ID: 1023165664

View in Genome Browser
Species Human (GRCh38)
Location 7:37341160-37341182
Sequence AAAGCTCCACAGATTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023165661_1023165664 -8 Left 1023165661 7:37341145-37341167 CCAAGCATGTGGTCCAAAGCTCC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG No data
1023165660_1023165664 -7 Left 1023165660 7:37341144-37341166 CCCAAGCATGTGGTCCAAAGCTC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1023165664 7:37341160-37341182 AAAGCTCCACAGATTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023165664 Original CRISPR AAAGCTCCACAGATTGAGAA GGG Intronic
No off target data available for this crispr