ID: 1023164594

View in Genome Browser
Species Human (GRCh38)
Location 7:37331007-37331029
Sequence TTATCCTGCTTTGTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023164594 Original CRISPR TTATCCTGCTTTGTCCCTCC AGG (reversed) Intronic
903308450 1:22432050-22432072 TTATGCTGCTTTGTGACTCTGGG + Intergenic
903874021 1:26459950-26459972 TTAGCCTGCTTTTTCCCTGGAGG + Intronic
906478063 1:46183244-46183266 CTATCCTGCTTTGCCCAGCCTGG - Intronic
906698745 1:47842413-47842435 TTATTCTGCCTGGTCCCTGCTGG + Intronic
907982682 1:59499404-59499426 TTATCTAGCTTGGTCCCACCTGG - Intronic
908980258 1:69948077-69948099 CTGTCCTGCTCTGTCTCTCCTGG - Intronic
909030311 1:70531462-70531484 TTTTCCTGCTTTTTCACTGCAGG - Intergenic
910301741 1:85713918-85713940 GTGTCCCTCTTTGTCCCTCCAGG + Intergenic
912512819 1:110200132-110200154 TGATTCTGGTCTGTCCCTCCAGG - Exonic
912578179 1:110694533-110694555 TTACTCTGCTTTGTCCCTGTAGG - Intergenic
913608841 1:120491476-120491498 TTGGCCTGCTTTGGCCTTCCAGG - Intergenic
913986593 1:143571188-143571210 TTGGCCTGCTTTGGCCTTCCAGG + Intergenic
914204989 1:145518975-145518997 TTGGCCTGCTTTGGCCTTCCAGG + Intergenic
914582354 1:149030362-149030384 TTGGCCTGCTTTGGCCTTCCAGG + Intronic
915748941 1:158186662-158186684 TCCTCCTGCTGTGTCCCTCCGGG - Intergenic
916259245 1:162824132-162824154 TTTTCCTACTTTCTCCTTCCTGG + Intergenic
916477121 1:165180329-165180351 TTCTCCTGCTTTGCCTGTCCTGG - Intergenic
918178027 1:182062011-182062033 GTAGCATGCTTTTTCCCTCCTGG + Intergenic
924183806 1:241465909-241465931 CTTTTCTGCTTTGTCCCCCCAGG - Intergenic
1066375460 10:34854237-34854259 TCATCCTACTGTGTTCCTCCAGG + Intergenic
1066577693 10:36844342-36844364 TTCTCCTGCTTTGGCCTCCCTGG - Intergenic
1067717031 10:48697770-48697792 TTTTCCTGCTTAGTACTTCCAGG + Intronic
1069270549 10:66521660-66521682 TTATCATTCTTTGGCCCTCCAGG + Intronic
1070723969 10:78775382-78775404 TCATCCAGCTTTCTCCCGCCAGG - Intergenic
1070850399 10:79558362-79558384 CTTTCCTGCTCTGTCCCTCGAGG + Intronic
1070856819 10:79612934-79612956 CTTTCCTGCTCTGTCCCTCGAGG - Intronic
1073604947 10:104884851-104884873 TTTTCCTCCTATGTCCCTCCAGG + Intronic
1074851857 10:117445441-117445463 TGATCCTGCTGTTTCCCTCCGGG + Intergenic
1079180192 11:18186137-18186159 TGGTCCTGCTCTGTCCTTCCTGG - Intronic
1080460671 11:32451999-32452021 TCATTCTTCTTTCTCCCTCCAGG + Intergenic
1080652908 11:34236704-34236726 TTATCCTCCTGTCTCCCTCCTGG - Intronic
1081277519 11:41168115-41168137 GTTACCTGCTTTGTCCCTGCAGG - Intronic
1081885322 11:46490638-46490660 TGTGTCTGCTTTGTCCCTCCAGG + Intronic
1083027348 11:59561902-59561924 TTATCAACCTTTGTCCTTCCTGG + Intergenic
1083200860 11:61120184-61120206 TGATCCTGGTTTGGCCCACCGGG - Intronic
1085661729 11:78373883-78373905 TTATCCTTCTTTGCTGCTCCAGG + Intronic
1087237593 11:95737422-95737444 TTAGCCAGCTTTTTCTCTCCAGG + Intergenic
1087921408 11:103870955-103870977 CTGTCCTGCTCTGTCCCACCCGG - Intergenic
1088583586 11:111337784-111337806 TTATCCTGCTCTCTGCCTCTAGG + Intergenic
1089695864 11:120216003-120216025 TTATCTTGCTTATTCCCTCCAGG - Intronic
1091211004 11:133860364-133860386 AAATCCTGCTCTGTCCCTCCTGG - Intergenic
1091359384 11:134963103-134963125 CTGTCCTGCTCTGTCCCTCATGG + Intergenic
1091445010 12:540000-540022 TCACCCTGCTGTGTTCCTCCGGG + Intronic
1092628612 12:10354812-10354834 TTTTTCTGCTTTTTCCCTGCTGG - Intergenic
1092660500 12:10733349-10733371 TTATCATGCTTTTTCCTGCCAGG + Intergenic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1093194533 12:16114287-16114309 TTATCCACCTTTTTGCCTCCAGG - Intergenic
1093339443 12:17953866-17953888 TTATCCTATTTTCTCTCTCCTGG + Intergenic
1093866511 12:24233817-24233839 TTATCCAGCTTGTTCTCTCCTGG - Intergenic
1099634999 12:85202545-85202567 TTATCCTTCTTGGTCTTTCCTGG + Intronic
1099926130 12:89020146-89020168 TTGTGCTTCTTTGTCCCACCAGG - Intergenic
1100254349 12:92867265-92867287 GTATACTGCTTTTTCCCTCCAGG + Intronic
1100447174 12:94671638-94671660 TTATACTTCTTTTTCCTTCCTGG - Intergenic
1101184278 12:102257378-102257400 CCATCCTGCTGTGTCCCACCAGG + Intergenic
1104013704 12:124949100-124949122 ATGTCCTGCTCTGTCCCTCTGGG + Intronic
1104114472 12:125736100-125736122 TCATCCTGCTCTGTCCTGCCTGG + Intergenic
1104618755 12:130293485-130293507 TTTTCCTTCTTTTTCCCGCCTGG + Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1107299749 13:38952982-38953004 CTGTCCTGCTCTGTCCCACCTGG + Intergenic
1107583642 13:41819806-41819828 TTATCCTGAATTGTGCCTCTTGG - Intronic
1110610786 13:77485655-77485677 CTATCTTGCTCTGTTCCTCCTGG + Intergenic
1111959224 13:94791539-94791561 TTCTCCTTCTTTGCCCCACCAGG + Intergenic
1113280161 13:108779783-108779805 TCTTCCTGCTGTGTCCCTCCAGG + Intronic
1115368409 14:32584333-32584355 CCATCCTGCTGTGTCCCACCTGG - Intronic
1117888302 14:60388965-60388987 CCATCCTGCTCTGTCCCACCTGG + Intergenic
1119905610 14:78299027-78299049 TTACCCTGCTTTGTCAGTTCAGG - Intronic
1120918924 14:89736989-89737011 TTTTCCTGCTTTTTCACTGCAGG + Intergenic
1121451019 14:94008384-94008406 TCATCCAGCTCTGTCACTCCTGG + Intergenic
1121740640 14:96249829-96249851 CCGTCCTGCTTTGTCCCACCTGG + Intronic
1122150953 14:99725989-99726011 TTCTCCTCCTTTTACCCTCCTGG - Intronic
1122152609 14:99732981-99733003 TGACCCTCCTCTGTCCCTCCAGG + Intergenic
1122313154 14:100810072-100810094 TTATCCTGCCTTATCCCACATGG - Intergenic
1127832629 15:62764252-62764274 TTTTCCTGCTTTTTCCCTTTGGG + Intronic
1127899257 15:63329177-63329199 TATTTTTGCTTTGTCCCTCCTGG + Intronic
1131773525 15:95767658-95767680 TTCTCCTGCTTTAGCCTTCCTGG + Intergenic
1135634409 16:24061834-24061856 TTAGATTGCTTTGTCGCTCCAGG - Intronic
1136253727 16:29024492-29024514 TTCTCCCGCTTGGCCCCTCCTGG - Intergenic
1137520541 16:49191466-49191488 TTTTCTTCCTTTGTTCCTCCAGG - Intergenic
1140908156 16:79427847-79427869 TTATACAGCTCTGTGCCTCCAGG + Intergenic
1140919022 16:79519875-79519897 CCATCCTGCCTTGGCCCTCCTGG + Intergenic
1141334354 16:83140824-83140846 TTACCCTTGTTTCTCCCTCCTGG + Intronic
1141735875 16:85852761-85852783 TTGTCCTGCTTTGTCCTTGCTGG - Intergenic
1143695089 17:8608726-8608748 CTATGCTGCTTTATGCCTCCAGG + Intronic
1144959549 17:19037415-19037437 TTATCTTGCTGTGTGGCTCCTGG + Intronic
1144975610 17:19137109-19137131 TTATCTTGCTGTGTGGCTCCTGG - Intronic
1147862115 17:43529825-43529847 TTATCACGCTGTGTCCCTGCAGG - Intronic
1148625695 17:49067410-49067432 TTATCCTGCATTCTCCCTTCGGG - Intergenic
1149710909 17:58741227-58741249 CTATCCTGCTCTGTCCTGCCTGG - Intergenic
1150197072 17:63310419-63310441 GAATCCTGCTTTGTCGCCCCTGG - Intronic
1151981265 17:77510644-77510666 TTTGCCTGCTTTGTTCCTCCAGG - Intergenic
1153372922 18:4340322-4340344 CTGTCCTGCTTTGTCCTTCTGGG - Intronic
1153385268 18:4486485-4486507 TCTTCCTGCTTTCTCCCTCTGGG + Intergenic
1153592760 18:6691535-6691557 AAATCCTACTTTGTCCCACCAGG + Intergenic
1153808738 18:8733511-8733533 TTCTCCTGCCTTGGCCTTCCCGG + Intronic
1155271101 18:24141970-24141992 TCAGCCTGCTTTGTACCTGCAGG - Intronic
1155938709 18:31781478-31781500 TTTTCCTCCCTTCTCCCTCCTGG - Intergenic
1156389978 18:36641187-36641209 TTTTCCTGCTCTGTTTCTCCAGG - Intronic
1159299957 18:66550524-66550546 TTATCCTGCTTTATCCAACTGGG + Intronic
1159957052 18:74526113-74526135 ATGTTCTTCTTTGTCCCTCCAGG + Intergenic
1161896919 19:7089451-7089473 TTCTCTTCCTTTGTCCCTTCAGG - Intergenic
1166311746 19:41966965-41966987 CTTTCCTTCTTTGTCTCTCCAGG - Exonic
1167032503 19:46972385-46972407 TTGTCCTGCTGTGTCCCATCAGG - Intronic
1167140023 19:47643962-47643984 ATATCATGCTCTGTGCCTCCTGG - Intronic
1168488867 19:56790445-56790467 CTTTCCTGCTCTGTCCCACCTGG + Intronic
925842568 2:8006485-8006507 AAAGCCTGGTTTGTCCCTCCTGG - Intergenic
927105249 2:19818506-19818528 CTTTCCTTCTTTGACCCTCCTGG - Intergenic
927234445 2:20857608-20857630 TTGTCCTACTTTGTCCCAGCTGG - Intergenic
928618387 2:33062864-33062886 CTGTCCTGCTGTGTCCCACCTGG - Intronic
929360675 2:41085786-41085808 TTATTATTCTTTGACCCTCCAGG - Intergenic
929952973 2:46430427-46430449 TTATCATACATTGTCACTCCAGG - Intronic
930871716 2:56177735-56177757 TTATCCTATTTTGTTCCCCCAGG - Intergenic
932215721 2:69964713-69964735 TTGTCCTGCTTTGCTCCTGCAGG - Intergenic
936842149 2:116783925-116783947 TTTTTCTTCTTTGTTCCTCCAGG + Intergenic
937065886 2:119017335-119017357 TACTGCTGCTCTGTCCCTCCTGG + Intergenic
937631035 2:124101437-124101459 CTTTCCAGCTTTGTTCCTCCAGG - Intronic
939016522 2:136910151-136910173 TCACCTTGCTTTCTCCCTCCTGG - Intronic
940610369 2:155982330-155982352 TTGTCCTGCCTTGTCAATCCTGG + Intergenic
940650385 2:156435747-156435769 TTCTCCTACTCTGTACCTCCCGG - Exonic
941829652 2:169940915-169940937 CCATCCTGCTCTGTCCCACCTGG + Intronic
944432407 2:199647311-199647333 TTATTCTCCTGTGTCCCTTCAGG + Intergenic
945485526 2:210390973-210390995 ATATCCTGATTTGTGCCTCTTGG + Intergenic
945825260 2:214713775-214713797 TTATTCACCTTTGTTCCTCCAGG + Intergenic
948367281 2:237465196-237465218 TTCTCCTGCTTTATCCCTCCAGG + Intergenic
948602728 2:239116508-239116530 CTTTCCTGCTTTGCCCCACCTGG + Intronic
948984257 2:241510376-241510398 TTTTCCTGCATTGACCTTCCAGG + Intergenic
1168824782 20:802731-802753 TTAGCTGGCTTTTTCCCTCCTGG + Intergenic
1169187163 20:3628517-3628539 CCATCCTGCTTCGTCCCACCTGG + Intronic
1170571903 20:17637325-17637347 CCATCCTGCTCTGTCCCTGCTGG - Intronic
1170758240 20:19223922-19223944 TTGTCATGCTCTGTCCCGCCTGG - Intronic
1171381710 20:24738459-24738481 TCATCCTGCGTTGACCCTGCAGG - Intergenic
1172032941 20:31994468-31994490 TCATCCTGCTTTGGCCTCCCAGG - Intronic
1172299421 20:33838750-33838772 GTATCCTGGTTTCCCCCTCCTGG + Intronic
1174719300 20:52794380-52794402 CTGTCCTGCTCTCTCCCTCCTGG - Intergenic
1175166892 20:57050390-57050412 CCATCCTGCTCTGTCCCACCGGG + Intergenic
1175609262 20:60336660-60336682 CTGTCCTGCTCTGTCCCACCTGG - Intergenic
1175635788 20:60581861-60581883 TTTTCATGCTCTGTCCCTCTTGG - Intergenic
1178275286 21:31231220-31231242 TTAACATGCTTTCTCCTTCCTGG - Intronic
1178576062 21:33792804-33792826 TTTTCCTGCTGTGTCCTGCCTGG + Intronic
1182054791 22:27343184-27343206 TTATTCTGTTTTATCCCTTCTGG + Intergenic
1182676556 22:32043628-32043650 GTATCCTCCTTGGTCCTTCCTGG - Intronic
1182987378 22:34733090-34733112 TTATCCCTCTGTGTCCCTTCTGG - Intergenic
1183468363 22:37991846-37991868 TCCTCCTGCATTGTCCCTGCTGG + Intronic
1183700242 22:39446980-39447002 TCATCCTGCATTGTCACGCCAGG - Intergenic
1184765188 22:46568539-46568561 TTCTCCTGCTGTGACTCTCCAGG - Intergenic
951643516 3:24862541-24862563 CTCTCCTGCTTTGTCCCACCTGG + Intergenic
955250355 3:57275553-57275575 CCATCCTGCCTTGTCCCACCTGG + Intronic
962124101 3:132596563-132596585 TTATGCTGATTTGGCCCTCATGG - Intronic
962248196 3:133815568-133815590 TTTTCTTGTTTTCTCCCTCCAGG + Exonic
962356645 3:134699853-134699875 TTTTCCTTCTTTGTCCTCCCTGG + Intronic
964599507 3:158481286-158481308 TGATCCTGCTCTGTGCATCCAGG + Intronic
965402878 3:168234673-168234695 TCTTCCTGCTTCATCCCTCCTGG + Intergenic
966103497 3:176305911-176305933 TTATCCTGCTTTATTCATTCAGG - Intergenic
966627820 3:182037506-182037528 GTATCCTACATTGTTCCTCCTGG - Intergenic
967314516 3:188138675-188138697 TTATCCTGCTTTCTTCCTAAGGG + Intergenic
969302262 4:6304050-6304072 TCATCCTGGTTTGTCCTGCCTGG + Intergenic
970889479 4:21026626-21026648 GTATCTTGCTCTGTCCCCCCAGG - Intronic
972474522 4:39437758-39437780 TTATACTGCCTGGTCTCTCCTGG + Exonic
972765971 4:42152376-42152398 TTTACCTCCTTTCTCCCTCCAGG - Exonic
973720875 4:53722157-53722179 CTACACTGCTTTGTCTCTCCTGG - Intronic
974445771 4:61979474-61979496 CTATCATGCTTTGTGCATCCAGG + Intronic
974825645 4:67126227-67126249 CTATCCTGCTTTGTCCTACCTGG - Intergenic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
976433938 4:84995447-84995469 GTATCCTGCTATCTCCCTCCTGG + Intergenic
976511829 4:85919762-85919784 ATATCCTGCTGTGTCACTCCAGG - Intronic
979632273 4:122916970-122916992 CCATCCTGCTCTGTCCCACCAGG - Intronic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
981960613 4:150533694-150533716 TCATCCTGCAGCGTCCCTCCAGG - Intronic
984597040 4:181681760-181681782 TTATCTTGTTTTATCCCTACTGG - Intergenic
985751642 5:1682062-1682084 TTCCCCTGCCGTGTCCCTCCTGG + Intergenic
985933059 5:3074126-3074148 TTTTCCTGGTGTGTCCGTCCTGG + Intergenic
986003988 5:3652307-3652329 TTAACTTGTTTTGTCACTCCAGG - Intergenic
989571108 5:42947024-42947046 TTACCTTGCTTTGTTCCCCCTGG + Intergenic
989577581 5:43002789-43002811 TTATCTTGCTTTGTTCACCCTGG + Intergenic
993377068 5:87160969-87160991 CTATCCTGCCTTTTTCCTCCCGG - Intergenic
993737011 5:91489531-91489553 ATATCCTGTTTTTTCCTTCCAGG + Intergenic
993914390 5:93725019-93725041 CTATCCTACTCTGTCCCTCATGG - Intronic
998346134 5:141465595-141465617 TTATCACTCTTTGGCCCTCCAGG + Intronic
998596490 5:143535895-143535917 TTCTCCTGCCTTGGCCTTCCAGG - Intergenic
1001162700 5:169335610-169335632 TTACACCTCTTTGTCCCTCCTGG - Intergenic
1001276406 5:170354693-170354715 TTAGCCTTCTTTCTGCCTCCCGG - Intronic
1002450649 5:179316536-179316558 CCTTCCTGCTGTGTCCCTCCAGG + Intronic
1006751759 6:36382670-36382692 TTCTCCTGCTTTACACCTCCAGG + Intronic
1007069177 6:39022588-39022610 ATACCTTGCTTTGTCCCACCTGG + Intronic
1009676496 6:66830216-66830238 TTATCCTGCTGTGATTCTCCAGG - Intergenic
1009948336 6:70365706-70365728 TTATTCGGCTTTATCCCTACAGG + Intergenic
1010072114 6:71755581-71755603 TTATCCTGCTTCTTCCTTCTTGG + Intergenic
1011582934 6:88891027-88891049 TTCTCCTGTTTTGTCACTTCTGG - Intronic
1014541535 6:122682027-122682049 TTATACTGCTGTGGCCCTCTGGG + Intronic
1015874165 6:137805913-137805935 TTATCATGATATGGCCCTCCAGG + Intergenic
1016058360 6:139602628-139602650 TTATCCTGCCCTGTTCCTGCAGG + Intergenic
1016148991 6:140715025-140715047 TTATCATTCTTTGTCCATACAGG + Intergenic
1016847637 6:148584520-148584542 GAATCCTTCTTTGTACCTCCTGG + Intergenic
1017626245 6:156351999-156352021 TCTTCCTGCTTTCTCTCTCCTGG + Intergenic
1021300031 7:18961221-18961243 TTATCATGCTTCTTCCCTGCTGG - Intronic
1021585686 7:22205104-22205126 TTGACCTTCTTTGGCCCTCCAGG - Intronic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1024175130 7:46832277-46832299 TTTTCCTGTTTTATCCCACCTGG + Intergenic
1025991888 7:66503365-66503387 TTTTCCTCTTTTGTCTCTCCTGG - Intergenic
1032150686 7:129427017-129427039 TCATCTTTCTTTTTCCCTCCAGG + Exonic
1033950332 7:146777401-146777423 TTATGCTGCTCTGCCCCTGCAGG + Intronic
1033975815 7:147099223-147099245 TTATCCAGCTTTCTCTCTTCTGG - Intronic
1035930490 8:3774999-3775021 GTATCCTGCTTGGTCCTGCCGGG - Intronic
1035964022 8:4170103-4170125 CTAACCTGTTTTCTCCCTCCAGG + Intronic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1036453122 8:8885936-8885958 TTGACCTGCTTTCTCCATCCTGG - Intronic
1036641946 8:10590317-10590339 TTCTCCAGCTCTGTCCCTGCAGG - Intergenic
1037191678 8:16133557-16133579 TTACCATTCTTTGGCCCTCCAGG + Intronic
1037553453 8:19997904-19997926 TTATCATCCTCTGTTCCTCCTGG - Intergenic
1037561514 8:20079117-20079139 TCATCCTGCTCTGTTCCACCTGG + Intergenic
1038859919 8:31375809-31375831 TTGCCCTGCTTTGTCTGTCCAGG + Intergenic
1039047828 8:33466319-33466341 TTCTCCTGCTTTAGCCTTCCAGG - Intronic
1041030154 8:53728599-53728621 ATCCCCTGCTTTGTCCCTTCTGG + Intronic
1041135137 8:54749944-54749966 TTCTCCTGCTTCCTCTCTCCTGG - Intergenic
1045549553 8:103158719-103158741 CTGTCCTGCTTTGTCTCGCCTGG - Intronic
1045667807 8:104509433-104509455 CTGTGCTGCTCTGTCCCTCCCGG + Intronic
1046849215 8:118953184-118953206 TCATTCAGCTTTGTCCCTCAAGG + Intergenic
1047026627 8:120831533-120831555 TTATCCTACCTTGTCTCTCTAGG + Intergenic
1050392163 9:5155488-5155510 TTATTCTGCTAGGTACCTCCAGG - Intronic
1050821911 9:9889715-9889737 CTATCCTGCTGTGACCCTCCAGG - Intronic
1051396879 9:16632287-16632309 TGCTCCTCCTCTGTCCCTCCAGG + Intronic
1051944020 9:22543990-22544012 TTTTCCTCCTTTTTCCTTCCTGG + Intergenic
1052038601 9:23711793-23711815 TCATCCTACTTTGTACATCCTGG + Intronic
1052458684 9:28734310-28734332 CCATCCTACTTTGTCCCGCCTGG - Intergenic
1053474718 9:38374131-38374153 CTGTCCTGCTCTGTCCCACCTGG + Intergenic
1053501783 9:38602776-38602798 TTCTCCTGCTTTGGCCTCCCAGG + Intergenic
1055513931 9:77019049-77019071 TTACCCTGATTTTTCACTCCAGG + Intergenic
1055546049 9:77374488-77374510 CCACCCTGCTTTGTCCTTCCTGG - Intronic
1057125559 9:92613518-92613540 TTATCCTGGTTCCTGCCTCCTGG + Exonic
1057802270 9:98197769-98197791 TTTACCTGCTTTAGCCCTCCTGG + Intergenic
1058312341 9:103519442-103519464 TTATCCTGCTCTGTCCTGCCCGG + Intergenic
1058574258 9:106383095-106383117 TTATCCTGGTTTATCTCTTCTGG + Intergenic
1058766105 9:108184260-108184282 CCATCCTGCTCTGTCCCACCTGG - Intergenic
1059790809 9:117640133-117640155 GTTTCCTGCTTTCTCACTCCTGG + Intergenic
1060016066 9:120087558-120087580 TAAGCTTGCTCTGTCCCTCCTGG + Intergenic
1187457801 X:19458179-19458201 ATACCCTGCCTTCTCCCTCCTGG - Intronic
1188356572 X:29198914-29198936 TTATCCTGTTTTATCACTGCAGG + Intronic
1195323869 X:103742579-103742601 TTAACCTGTTTTGCCACTCCAGG + Intergenic
1198102932 X:133437514-133437536 TGTTCCTGCTTTGGCCCTCAGGG + Intergenic
1198136896 X:133762053-133762075 TTATCCTACTTTGTCCCCAGAGG - Intronic
1199533129 X:148871797-148871819 ATATAATGCTTTGTCTCTCCTGG + Intronic