ID: 1023166359

View in Genome Browser
Species Human (GRCh38)
Location 7:37347383-37347405
Sequence AAGGGACTGTTGACCTCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023166359_1023166368 25 Left 1023166359 7:37347383-37347405 CCTCTAGAGGTCAACAGTCCCTT 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1023166368 7:37347431-37347453 ATGTTGTAGAAGGGACCCGGTGG 0: 1
1: 25
2: 365
3: 2294
4: 5668
1023166359_1023166365 15 Left 1023166359 7:37347383-37347405 CCTCTAGAGGTCAACAGTCCCTT 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1023166365 7:37347421-37347443 AAATTTTCACATGTTGTAGAAGG 0: 1
1: 1
2: 6
3: 88
4: 905
1023166359_1023166369 26 Left 1023166359 7:37347383-37347405 CCTCTAGAGGTCAACAGTCCCTT 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1023166369 7:37347432-37347454 TGTTGTAGAAGGGACCCGGTGGG 0: 2
1: 48
2: 777
3: 4107
4: 6879
1023166359_1023166367 22 Left 1023166359 7:37347383-37347405 CCTCTAGAGGTCAACAGTCCCTT 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1023166367 7:37347428-37347450 CACATGTTGTAGAAGGGACCCGG 0: 1
1: 86
2: 803
3: 1804
4: 3180
1023166359_1023166366 16 Left 1023166359 7:37347383-37347405 CCTCTAGAGGTCAACAGTCCCTT 0: 1
1: 0
2: 1
3: 14
4: 159
Right 1023166366 7:37347422-37347444 AATTTTCACATGTTGTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023166359 Original CRISPR AAGGGACTGTTGACCTCTAG AGG (reversed) Intronic
900819043 1:4872127-4872149 AAGGGACTCTTATCCTCTAAAGG - Intergenic
902730414 1:18365295-18365317 AAGGGCCTGCTGTCCTGTAGGGG - Exonic
904023414 1:27486026-27486048 AAGGGACTGTAGATCTCTATAGG - Intronic
905487985 1:38319857-38319879 AAGGAACAGTTTACCTATAGAGG - Intergenic
912170812 1:107097199-107097221 TAGGCACTGTGGACCACTAGAGG - Intergenic
916614781 1:166428881-166428903 AAGTGTCTGTTGACCCCTACTGG + Intergenic
917919020 1:179734234-179734256 AAGAGACTGTAGACCTATATAGG + Intergenic
918647189 1:186918346-186918368 AAGGGCCTGTTAAACTCTGGGGG - Intronic
919830236 1:201535771-201535793 AAGGGAGTGTTGACACCCAGAGG - Intergenic
921054650 1:211534742-211534764 AAGGCACTGGTGACCTCTCGTGG + Intergenic
924217204 1:241834942-241834964 AAGCAAGTGTTGGCCTCTAGTGG + Intergenic
924351849 1:243122187-243122209 AAGGGCCTGGTGACCTCTTCGGG + Intergenic
924744843 1:246822348-246822370 AAGGGAGTCTTCTCCTCTAGAGG - Intergenic
1062837440 10:644976-644998 AAGGGACTGAGGACCTGAAGAGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064729264 10:18312922-18312944 AAGTGACTGCTGACCTCTAGAGG + Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067986617 10:51154343-51154365 GGGGGACTGCTGACTTCTAGTGG + Intronic
1070196848 10:74165608-74165630 TAGGGACTCTTAACCTCTCGGGG - Intronic
1071286140 10:84147544-84147566 AGGAGATTGTTGACATCTAGAGG + Intronic
1075366893 10:121898576-121898598 AAATGACTGTTGACCTAGAGTGG + Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1079647357 11:22882032-22882054 AAGGGACTGTTGTCCTATCTGGG - Intergenic
1081553154 11:44132689-44132711 AGTGGACTGTTCACCACTAGAGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085219212 11:74859333-74859355 AAGGGTCTGTTGGCCCTTAGTGG - Intronic
1086603118 11:88660083-88660105 AATGGACTGTTGACTCCTTGAGG - Intronic
1089402724 11:118173705-118173727 ATGGGCCTGTTTCCCTCTAGAGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1093856654 12:24112432-24112454 AAAGGTCTGTTGACCCCTATTGG + Intergenic
1098748643 12:74269065-74269087 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1099793186 12:87363053-87363075 TGGGGACTTCTGACCTCTAGGGG + Intergenic
1101203945 12:102466423-102466445 AAGGGACTGCTGGCACCTAGTGG + Intronic
1101556059 12:105810766-105810788 AAGGGACTATTCATCTCTTGCGG + Intergenic
1102905850 12:116674729-116674751 GAGGGACTTTTGCCCTGTAGGGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1105103416 13:16492516-16492538 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105108198 13:16570300-16570322 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105134199 13:16995122-16995144 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105141249 13:17110922-17110944 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105157756 13:17379590-17379612 AAGGGAATGTTCAACTCTATGGG - Intergenic
1105159832 13:17413695-17413717 AAGGGAATGTTCAACTCTATGGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1109803003 13:67401929-67401951 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1114000088 14:18228080-18228102 AAGGGAATGTTCACCTCTGTGGG + Intergenic
1119173402 14:72551560-72551582 AAGGGACCGTTGTTCTCAAGGGG - Intronic
1129888008 15:79052173-79052195 AAGTGACAGTTTGCCTCTAGGGG - Intronic
1131019000 15:89082071-89082093 GGGGTGCTGTTGACCTCTAGTGG - Intergenic
1134748661 16:16607967-16607989 AAAGGAATGTTGACATCTTGTGG - Intergenic
1134996805 16:18745649-18745671 AAAGGAATGTTGACATCTTGTGG + Intergenic
1139018480 16:62719128-62719150 AAGACACTGTGGACCACTAGAGG + Intergenic
1140424129 16:74846293-74846315 AAGGGACTGGGAACCTTTAGGGG - Intergenic
1143976067 17:10830911-10830933 GAGGTACTGTTGGCATCTAGTGG - Intronic
1146239771 17:31209097-31209119 AAGGGAATATTGGCATCTAGTGG - Intronic
1146681579 17:34812080-34812102 GAGGAACTGTTGCCCTGTAGAGG + Intergenic
1147909093 17:43844107-43844129 AAGGGACTACTGGCATCTAGGGG + Intergenic
1152837658 17:82544712-82544734 AAGGGATTGTGGACCTTTATGGG + Intronic
1153439439 18:5100578-5100600 CAGGGCCTGTTGATCTCTAAGGG + Intergenic
1156887797 18:42155854-42155876 AAGGGCTAGATGACCTCTAGAGG + Intergenic
1160234569 18:77075909-77075931 AGGGGACTGTTGGCCTCTGGAGG + Intronic
1162284204 19:9726110-9726132 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1162303033 19:9854935-9854957 TAGTGACTGTTGAACTCTAATGG - Intronic
1163943208 19:20513824-20513846 AAGGGCCTGTTAAACTCTGGGGG - Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1167221894 19:48204685-48204707 AGGGGACTGTTGTCCTCTATGGG + Intronic
925722455 2:6842357-6842379 AAGGGACTGTTATCCTCTAAAGG - Intronic
926244363 2:11112344-11112366 AAAGGACCCTTGACCTCAAGTGG - Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930873761 2:56191800-56191822 AAGGCACAATTGCCCTCTAGTGG - Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932458478 2:71865441-71865463 AAGGGACTGTAGACCTATCCAGG + Intergenic
935880097 2:107556682-107556704 AAGTGAATGTTGACCTCATGGGG + Intergenic
937960362 2:127453543-127453565 AGAGGACTGGTGTCCTCTAGAGG + Intronic
939172846 2:138715747-138715769 AGGTGACTCTAGACCTCTAGAGG - Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
943233651 2:185290562-185290584 AGGTGTCTGTTGACCTCTACTGG - Intergenic
946241777 2:218360506-218360528 AAGGGTCAGGTGACCTCTGGGGG + Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1169229531 20:3878366-3878388 AATTCATTGTTGACCTCTAGAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1175160617 20:57005100-57005122 AAGGGACTGTGGACCTGAACTGG - Intergenic
1178310721 21:31527808-31527830 GAGAGACTGTTGACCACAAGTGG - Intronic
1178447716 21:32660793-32660815 AAGGGCCTGTTAAACTCTAGGGG + Intronic
1178585148 21:33865432-33865454 TAGGCCCTGTTGGCCTCTAGTGG - Intronic
1179012500 21:37566664-37566686 AAGGAACTTTTGACCTATAGGGG - Intergenic
1180424551 22:15157853-15157875 AAGGGAATGTTCACCTCTGTGGG + Intergenic
1181379985 22:22494453-22494475 AAGGGTCTCTGGACATCTAGAGG - Intronic
1183830451 22:40416039-40416061 CAGGGACAGTTGACATCAAGTGG - Intronic
1203330676 22_KI270738v1_random:82251-82273 AAAGGAATGTTCAACTCTAGGGG + Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
953196276 3:40737370-40737392 CAGGCTCTGTTGACCTCTGGTGG + Intergenic
953569166 3:44057744-44057766 AAGAGGCTGATGACCTCGAGAGG - Intergenic
954903020 3:54036018-54036040 AAGGGCCTGGTGACCTACAGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
962316021 3:134359987-134360009 GAGGGACTGCTGAGCTCTATGGG + Intronic
963335348 3:143969062-143969084 AAGGGACTGTTGCCTCCCAGGGG - Intergenic
964522395 3:157583191-157583213 AAGGGCCTGTTAAACTCTGGGGG - Intronic
964814283 3:160700545-160700567 AAGGGCGTATTGACCTCTAAGGG - Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
973204919 4:47549717-47549739 AAGGGAATGATCACCTCTAAGGG + Intronic
976009233 4:80467427-80467449 AAGGGACTATTCATCTGTAGAGG - Intronic
976226039 4:82796691-82796713 CAGAGCCTGGTGACCTCTAGGGG - Intronic
976899984 4:90160747-90160769 AATAGAATGTAGACCTCTAGAGG + Intronic
978150977 4:105434401-105434423 AAGGCAATTTTGCCCTCTAGGGG + Intronic
978413607 4:108452183-108452205 AATGAAATGTTGACCTTTAGTGG - Intergenic
978577252 4:110199395-110199417 AATGTACTGTTGACCCCTACTGG + Intergenic
978887426 4:113781629-113781651 AAGATAATGTTGACCACTAGAGG + Intergenic
979426051 4:120568680-120568702 AAAGGGCTGTTGATCTCTGGTGG - Intergenic
980373526 4:131911652-131911674 AAGTGTCTGTTGCCTTCTAGAGG - Intergenic
980780151 4:137483063-137483085 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
983287655 4:165760320-165760342 CAGGGAGTGTTGAGCTCTACAGG - Intergenic
986005940 5:3669346-3669368 AGGTGACTGTTGACCTCTACTGG + Intergenic
993737065 5:91489881-91489903 AAGTGACTGTGGACCTCTTTGGG + Intergenic
996270353 5:121597069-121597091 AGGGGACTGCTGGGCTCTAGTGG - Intergenic
996487720 5:124056466-124056488 AATGGACTGTTGAGGTCTTGAGG + Intergenic
997943638 5:138180376-138180398 AAGGCACTACTGACATCTAGTGG - Intronic
1009612561 6:65964894-65964916 AAGTGATTGTTGACATATAGTGG + Intergenic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1013360978 6:109393729-109393751 AAGGGAGTGTGGAGCTCTTGAGG - Intronic
1013797414 6:113903125-113903147 AATTGACTGTAGACCTCAAGTGG - Intergenic
1014166787 6:118233911-118233933 AAGGGTCTCTTGACCTTTGGTGG - Intronic
1016786762 6:148019315-148019337 CAGGGCCTGTTGACCACTAGAGG + Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020542832 7:9482383-9482405 AAGTGACTGTTGTCATATAGTGG + Intergenic
1022793908 7:33716785-33716807 TAGGAACTGTTGCCCTCTACTGG - Intergenic
1023166359 7:37347383-37347405 AAGGGACTGTTGACCTCTAGAGG - Intronic
1028617431 7:92784463-92784485 AGGGCACTGTTTACCTCTTGAGG + Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1033237227 7:139647969-139647991 AAGGAACTTTTGATCTCTTGGGG - Intronic
1035648029 8:1243267-1243289 AAGGGGCTGGTGCCCTGTAGAGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038048746 8:23789710-23789732 AAGAGACCGTTGACCACAAGAGG + Intergenic
1038445651 8:27602224-27602246 AGGGAGCTGCTGACCTCTAGTGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039480356 8:37868609-37868631 GAGGGATTGGTGACCTTTAGTGG - Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041596544 8:59660515-59660537 AAGCGTCTGTAGACCTCAAGTGG - Intergenic
1042743073 8:72073469-72073491 AAGGGTTTTTTAACCTCTAGAGG - Intronic
1042758811 8:72249288-72249310 AAGGGTTTTTTGAACTCTAGAGG - Intergenic
1048182951 8:132213231-132213253 AAGGGACAGTTAAGCTCTGGTGG - Intronic
1050151788 9:2624057-2624079 AAGGTAAAGTTAACCTCTAGTGG - Intronic
1053147292 9:35720206-35720228 GCAGGACTGTTGACCTGTAGAGG + Exonic
1053713849 9:40860293-40860315 AAGGGAATGTTCACCTCTGTGGG - Intergenic
1054424233 9:64990641-64990663 AAGGGAATGTTCACCTCTGTGGG - Intergenic
1055321556 9:75088099-75088121 AAGGGGCTGTGGGCCTCTCGGGG - Exonic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057195174 9:93112501-93112523 CAGAGAATGATGACCTCTAGCGG + Intronic
1057393789 9:94661366-94661388 AAAGGTCTGTTGACCTCTAAGGG + Intergenic
1057767562 9:97935410-97935432 AAGGTGCTGTTGGCATCTAGAGG + Intronic
1059035833 9:110752592-110752614 AGGGGGCTGTTGACTACTAGGGG - Intronic
1059807059 9:117813789-117813811 AAGTGACTTTTGTCATCTAGAGG + Intergenic
1060172358 9:121472296-121472318 AAGGGATTGTGGACCTCTACTGG + Intergenic
1061032201 9:128092087-128092109 AAGGTAATGTTGGCCTCAAGAGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1185527392 X:790406-790428 AAGGGGCTGTCGGCTTCTAGGGG - Intergenic
1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG + Intergenic
1189478568 X:41375791-41375813 AAGGGACAGTTGGCCTCTAAAGG + Intergenic
1190747162 X:53331195-53331217 AAGAGAGTATTGCCCTCTAGTGG + Intergenic
1193510092 X:82388793-82388815 AAGTGACTGTTGACCCCTGCTGG - Intergenic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1198496637 X:137199923-137199945 CTGTGACTGTTGAACTCTAGTGG + Intergenic
1200394075 X:155972905-155972927 AAGGGCCTGTTAAACTCTAGGGG - Intergenic
1201555107 Y:15259043-15259065 AAGGGTCTGTTAAACTCTGGGGG + Intergenic
1202126765 Y:21575243-21575265 AAGGGGCTGTTAATCTCTGGAGG + Intergenic