ID: 1023165805

View in Genome Browser
Species Human (GRCh38)
Location 7:37342715-37342737
Sequence TGTAGGATCCTCATTCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023165805_1023165809 12 Left 1023165805 7:37342715-37342737 CCAGTGGGAATGAGGATCCTACA 0: 1
1: 0
2: 2
3: 9
4: 118
Right 1023165809 7:37342750-37342772 ACACGTGTCTATACCTAATGAGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023165805 Original CRISPR TGTAGGATCCTCATTCCCAC TGG (reversed) Exonic
900776389 1:4588749-4588771 TGTAGGATCCACATACCCAGCGG + Intergenic
903486798 1:23695537-23695559 TGGAGGATCCTCAGCACCACTGG + Intronic
907860483 1:58347948-58347970 TGGAGGATAGTCATTCCCAGGGG - Intronic
909305707 1:74073677-74073699 TGTTAGATCCTCATTGCCAGTGG - Intronic
912655216 1:111480613-111480635 TTAGGGATCCTCAGTCCCACAGG - Intergenic
915105063 1:153529128-153529150 AGTAGGATGGTGATTCCCACAGG + Intergenic
918169432 1:181982355-181982377 TCTAGAAGCCTCATTCCCAGGGG + Intergenic
918753426 1:188304068-188304090 TGCAGAATCCTCCTTCCCAAGGG + Intergenic
920616403 1:207496547-207496569 TGTAGGATCCTTCTGCGCACTGG + Intronic
921426677 1:215010801-215010823 TATAGGAGCCTCACTCCCTCAGG + Intronic
924578937 1:245306350-245306372 TGTAGATTCCTCATTCTCAGGGG + Intronic
1063401711 10:5752467-5752489 TGTCGGCTCCACATGCCCACTGG + Intronic
1064140918 10:12789626-12789648 TGTAGACGCCACATTCCCACTGG + Intronic
1067468386 10:46518309-46518331 TATAGGATTCTCATCTCCACTGG + Intergenic
1070724324 10:78777983-78778005 TGTATCATGCTCATTCCCACTGG - Intergenic
1070725582 10:78785777-78785799 TGAAGGGTCAGCATTCCCACAGG + Intergenic
1075073991 10:119338144-119338166 TCAGGGATCCTGATTCCCACCGG + Intronic
1077103201 11:831140-831162 TAGAAGATCCTCCTTCCCACGGG - Intronic
1080793105 11:35538730-35538752 TTTAGGAGCCTCCTTTCCACTGG + Intergenic
1081677687 11:44980577-44980599 TCAGGGATCCTCATTCCCTCAGG + Intergenic
1083650721 11:64203005-64203027 TGTTGGATCCTAAATCCTACAGG - Intronic
1084732337 11:71081653-71081675 TCAAGGGTCCTCATTCCCTCTGG + Intronic
1085523748 11:77152772-77152794 TGTACAATCATCATACCCACAGG - Intronic
1088760255 11:112922647-112922669 TGTAGCAACCTGCTTCCCACTGG - Intergenic
1090400447 11:126445320-126445342 TGTAACATCCTCAGTCACACGGG - Intronic
1099674811 12:85745102-85745124 TGGAAGATTCTCATTACCACAGG + Intergenic
1100279174 12:93101827-93101849 TGTATGATCCTCATTGCAATGGG + Intergenic
1100876895 12:98971709-98971731 CATAGGACCCTCATTCCCTCTGG - Intronic
1107858110 13:44635196-44635218 TCTAGACTCCTCATTCCCTCTGG - Intergenic
1110261017 13:73485424-73485446 TGAATGATCCTCATTACCAACGG + Intergenic
1111023389 13:82485469-82485491 TGTATGTTCCTCATTTCCACTGG + Intergenic
1112191450 13:97181984-97182006 TTTAGGCTCATCATTGCCACTGG + Intergenic
1116261508 14:42634253-42634275 GGTAGGATCCTAACTCCCATGGG - Intergenic
1117064291 14:51994513-51994535 TGTTGTATCTTCATTCCCATTGG + Intronic
1117195612 14:53337029-53337051 TACAGAATCCTCATTACCACAGG - Intergenic
1131315808 15:91336062-91336084 AGTAAGATCCTAATACCCACAGG - Intergenic
1133955743 16:10442485-10442507 GTTAGGGTACTCATTCCCACTGG - Intronic
1135385780 16:22038268-22038290 AGTAGGAGCCTCATTCACAGTGG + Intronic
1138327551 16:56188662-56188684 AGTAATTTCCTCATTCCCACAGG + Intergenic
1139022172 16:62763271-62763293 TGTAGGAGGCTAATGCCCACAGG - Intergenic
1139328491 16:66169774-66169796 ATGAGGATACTCATTCCCACTGG - Intergenic
1140297935 16:73727021-73727043 GGTAGGATCCTAGTTCTCACAGG + Intergenic
1141229523 16:82152452-82152474 TGTAGGCTCTTCATTTCCAAGGG + Intronic
1142204698 16:88777369-88777391 TGCAGGGTCCTCATTGTCACTGG + Intronic
1149036076 17:52135646-52135668 TGCAGGGTGCCCATTCCCACAGG - Intronic
1150808898 17:68340793-68340815 TGTAGTATCCTCATTGCCACAGG + Intronic
1151380680 17:73723824-73723846 TATAGGATCCCCATGCCCACAGG + Intergenic
1152014851 17:77743939-77743961 TGGAGTATCCCCTTTCCCACGGG + Intergenic
1155021429 18:21900584-21900606 TGCAGGACCCTCATTTGCACAGG - Intergenic
1158111943 18:53949813-53949835 TGTTGGCTACTCAGTCCCACAGG - Intergenic
1159146721 18:64463790-64463812 TTTAGGAGCCTCATTTCCCCAGG - Intergenic
1161293845 19:3509582-3509604 TGGAGCATTCTCATTCCCTCAGG + Intronic
1162207143 19:9064633-9064655 TGTAGGATTCACAATCCCACGGG - Intergenic
1162601575 19:11674095-11674117 TGTAGCATCCTCTGTCACACTGG + Intergenic
1163631825 19:18421445-18421467 TGAACGATCCCGATTCCCACTGG - Intronic
1164393982 19:27848120-27848142 TGTAGGATCTGCATACCCAGAGG + Intergenic
1165453244 19:35897058-35897080 TGTAGGATCTTCTCTGCCACAGG - Exonic
1202644664 1_KI270706v1_random:129353-129375 AATAGCATCCTCTTTCCCACTGG - Intergenic
926147889 2:10407813-10407835 TGAAGGATTCTCCTTCCCCCAGG + Intronic
926619258 2:15032343-15032365 TATACAATCCTCATTTCCACTGG - Intergenic
927056570 2:19370748-19370770 TAGACGATCCTCATTCACACTGG + Intergenic
927597640 2:24411107-24411129 TGGCAGATCCTCATTCCTACTGG + Intergenic
928725086 2:34163221-34163243 TGTAACATCATTATTCCCACAGG - Intergenic
930127649 2:47815315-47815337 TGGAAGATCCTCATTCCCGAGGG - Intronic
933015112 2:77114528-77114550 TGTGGGAACCTGATTCCCTCTGG - Intronic
933126626 2:78616687-78616709 TTTACGATCCTCATTCCCTTTGG + Intergenic
935737101 2:106115046-106115068 TGCTGAATCCTCATTCTCACTGG + Intronic
937696187 2:124811009-124811031 TCTAGGATCCTCCTTCCAAATGG - Intronic
938134912 2:128748868-128748890 TGTTGGACCCTCATTTTCACTGG + Intergenic
939026808 2:137023818-137023840 TGTAGGTGGCTCATACCCACAGG - Intronic
940205964 2:151202127-151202149 TGTAGGATCCTAAATCCTATTGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1173338794 20:42135859-42135881 TGTAGGGTCCTCACTCCTCCTGG + Intronic
1174337280 20:49871929-49871951 TGTTAGATCCTCAGTCCCACAGG + Intronic
1176607218 21:8843302-8843324 AATAGCATCCTCTTTCCCACTGG + Intergenic
1177781837 21:25630314-25630336 TGTAGGCTCTTATTTCCCACTGG + Intergenic
1180065513 21:45410265-45410287 TGTGGGCCCCTCGTTCCCACAGG + Intronic
1180357304 22:11853090-11853112 AATAGCATCCTCTTTCCCACTGG + Intergenic
1180380961 22:12139241-12139263 AATAGCATCCTCTTTCCCACTGG - Intergenic
1181966163 22:26657910-26657932 TGCAAGATCCCCATTCGCACTGG - Intergenic
949673639 3:6427640-6427662 TGGAAGATCCTCATTCCAAAGGG + Intergenic
949894399 3:8758483-8758505 TGTAAGTCCCTCATTCCTACAGG + Intronic
954038800 3:47868695-47868717 GTTAGGATGCTCATTCCCAATGG - Intronic
955966235 3:64391975-64391997 TGCAGTACCCTCACTCCCACTGG + Intronic
956996531 3:74832150-74832172 TGGAGGAACCTCACTCCCCCAGG - Intergenic
961714507 3:128849380-128849402 TGTAGGATCCTCAAGACCATCGG - Intergenic
963843387 3:150130714-150130736 TGAAGGATTTTCATTCCCTCAGG - Intergenic
967990154 3:195124695-195124717 TGTGGGGTCCACACTCCCACGGG - Intronic
969565826 4:7977455-7977477 TGTGGGAACCACATTCCCAGTGG + Intronic
973370902 4:49247912-49247934 AATAGCATCCTCTTTCCCACTGG - Intergenic
973390128 4:49547544-49547566 AATAGCATCCTCTTTCCCACTGG + Intergenic
980765639 4:137300447-137300469 TGTAGGCTTGTCATTCACACAGG - Intergenic
988005850 5:25408892-25408914 TTTAAGATCGTCATTCCAACTGG + Intergenic
994040987 5:95259623-95259645 CGTAGGATCTGCATACCCACAGG - Intronic
1007429247 6:41767230-41767252 TGAAGGAGCCTCATTCTCTCAGG - Intergenic
1011155441 6:84325106-84325128 TGTAGTATCCTCTACCCCACAGG + Intergenic
1013356086 6:109347085-109347107 TGTAGGATCCTCATTCCCTACGG - Intergenic
1019724883 7:2595993-2596015 TGAAGGATCCTCCTACCCACTGG - Intronic
1023165805 7:37342715-37342737 TGTAGGATCCTCATTCCCACTGG - Exonic
1024010775 7:45264774-45264796 TGGAGTAGCCTCATTCCCCCAGG - Intergenic
1024201001 7:47105723-47105745 TGTAGGAGCCTCATTCTACCAGG + Intergenic
1027184195 7:75960593-75960615 TGTAGGATCCAAAGTCCCACAGG + Intronic
1027814109 7:82946940-82946962 TCTATGATCCTCATAGCCACAGG + Intronic
1028029242 7:85888500-85888522 TGTAAAATCTTCATTCCAACAGG + Intergenic
1034322857 7:150201057-150201079 TGTAGAATTCTCATCCCCAGAGG - Intergenic
1034770328 7:153768066-153768088 TGTAGAATTCTCATCCCCAGAGG + Intergenic
1035310372 7:157964127-157964149 TGTGGGACCCCCGTTCCCACTGG + Intronic
1036094812 8:5711886-5711908 TGCATGATCCTCACTCACACTGG + Intergenic
1036436890 8:8743021-8743043 TGCTGAATCCTCATTCTCACTGG - Intergenic
1037374058 8:18209647-18209669 TCCATCATCCTCATTCCCACTGG - Intronic
1037561406 8:20078087-20078109 TGTATGATCCAGCTTCCCACTGG - Intergenic
1038647500 8:29373534-29373556 GGTGGGATCCTCTTCCCCACCGG - Intergenic
1040903449 8:52440446-52440468 TGAAGGATGCTGATTCCCAGAGG - Intronic
1044353110 8:91189739-91189761 TATAGGATCCACATTGCCAATGG - Intronic
1044915811 8:97111736-97111758 TGCAGGATGCTCATTTCCAAGGG + Intronic
1047147946 8:122226691-122226713 TCTAGGATACACATCCCCACTGG + Intergenic
1050716700 9:8536479-8536501 TATAGGCTTCTCATTCCCTCAGG + Intronic
1051480143 9:17550638-17550660 TGCAGGATGCCCACTCCCACTGG - Intergenic
1054354029 9:64044492-64044514 AATAGCATCCTCTTTCCCACTGG + Intergenic
1059706099 9:116824988-116825010 TGTAGGAACTTCCTTCCTACAGG - Intronic
1059862339 9:118478687-118478709 TGTAGAATTCTCTTTCCCACTGG - Intergenic
1060936166 9:127517408-127517430 TGTAGGATCCTCAGACTCAAGGG + Intronic
1061650305 9:132042504-132042526 TGTGGGATCTTCAGTCCCAGAGG - Intronic
1203695303 Un_GL000214v1:92711-92733 AATAGCATCCTCTTTCCCACTGG - Intergenic
1203742364 Un_GL000218v1:13604-13626 AATAGCATCCTCTTTCCCACTGG + Intergenic
1203554533 Un_KI270743v1:194249-194271 AATAGCATCCTCTTTCCCACTGG + Intergenic
1203640970 Un_KI270751v1:11352-11374 AATAGCATCCTCTTTCCCACTGG + Intergenic
1190997444 X:55624004-55624026 TGTCAGATCCTCTTTTCCACTGG - Exonic
1194440851 X:93931852-93931874 TGTAGGAACCACTTTCCCAGTGG - Intergenic
1201155895 Y:11131079-11131101 AATAGCATCCTCTTTCCCACTGG + Intergenic