ID: 1023165572

View in Genome Browser
Species Human (GRCh38)
Location 7:37340271-37340293
Sequence GACATACACACTGAGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023165572 Original CRISPR GACATACACACTGAGTGTTC AGG Intronic
901310158 1:8263212-8263234 CACATACTCCCTGCGTGTTCAGG - Intergenic
905652203 1:39663990-39664012 GACATACACACTGCGTAATCAGG - Intronic
909288532 1:73852877-73852899 GCCATACACAATGAGTTTTAGGG - Intergenic
910499006 1:87867189-87867211 GACATACACACAGAGTGAAGTGG + Intergenic
916181604 1:162088742-162088764 GACCTACAGACTGAGTAATCTGG - Intronic
916247150 1:162699844-162699866 GACATAAACACTGAGATTTTTGG + Intronic
919564164 1:199162671-199162693 CACACACACACAGAGTGTGCAGG - Intergenic
922654675 1:227371289-227371311 CACATACACACTGTTTGTTCAGG + Intergenic
1062842510 10:681901-681923 GAGATACACGGTGAGTGTTGGGG - Intronic
1064778606 10:18808042-18808064 TAGACACACACTGAGTATTCTGG + Intergenic
1067816432 10:49481067-49481089 GAAATACACACTGAGGGATTTGG + Intronic
1068464025 10:57364396-57364418 AAAATACAAATTGAGTGTTCAGG - Intergenic
1069365404 10:67690166-67690188 GACCTTCACAGTGAGTGTTACGG + Intronic
1069794520 10:71043550-71043572 GACATAGACACTCTGGGTTCTGG + Intergenic
1073558653 10:104478758-104478780 GACATGGCCACTGAGTGTTCTGG + Intergenic
1077649899 11:3961396-3961418 GACATTAATATTGAGTGTTCAGG + Intronic
1078490980 11:11768405-11768427 GACATAGACACAAAGTGTCCTGG - Intergenic
1079050113 11:17147502-17147524 GAGGTACACACTTACTGTTCGGG + Exonic
1080023636 11:27591042-27591064 GACATAGACATTGAGAGTTCAGG + Intergenic
1081750503 11:45507706-45507728 GAGCTACAAAGTGAGTGTTCTGG + Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084704744 11:70809680-70809702 GGCAGACAGACTGAGTATTCAGG - Intronic
1088319148 11:108536901-108536923 GACTGTCACACTCAGTGTTCTGG - Intronic
1088553210 11:111035941-111035963 GTTCTACACACTGAGGGTTCTGG - Intergenic
1089062289 11:115635301-115635323 CACACACACACACAGTGTTCAGG - Intergenic
1090229399 11:125090647-125090669 GACCTTCACAGTGAGTGTTACGG - Intergenic
1090758309 11:129814461-129814483 GACCTTCACAGTGAGTGTTATGG + Intergenic
1092147787 12:6226752-6226774 CACATACACACAGAGTTTTTGGG + Intronic
1098283263 12:68883086-68883108 CACATACACACTGAGTGGCAGGG - Intronic
1098698410 12:73590147-73590169 GCCATTCCCACTGAGTCTTCAGG + Intergenic
1100025602 12:90123919-90123941 GACACACACACAGAGTGTTATGG + Intergenic
1101060239 12:100963468-100963490 GACACACACACACAGTGTCCTGG - Intronic
1101267292 12:103102393-103102415 TAGATTAACACTGAGTGTTCTGG - Intergenic
1105988429 13:25592764-25592786 TACATACACATTGAGACTTCTGG + Intronic
1108152039 13:47546183-47546205 GAGAGAAACACTGTGTGTTCCGG - Intergenic
1109100669 13:58180653-58180675 GCCATACTCACTGAGTGTCTGGG - Intergenic
1109908936 13:68885270-68885292 GACATACAGACAGAGTCTTCTGG + Intergenic
1109985696 13:69981561-69981583 GAAATACACACTAAGTTTACTGG - Intronic
1111669963 13:91318529-91318551 GCCAAAGACACTGAGTGTTTAGG - Intergenic
1112176570 13:97031405-97031427 GACAAACACACTGTCTGTACTGG - Intergenic
1112675693 13:101699239-101699261 GACACAAATACTGAGTCTTCAGG + Intronic
1112900862 13:104354972-104354994 GCCATACACACTGATTTTTGGGG - Intergenic
1114790528 14:25653016-25653038 GAAGTATACACTGAGTATTCAGG + Intergenic
1126294881 15:47129092-47129114 GACAGACACTCTGTGTGTTTGGG - Intergenic
1126367016 15:47904580-47904602 GACTTACACACTGACTGATATGG - Intergenic
1128685675 15:69683422-69683444 GACATAAAGTCTGAGTGGTCTGG - Intergenic
1133396062 16:5448518-5448540 GCCAGACACACTGTGTTTTCTGG + Intergenic
1141199437 16:81885772-81885794 GCCATCCACACTGAGGGCTCAGG + Intronic
1141876147 16:86825931-86825953 GCCACACACACTGAGAGCTCAGG + Intergenic
1148411631 17:47472250-47472272 AACAAACAAACTGAGTGTTATGG - Intergenic
1148718445 17:49732675-49732697 GGCCTACACACTGACTTTTCTGG + Exonic
1149060740 17:52418614-52418636 GAGAGTGACACTGAGTGTTCAGG + Intergenic
1151141292 17:71994670-71994692 GACATACTTACTGAGTGATAGGG - Intergenic
1158509437 18:58077494-58077516 GACGTGCACACTCAGTGTTTAGG - Intronic
1163643614 19:18475915-18475937 GACACACACACGGCGAGTTCTGG + Intronic
1164902474 19:31939812-31939834 GCCATACACACTGACTGGTCTGG - Intergenic
1167856689 19:52247678-52247700 AACAAACAAACTTAGTGTTCAGG + Intergenic
925425933 2:3748636-3748658 GACACACAATCTGAGTGTTGTGG + Intronic
925787268 2:7444650-7444672 GACAGACAAACTGAGTGCTTGGG - Intergenic
925901558 2:8512792-8512814 CACAACCACACTGAGTGTTAGGG + Intergenic
933807925 2:86013481-86013503 TACATCCACACTGAGGGTTAGGG - Intergenic
936667805 2:114617712-114617734 CGCATACCCACTGAGTGTTTGGG - Intronic
936872830 2:117153871-117153893 ACCATAGACACTGTGTGTTCTGG + Intergenic
941864590 2:170321682-170321704 CAGAAACACACTGAGTATTCAGG - Intronic
942597652 2:177607624-177607646 GACATACTCCCAGAGTGTTTGGG + Intergenic
942992892 2:182223014-182223036 TACAGACACACTGAGAGTTAGGG - Intronic
945563568 2:211368290-211368312 GCAACACAGACTGAGTGTTCTGG - Intergenic
947361130 2:229346398-229346420 GCCTTACACAGTGAGTGCTCAGG + Intergenic
948056394 2:235012057-235012079 TGCATCCACACTGAGTGTGCGGG - Intronic
949077428 2:242069735-242069757 CACATACACAGTCAGTGTCCTGG + Intergenic
1173130969 20:40393127-40393149 GACATAAATACTGAGTGTTTTGG - Intergenic
1173292595 20:41727649-41727671 GACCTTCACAGTGAGTGTCCTGG + Intergenic
1175622929 20:60465999-60466021 GAGAAGCACACTGAGTGATCCGG + Intergenic
1180783234 22:18533449-18533471 GACAAACACAATGTGTGTTTTGG + Intergenic
1181126797 22:20707494-20707516 GACAAACACAATGTGTGTTTTGG + Intergenic
1181240133 22:21472801-21472823 GACAAACACAATGTGTGTTTTGG + Intergenic
1184069513 22:42139466-42139488 GACCTTCACAGTGAGTGTTACGG - Intergenic
950823034 3:15782602-15782624 TACACACATACTGAGTGTTCAGG + Intronic
952536114 3:34310631-34310653 GACACAGAGACTCAGTGTTCTGG - Intergenic
953130956 3:40137728-40137750 GATGTAAACACTGAGTGTACAGG - Intronic
955757341 3:62238794-62238816 GACAGACTGACTGACTGTTCAGG + Intronic
956525616 3:70156404-70156426 CACACACACAGTCAGTGTTCAGG + Intergenic
957036117 3:75294610-75294632 TACATCCACACTGATTGGTCAGG - Intergenic
957132526 3:76240803-76240825 GCCATAAACACTGAGGGTTTTGG + Intronic
958255965 3:91325178-91325200 GACCTACACACTTTGGGTTCAGG + Intergenic
962960461 3:140306661-140306683 GTCATTCACGCTGTGTGTTCTGG + Intronic
963167604 3:142221338-142221360 GATATCCACATTGAGTTTTCTGG - Intronic
964866155 3:161264171-161264193 GACCTTCACAGTGAGTGTTACGG + Intergenic
969408200 4:7009171-7009193 GACATAGACAGTAAGTGTTTGGG + Intronic
970790516 4:19853075-19853097 GACATACACAGTAACTATTCTGG + Intergenic
971976549 4:33696445-33696467 GACATAAACAAGGAGTGCTCTGG + Intergenic
972164584 4:36266761-36266783 GACCTTCACACTGAGTTTCCTGG - Intergenic
972641236 4:40926942-40926964 CACACACACAGTGAGTGTTCAGG + Intronic
973139673 4:46750939-46750961 TACAGACACACTGAGGGTTAGGG + Intronic
976616871 4:87086985-87087007 GACATACACTGTTAGTTTTCAGG + Intronic
976979626 4:91210906-91210928 GAAATACACACTAAGTATTCGGG + Intronic
977129839 4:93222263-93222285 GACGTATGCACTGTGTGTTCCGG + Intronic
978784407 4:112593543-112593565 GACATAGACATAGAGTCTTCAGG - Intronic
980997417 4:139793265-139793287 CACAGTCACACTGAGTGTTCAGG - Intronic
984150417 4:176123400-176123422 AACACACACACTGAGGGATCAGG + Intronic
985251238 4:188026605-188026627 GACAGGCACATTGAGAGTTCAGG + Intergenic
986425921 5:7631431-7631453 CACTTACTCACTGAGTGATCTGG - Intronic
986540272 5:8838222-8838244 GACATCCAGACTGAGAGGTCTGG + Intergenic
988179250 5:27767765-27767787 TACATTCACACTGAGGGTTAAGG + Intergenic
989495898 5:42111529-42111551 GACCTTCACAGTGAGTGTTACGG - Intergenic
989808931 5:45648718-45648740 GACATAGAAACTGAGAGTTAAGG - Intronic
990510982 5:56488734-56488756 GACCTACACAGTGAGTGTCAAGG - Intergenic
993143180 5:84060046-84060068 GACATACACATAGTGTGATCTGG + Intronic
993156264 5:84228354-84228376 GACATACAGACAGAGTCTTTGGG + Intronic
993877643 5:93326965-93326987 GACATACAAACACAGTGTTTAGG + Intergenic
998307684 5:141095735-141095757 GACATACACAGTAAATATTCAGG + Exonic
999207865 5:149863055-149863077 GACGCAGACACTGAGTGCTCAGG + Intronic
1000983461 5:167841583-167841605 GAAAGACACACTGAGTTGTCTGG - Intronic
1001388204 5:171357373-171357395 GTCTTACACAATGAGTGTTTTGG - Intergenic
1002282334 5:178138839-178138861 GACATACACACTGAAGGCTTGGG - Intronic
1003800181 6:9655485-9655507 GACAGACAAACTGAGATTTCTGG + Intronic
1005401863 6:25442857-25442879 GACATTCACACTCAGGGTTAAGG - Intronic
1005958144 6:30678989-30679011 GAAGTACACATTGAGTCTTCAGG - Intronic
1006734856 6:36266349-36266371 GGCAGACACACTGAGTGTATTGG - Intronic
1008999375 6:57695995-57696017 GACCTACACACTTTGGGTTCAGG - Intergenic
1009187863 6:60595400-60595422 GACCTACACACTTTGGGTTCAGG - Intergenic
1009509712 6:64534866-64534888 GACATACAGTATGACTGTTCAGG + Intronic
1010768617 6:79803939-79803961 GATATACCCTGTGAGTGTTCAGG - Intergenic
1019771097 7:2883991-2884013 GACTTCCACACTGACTGTGCTGG + Intergenic
1021053335 7:16017026-16017048 GACATGCATACTAAGTGTTTAGG + Intergenic
1022392615 7:29956623-29956645 GACACACACACTCACTGGTCAGG + Intronic
1023165572 7:37340271-37340293 GACATACACACTGAGTGTTCAGG + Intronic
1026353719 7:69539546-69539568 AACATACAGACTGAGTGGACTGG + Intergenic
1027620430 7:80478502-80478524 GACATGCACACTGAGGTTTTGGG - Intronic
1032169815 7:129575436-129575458 GAAATACACACTGAACGTTTAGG - Intergenic
1032454207 7:132059540-132059562 GACTTGCACCCTGAGTGTTGTGG + Intergenic
1035535983 8:391620-391642 CACATACACAGTCAGTGTCCTGG + Intergenic
1037394906 8:18431270-18431292 GACACACACACAGAGTCTTTTGG - Intergenic
1037538178 8:19846858-19846880 TACAGACACACTGAATGTGCAGG - Intronic
1038945806 8:32358457-32358479 GACATTCACACTGAGACTTAAGG + Intronic
1043397539 8:79853598-79853620 GACATAAACACAGAGGGTTATGG - Intergenic
1044933090 8:97268873-97268895 GAGATGCACACTGAGTATTTAGG + Intergenic
1048178850 8:132177183-132177205 CACATAAAAACTGACTGTTCTGG + Intronic
1048206250 8:132417591-132417613 GACATACACACTCTATGTGCTGG + Intronic
1049092494 8:140526803-140526825 GACACACACACAGACTGGTCTGG + Intergenic
1049343805 8:142127926-142127948 GAGATACACAATGAGTGGACAGG + Intergenic
1050100587 9:2115319-2115341 TACACACACACTGACTGCTCAGG - Intronic
1051674995 9:19549888-19549910 CACAATCACACTGATTGTTCAGG - Intronic
1052503483 9:29323131-29323153 TACATCCACACTGAGGGTTAGGG + Intergenic
1053160082 9:35808003-35808025 GAAATACACACTAAGTATTTAGG - Intronic
1055433542 9:76269324-76269346 GACATCCAATCTAAGTGTTCAGG + Intronic
1058713321 9:107700409-107700431 GAAATACTCACTAAGTATTCAGG - Intergenic
1058852253 9:109024194-109024216 GAAATACACACTCAGTGCTGGGG - Intronic
1058979296 9:110154416-110154438 GAGATACATACTAAGTGTGCAGG + Intronic
1059010344 9:110451120-110451142 GAAATACACACTGAGGGGTTTGG - Intronic
1059058679 9:111012492-111012514 CACATACACACTCAGTATCCTGG + Intronic
1062294096 9:135814552-135814574 GGCATGCACACTGGGTGCTCCGG + Intronic
1186902113 X:14067695-14067717 AAAATACACACTGAGTTTTGAGG - Intergenic
1189921930 X:45910730-45910752 CACATACACACAGAGTCTTGTGG - Intergenic
1191107715 X:56782113-56782135 GACATACACAATGAGTGACAAGG - Intergenic
1193239760 X:79154301-79154323 GACATTCACAGGGAGTGTGCAGG - Intergenic
1196088383 X:111710982-111711004 GACATACAGGCTGGGTGTTGTGG - Intronic
1196096109 X:111801756-111801778 GACGTAAACATTGTGTGTTCTGG + Intronic
1196215639 X:113048935-113048957 GACATCCATACTCAGTGGTCAGG + Intergenic
1196908081 X:120458509-120458531 GAGAAACACCCTGAGGGTTCTGG + Intronic
1198788682 X:140318583-140318605 GGCATCCACACTGCGGGTTCTGG + Intergenic
1200410021 Y:2851723-2851745 GACACAGACACAGAGTGTCCAGG - Intronic
1201568050 Y:15386693-15386715 GACCTTCACAGTGAGTGTTACGG + Intergenic
1201857052 Y:18556240-18556262 GACACTCACACTGAGGGTTGTGG - Intronic
1201876269 Y:18764140-18764162 GACACTCACACTGAGGGTTGTGG + Intronic