGAGG - Intergenic
1191229378 X:58082033-58082055 CTCTCCCTTCAGAAAACCTGAGG - Intergenic
1191229426 X:58082348-58082370 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191229606 X:58083704-58083726 CTCTCCCCTCAGAATGCCTGAGG + Intergenic
1191229702 X:58084340-58084362 CTCTCCCTTCAGAATGCCTGAGG + Intergenic
1191230276 X:58088193-58088215 CTCTCCCATTAGAATTCCTGGGG - Intergenic
1191230346 X:58088709-58088731 CTCTCCCATTAGAATGCCTGTGG - Intergenic
1191230729 X:58091504-58091526 CTCTTCCATTAGAAGGCCTGTGG - Intergenic
1191231317 X:58098313-58098335 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191231667 X:58100905-58100927 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191232588 X:58107705-58107727 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191233452 X:58115647-58115669 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191234523 X:58123431-58123453 CTCTCCCATTAGAAGGCCTGGGG - Intergenic
1191234938 X:58126740-58126762 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191235317 X:58129317-58129339 CTCTCCAGTTAGAAGGCATGGGG - Intergenic
1191235435 X:58130188-58130210 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191235487 X:58130573-58130595 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191235494 X:58130608-58130630 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191235545 X:58130995-58131017 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191235781 X:58132667-58132689 TTCTCCTATCAGAATGCATGCGG - Intergenic
1191236320 X:58137306-58137328 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191237323 X:58144604-58144626 CTCTTCCATTAGAATCCCTGGGG - Intergenic
1191240531 X:58186741-58186763 CTCTCCCATTAGAATGCCTGTGG - Intergenic
1191242013 X:58197207-58197229 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191242031 X:58197348-58197370 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191242254 X:58198735-58198757 CTCTCCCATTAGAATTCCTGAGG - Intergenic
1191242325 X:58199188-58199210 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191243978 X:58211456-58211478 CTCTCCCATAAGAAACCCAGGGG - Intergenic
1191244184 X:58212952-58212974 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191244457 X:58214930-58214952 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191245504 X:58225236-58225258 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191245889 X:58228060-58228082 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191246119 X:58229647-58229669 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191246287 X:58230877-58230899 CTCTCCCATCAGAATGTCTGGGG - Intergenic
1191247244 X:58237637-58237659 CTCTCCCATTAGAACGCCTGCGG - Intergenic
1191247313 X:58238138-58238160 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191247364 X:58238487-58238509 CTCTCCCATTAGAACGCATGGGG - Intergenic
1191248052 X:58243586-58243608 CTCTCCCATTAAAATACATGGGG - Intergenic
1191248565 X:58247326-58247348 CTCTCCCATTAGAATGCCTGAGG - Intergenic
1191248765 X:58248717-58248739 CTCTCCCATTAGAATGCTTGGGG - Intergenic
1191249160 X:58251725-58251747 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1191249305 X:58252642-58252664 CTCTCCCATTAGAATGCCTGGGG - Intergenic
1193139996 X:78017353-78017375 CCCTCCCATCAAAGGCCCTGAGG - Intronic
1193161441 X:78233283-78233305 CCCACCCAAGAGAAGCCATGAGG - Intergenic
1193316564 X:80071981-80072003 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1193857882 X:86626865-86626887 CCCTCCCATCACAAGCCAGGAGG - Intronic
1193865787 X:86728575-86728597 CCCTCCCATCACAAGCCTAGAGG + Intronic
1194014239 X:88599397-88599419 CCCTCCCATCACAAGCCTGGAGG - Intergenic
1194064139 X:89241376-89241398 CTCTCCCATCACAAGCCCCAGGG + Intergenic
1194192737 X:90857631-90857653 CTCTCCCATCATAGGCCAGGAGG + Intergenic
1194313279 X:92340720-92340742 CTCTCCCATCACAGGCCCTGAGG - Intronic
1194321078 X:92447312-92447334 CCCTCCCATCACAAGCCCAGAGG + Intronic
1194339464 X:92691595-92691617 CTCTCCCATCAAAGGCCCAGAGG + Intergenic
1194377340 X:93152082-93152104 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1194397588 X:93404329-93404351 CTCTCCCATCACAGGCCCAGAGG - Intergenic
1194418995 X:93649520-93649542 CCCTCCCATCAGAGACCAGGAGG + Intergenic
1194525217 X:94969453-94969475 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1194584778 X:95718910-95718932 TTCTTGCATCAGAAGCCCTGGGG - Intergenic
1194843567 X:98775861-98775883 TCCTCCCATCACAAGCCAGGAGG + Intergenic
1194864482 X:99048844-99048866 CCCTCCCATCACAAGCCCAGAGG - Intergenic
1195036911 X:100978651-100978673 CTCTCCAATCAAAAGACATAGGG - Intronic
1195392202 X:104374208-104374230 TTCTCCCATCAGAAATTATGTGG - Intergenic
1195510874 X:105713681-105713703 CTCTCCCATCACAAGCTCAGGGG - Intronic
1196168958 X:112565938-112565960 CCCTCCCATCAGAGGCCCTGAGG - Intergenic
1197109605 X:122756719-122756741 CTCTCCCATCACAGTCCAGGAGG - Intergenic
1197438019 X:126456313-126456335 CACTACCACCAGAGGCCATGAGG - Intergenic
1197544839 X:127812173-127812195 CCCTCCCATCACAAGCCTGGAGG + Intergenic
1198537950 X:137604817-137604839 CTCTCCAATCAAAAGACATAGGG + Intergenic
1198569730 X:137942173-137942195 CTCTCCCATCATAGGCCTGGAGG + Intergenic
1198629307 X:138617010-138617032 CTCTCCCATTATAGGCCAGGAGG - Intergenic
1198943806 X:141987370-141987392 CCCTCCCATCACAAGCCCAGAGG + Intergenic
1198947093 X:142027265-142027287 CACTCCCATCAGAGGCCTAGAGG - Intergenic
1198966836 X:142236765-142236787 CCCTCCCATCAGAGGCCTGGAGG + Intergenic
1199091760 X:143701596-143701618 CCCTCCCATCACAGGCCCTGAGG + Intergenic
1199249692 X:145646340-145646362 CACTACCACCAGAAGCCAAGAGG - Intergenic
1199515305 X:148668758-148668780 CCCTCCCATCACAGGCCAGGAGG - Intronic
1199999271 X:153049252-153049274 CTCTCCCATCACAGGCCCAGAGG + Intergenic
1200251404 X:154556153-154556175 CTCTGCCACCAGATGCCATCCGG + Exonic
1200266363 X:154648263-154648285 CTCTGCCACCAGATGCCATCCGG - Intergenic
1200345306 X:155441321-155441343 CTCTCCCATCACAGGCCCAGTGG - Intergenic
1200539365 Y:4440080-4440102 CTCTCCCATCATAGGCCAGGAGG + Intergenic
1200591383 Y:5079711-5079733 CTCTCCCATCACAAGCTGGGAGG - Intronic
1200621543 Y:5454834-5454856 CTCTCCCATCACAGGCCCTGAGG - Intronic
1200629196 Y:5560459-5560481 CCCTCCCATCACAAGCCCAGAGG + Intronic
1200647849 Y:5808376-5808398 CTCTCCCATCAAAGGCCCAGAGG + Intergenic
1200718313 Y:6575475-6575497 CTCTCCCATCACAAGCCCCAGGG + Intergenic
1201469433 Y:14317631-14317653 CCCTTCCATCACAAGCCAAGAGG + Intergenic
1202099775 Y:21294956-21294978 CCCTCCCATCACAGGCCCTGAGG - Intergenic