ID: 1023169592

View in Genome Browser
Species Human (GRCh38)
Location 7:37377751-37377773
Sequence TAGCAAACAGCCTTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 5, 3: 36, 4: 285}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023169592_1023169599 7 Left 1023169592 7:37377751-37377773 CCCTCCTCCAAGGCTGTTTGCTA 0: 1
1: 1
2: 5
3: 36
4: 285
Right 1023169599 7:37377781-37377803 GAAGCCAGCGCCTTGGCACCAGG No data
1023169592_1023169598 0 Left 1023169592 7:37377751-37377773 CCCTCCTCCAAGGCTGTTTGCTA 0: 1
1: 1
2: 5
3: 36
4: 285
Right 1023169598 7:37377774-37377796 TGTGGGAGAAGCCAGCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023169592 Original CRISPR TAGCAAACAGCCTTGGAGGA GGG (reversed) Intronic
901856808 1:12049830-12049852 TAGCAAACAGTCTTGGAAGCTGG + Intergenic
902225238 1:14992512-14992534 TGGCCAACAGCCCTGGAGGAGGG - Intronic
903352651 1:22727294-22727316 TAGCCCACATCCTTGGTGGATGG + Intronic
903562065 1:24235826-24235848 TACCAAAGACCCTTGGAGGGGGG - Intergenic
905224395 1:36469688-36469710 TAGCAACAAGACCTGGAGGATGG - Exonic
905247876 1:36627279-36627301 GAGCAGACAGACTTGAAGGATGG - Intergenic
906047621 1:42844180-42844202 TAGCAAACAGCCTCTTAGGTTGG + Exonic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
908249080 1:62251066-62251088 TAGTGAACAGCCTTGGAAGCTGG + Intronic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
911320963 1:96413553-96413575 TCGCATAAAGCCTTGGAGGGAGG + Intergenic
912455356 1:109793101-109793123 GAGGAAACTGCCTTGCAGGAAGG + Intergenic
912536770 1:110379745-110379767 TTGGAAACAGCCTTAGAAGAGGG + Intronic
915912550 1:159923821-159923843 TACCAAACAGTGTTGGAGGCTGG + Intronic
916484857 1:165249630-165249652 CAGCAAACAGCCTGGCAGCAGGG + Exonic
916666484 1:166972419-166972441 TAGCAATAAGACTTGAAGGAGGG - Intronic
916809560 1:168293448-168293470 TAGCAAACAGCCAAGAGGGAGGG - Intronic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917837562 1:178953290-178953312 TAGCAAACGGCCCAGGAGGTGGG + Intergenic
919040102 1:192376013-192376035 TAGCGAACAACCTTGGAAGGAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919149373 1:193675990-193676012 TAGTAAACAGCCTTGAAAGATGG + Intergenic
920284156 1:204867864-204867886 TAGAAGAGAGCCTTGGAGGAGGG - Intronic
920444474 1:206005481-206005503 TAGCAAACATTCCTGGAGGGAGG + Intergenic
920613649 1:207467686-207467708 TGATAAATAGCCTTGGAGGAAGG + Intronic
920627968 1:207622208-207622230 TAGTAAAGAGCCTTTGATGAAGG - Intronic
920641529 1:207756136-207756158 TAGCTACCAGCCAGGGAGGAAGG + Intronic
921975751 1:221201110-221201132 TAGCAAACAGTCTCAGAGAACGG + Intergenic
922414659 1:225410165-225410187 TCTCAAGCAGCCTTGGAGGCAGG + Intronic
922968571 1:229715055-229715077 TAGCAACAAGCCTTTGAGGTTGG + Intergenic
924428790 1:243978974-243978996 TAGAAGACCGCCTTGGAGGCTGG - Intergenic
924501873 1:244645618-244645640 TAACCAACAGCCTTGTAGGTCGG - Intergenic
1063072165 10:2677694-2677716 TAGTAAACAGCTTTGGAAAATGG - Intergenic
1064095918 10:12424394-12424416 CACCAATCAGACTTGGAGGAGGG - Intronic
1064123345 10:12638292-12638314 TAGCAAGCAGGCTTAGAGTATGG - Intronic
1066662954 10:37754462-37754484 CAGCAAACAGCCTTAGAAGGTGG + Intergenic
1067522235 10:47016663-47016685 CAGGAAACAGCCTTGTAGCAGGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069041926 10:63704558-63704580 TAGCTCACAGCCTTGGTTGAAGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072112248 10:92333780-92333802 TAGCAAAAAGACTTGGAGCAAGG + Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1074416921 10:113274559-113274581 TATCAACCAGCCTTGGGGGAAGG - Intergenic
1076061111 10:127414805-127414827 GAGCAAACAGATTTTGAGGAAGG - Intronic
1076228710 10:128802273-128802295 GAGAACACAGCTTTGGAGGAAGG + Intergenic
1076541964 10:131220305-131220327 AAGCCAAGAGCCCTGGAGGATGG - Intronic
1076803849 10:132845435-132845457 CACCAAACAGCCCTGGACGAGGG + Intronic
1077609381 11:3635141-3635163 TAGAAGACAGCCTTCGAGGAGGG - Intergenic
1078780591 11:14435411-14435433 TAGCAAACAGCCTTGGAAGATGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083969120 11:66061905-66061927 TGGCAATCAGCCATGGGGGAGGG - Exonic
1085522292 11:77145845-77145867 GAGAAAACAGGCTCGGAGGAGGG - Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086254096 11:84853997-84854019 TCCCTAACAGCCATGGAGGATGG + Intronic
1087056325 11:93940031-93940053 CAGCATACTGCCTTGGAGGAAGG + Intergenic
1087578172 11:100016601-100016623 AAGCAAACAGCCTGGGACAATGG - Intronic
1087825795 11:102763442-102763464 TAGCAAACAACCTTGCAGGTGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088545111 11:110951431-110951453 GATTGAACAGCCTTGGAGGAGGG - Intergenic
1089076575 11:115743314-115743336 TAGCAGACAGCCTGGGTGGAGGG + Intergenic
1089178894 11:116567328-116567350 TCTCAAACAACCTTGGAGGCAGG - Intergenic
1089701951 11:120250301-120250323 TAACCAACATCTTTGGAGGATGG + Intronic
1090925960 11:131250763-131250785 AAAGAAACAACCTTGGAGGAAGG - Intergenic
1091698148 12:2641821-2641843 TAGAAAACAGCCTTTGTGGGGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095269138 12:40195728-40195750 TAACAAACAGCCTCACAGGAAGG - Intergenic
1095563164 12:43589404-43589426 TAGCAAACATCCTGGGGGAATGG + Intergenic
1097399419 12:59110698-59110720 TAGGAAACATCCTAGGAGAAAGG + Intergenic
1097786393 12:63764915-63764937 TAGCAAAGAGCCTTGGAAGATGG - Intergenic
1098952623 12:76657476-76657498 TAGAAAACACCTTTGGAAGATGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100634778 12:96425261-96425283 TAGGAAAAGGCCTTGGAGGGGGG + Intergenic
1101870858 12:108563908-108563930 TAGTAATCATCCTTTGAGGATGG + Intronic
1102992185 12:117322999-117323021 TGGGAACCAGCCTTGGATGAAGG + Intronic
1104515971 12:129427031-129427053 TTGCAAACATCCTTTGAGGTTGG - Intronic
1104852469 12:131883883-131883905 CAGCCTACATCCTTGGAGGATGG - Intergenic
1106814936 13:33397256-33397278 TAGCCAACAGCCATGGCAGATGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107202202 13:37734869-37734891 TAGCAAGGAACCATGGAGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112453884 13:99539814-99539836 TAGAAAACAGGCCTAGAGGACGG + Intronic
1112939140 13:104839954-104839976 TTGCAAACAGCCTTGTAGTATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116975751 14:51114056-51114078 GAGCAAAGAGGCTTAGAGGAGGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119023795 14:71136895-71136917 TGACACACAGACTTGGAGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120694078 14:87624573-87624595 TAGCAACCAGCCTTGGTGACTGG + Intergenic
1121311410 14:92937377-92937399 TTCCACACAGCCCTGGAGGAAGG + Exonic
1121651790 14:95564216-95564238 TTGCAAACTGCCAAGGAGGAAGG - Intergenic
1122548013 14:102535476-102535498 CAGCAAGTAGCCTTGCAGGAAGG - Intergenic
1122624024 14:103075169-103075191 TGGCAACCAGCCGGGGAGGAAGG - Intergenic
1122900254 14:104779474-104779496 TATCTAACCCCCTTGGAGGAGGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126831386 15:52610088-52610110 TAGCAAACAAACTTGGACCATGG - Exonic
1127007579 15:54587663-54587685 TGGCAATCAGACTTGGAGGAAGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129949553 15:79573827-79573849 TGGCAAACGGTCTTAGAGGAAGG + Intergenic
1130252593 15:82309826-82309848 TAGCAAAAAGCAATGGAGGGTGG - Intergenic
1132210974 15:100021801-100021823 CAGCCAACAGCCTGGGAGGGAGG - Intronic
1132405485 15:101539767-101539789 CAGCAAGCAGCCTTCGTGGAAGG + Intergenic
1133224754 16:4335532-4335554 TAGCAAACTGCATTGGAAAAGGG - Intronic
1135034120 16:19062234-19062256 TAACAAACAGAATTGGAGGCTGG + Exonic
1135064550 16:19298639-19298661 AAGGAAACAGACTGGGAGGAAGG - Intronic
1135939280 16:26806872-26806894 TTTCAAAGAGCCTTGGAGGTGGG + Intergenic
1137219030 16:46428391-46428413 GAGCAAAAAGCCATGGCGGAGGG + Intergenic
1137486850 16:48898512-48898534 TAGAAAACAGTCCTGGATGATGG + Intergenic
1138126702 16:54444795-54444817 CAGTAAACAGCTTTGGAAGATGG + Intergenic
1139184218 16:64786248-64786270 TATTAAACAGCCCTAGAGGAAGG + Intergenic
1139778947 16:69334974-69334996 TAGCACCCAGCCATGGAAGATGG + Exonic
1140250099 16:73287957-73287979 CAGCAAGAAGGCTTGGAGGAGGG - Intergenic
1140709923 16:77667912-77667934 TAGGAAGCAGTCTTGAAGGAAGG - Intergenic
1142226508 16:88880295-88880317 TGGGAATCAGCCTTGGGGGAGGG - Intronic
1142687485 17:1586085-1586107 TGGCAGACAGCCCTGGAGCAGGG + Intronic
1144825010 17:18100917-18100939 TGGGAAACAGCCTCTGAGGACGG + Intronic
1145327554 17:21843776-21843798 CAGCAAAAAGCCTTGGCGGCGGG - Intergenic
1147195788 17:38765984-38766006 GAGCCAACACCCTTGGGGGAGGG - Exonic
1147476838 17:40720091-40720113 TAGCAAAAATCCTTTGAGGTTGG + Intergenic
1148194407 17:45702840-45702862 TAGAAAACAGCCTGGGAAGAAGG + Intergenic
1148710472 17:49677486-49677508 TAGCCCACAGCCTGGGAAGAAGG + Intronic
1149774075 17:59343660-59343682 TAGGAAACAGGTTTGGAGTAGGG + Intronic
1150211493 17:63444346-63444368 TAGGAAGCAGGCTTGGAGAAGGG - Intronic
1151184080 17:72350758-72350780 TAGAAACCAGCCTTGGAGTGAGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1157608195 18:48939467-48939489 TTGCAAACTGCCCGGGAGGAAGG - Intronic
1159315962 18:66773380-66773402 TAGCAGACAGCCTGGGAAGATGG + Intergenic
1159508866 18:69370009-69370031 GAACAGACAGCCTTGGAGGTTGG - Intergenic
1161321819 19:3644940-3644962 TGGCAAACAGCCCTGGATGACGG + Intronic
1162356182 19:10186417-10186439 TCGCAGACAGCCGTGAAGGACGG + Intronic
1162855086 19:13461897-13461919 TAGCAGACAGCCCTGCAGGCAGG + Intronic
1163325028 19:16598019-16598041 TTGAAAACAGCCTTAGAGGCTGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164781885 19:30899321-30899343 AAGCAAACTGTTTTGGAGGATGG + Intergenic
1166302620 19:41921106-41921128 TACCAAACAGCTCTGGGGGAGGG + Intronic
1167983222 19:53293713-53293735 TAAAAAACAGCCTTGAAAGATGG + Intergenic
1168282132 19:55311563-55311585 TAGGAAACAGCCTGCCAGGACGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
926019769 2:9484676-9484698 AAACAAACAGGCTTGGGGGAGGG + Intronic
930617083 2:53604703-53604725 CAGAAACCAGCCATGGAGGAAGG + Intronic
931196113 2:60053719-60053741 TAGCCAACAGTGTTGGAGGGAGG - Intergenic
932748033 2:74350810-74350832 GAGGCAACATCCTTGGAGGATGG - Intronic
933216687 2:79637997-79638019 TATCAGACAGTCATGGAGGAAGG - Intronic
934025154 2:87996352-87996374 AAGCATCCAGCCTGGGAGGAAGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937892931 2:126953566-126953588 TAGCAAACAGCCTTTGAAGATGG + Intergenic
938149811 2:128872676-128872698 TAGCAGACAGACTGGGAGCAGGG + Intergenic
939662273 2:144904748-144904770 TAACTTACAACCTTGGAGGAGGG + Intergenic
940256294 2:151733968-151733990 TGGCAAACATCTTTGGATGAAGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941079674 2:161045931-161045953 TAGCCAACACCCTTGTGGGAGGG - Intergenic
942374111 2:175318472-175318494 AAGAAAACAAGCTTGGAGGAAGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
944447918 2:199810341-199810363 TAACAAACAGCCTTGGAACTGGG + Intronic
947247404 2:228064939-228064961 AAGCAAGTAGCCTTGAAGGATGG + Intronic
947777923 2:232729274-232729296 TAGAAAACAGCTCTGGAGGCCGG - Intronic
947966887 2:234289532-234289554 TGGCCCACAGCCTAGGAGGAAGG + Intergenic
948083365 2:235226002-235226024 TACCAAATAGCCTTGGTGGCAGG - Intergenic
948193816 2:236080183-236080205 CAGGAAACAGCCTTGGATGATGG - Intronic
1169750137 20:8983337-8983359 TAGGAAAAAGAGTTGGAGGATGG - Intergenic
1170046328 20:12089238-12089260 AAGGAAACAGCCTTGGCTGAAGG - Intergenic
1172068461 20:32238692-32238714 TAGCAAACAGACTTGGGTGTGGG - Intergenic
1172275431 20:33676636-33676658 TTCCAAACAGGCTGGGAGGACGG + Exonic
1173256906 20:41400231-41400253 GAGGAAACAGACTTGGAGAAGGG + Intergenic
1173292496 20:41726993-41727015 TAACAAACAGCAATTGAGGATGG + Intergenic
1173516767 20:43669827-43669849 TATCAAACAGCATTGGAGGCTGG + Intronic
1174284181 20:49460553-49460575 CAGCGAACAGGCTTGGAGGTGGG + Intronic
1175536474 20:59718188-59718210 GAGCAAGCAGCCTGGGAGGTGGG - Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177367055 21:20152457-20152479 TTGCAAAGAGTCTTGGAGAAGGG + Intergenic
1178612149 21:34092932-34092954 TAGCAGAGAGCCCTGGAGGCAGG + Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1183569114 22:38639047-38639069 GAGGAAACAGCCTTGGAGGGAGG - Intronic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950600962 3:14035274-14035296 TAGCAATCAGCCTAGGATCAGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951019435 3:17766543-17766565 TAACAAACAGCCTTGGAAGATGG - Intronic
953623869 3:44554920-44554942 GAGAAAACAGGCTTGGAGGTTGG + Intergenic
955124735 3:56099902-56099924 TAGCAAAGAGTTTTGGAGGAAGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957501313 3:81061179-81061201 TTGCAAATAGCCTTTGTGGAAGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
962228970 3:133643199-133643221 TAGCAAACCTCCTTGGAGCAAGG - Exonic
962810123 3:138952322-138952344 TAGGCAACTGCCATGGAGGAAGG + Exonic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963428606 3:145165753-145165775 TATAAAACAGCCTTGGAAGATGG + Intergenic
963837128 3:150068735-150068757 TAGCTCACAGCCTAGGTGGAGGG - Intergenic
965432413 3:168605861-168605883 AAGCCATCAGCCTTAGAGGAGGG - Intergenic
965926326 3:173985072-173985094 TAGCAAACATCCTTGAAGTTTGG - Intronic
966629035 3:182051381-182051403 GAGCCAGAAGCCTTGGAGGAGGG - Intergenic
966787003 3:183631062-183631084 AAGCAAGCAGCCTTGGAGACCGG - Intergenic
967188707 3:186967043-186967065 TACTAAACAGCCTTGAAGTATGG - Intronic
970324360 4:14907950-14907972 TTGCAAACACCCTTGAAGAAAGG - Intergenic
972198490 4:36683123-36683145 TAACAAACATCCTTGGAAAATGG + Intergenic
972366335 4:38378515-38378537 TAGTGAACAGCCTTGGAAGATGG - Intergenic
972407217 4:38758203-38758225 CAACAAACAGACTTGGAGGGAGG - Intergenic
972865510 4:43227463-43227485 TAGAAACCAGTCTTAGAGGAGGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
977153468 4:93543629-93543651 TATCAAACGGCCTGGGAGTAAGG + Intronic
977847810 4:101786830-101786852 ATGCAAACAGCCATGCAGGAAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978703031 4:111672439-111672461 TAAAGAACAGCCTTGAAGGAAGG + Intergenic
978848979 4:113310299-113310321 AAGCAAACAGACTCTGAGGAGGG + Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
979957617 4:126973963-126973985 TAGAAAACAAACATGGAGGATGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
982148896 4:152429698-152429720 TAGGAAACAGGCTTGGATTAAGG - Intronic
982321301 4:154079988-154080010 GGGCAAACAGGCTTGGAGAATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983820246 4:172184117-172184139 TAGCAGACATTCTTGAAGGATGG + Intronic
985126242 4:186697540-186697562 TTGGAAACAGCCTTGAATGACGG + Intronic
985217473 4:187669557-187669579 TAGAAAACATCCTTGGGAGAAGG - Intergenic
987554390 5:19428358-19428380 TAGCAGTCAGCCTAGGAAGATGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988298718 5:29395120-29395142 TAGCAAGCACCCTAGGAGCATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990174248 5:53089578-53089600 AAGCAAACAGCTTTGGGGAAGGG - Intronic
991017906 5:61950915-61950937 TAGCAGCCGGCCATGGAGGAGGG - Intergenic
992210628 5:74476333-74476355 ATGTAAACAGCCTTGGAGGTAGG - Intergenic
993121965 5:83785885-83785907 TAGAAAACAGCCTCAGAGGAAGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993712955 5:91246209-91246231 CATAAAACAGCCTTGGAGCAAGG + Intergenic
993788781 5:92179635-92179657 AAGCAAATATCTTTGGAGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995420526 5:111961934-111961956 TAGCTAAAAGCTTTGGAAGAAGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
996838516 5:127821129-127821151 TAACAACCAGCTTTGGTGGAAGG + Intergenic
998078910 5:139258587-139258609 CAGGAACCAGCCTTGGTGGAGGG + Intronic
998102520 5:139446132-139446154 AAGAGAACAGGCTTGGAGGAGGG + Intergenic
999474674 5:151887682-151887704 TAGGAAACAGGTTTAGAGGAAGG + Intronic
1001439964 5:171735190-171735212 GAGCCAGCAGCCTTGGTGGATGG + Intergenic
1001809195 5:174614183-174614205 TTGAAAAGAGCTTTGGAGGAAGG - Intergenic
1001890015 5:175330994-175331016 TATCCAACAGCCTATGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1008036551 6:46751656-46751678 TAGGAAATAGCACTGGAGGATGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009601422 6:65805572-65805594 TAGTGAACAGCCTTGGAAAATGG - Intergenic
1009910021 6:69914274-69914296 CATCAACCAGCCTGGGAGGAAGG + Intronic
1011135477 6:84095294-84095316 AAGTGAACAGCCTTGGAAGATGG - Intergenic
1011546702 6:88489465-88489487 TAGGCCAAAGCCTTGGAGGAAGG - Intergenic
1012648689 6:101723526-101723548 TATCTTACAGCCATGGAGGAAGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1015301660 6:131659420-131659442 TATAAAACAGCCTCGGAGGAGGG - Intronic
1015330807 6:131976801-131976823 CAGTGAACAGCCTTGGAAGATGG + Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015794912 6:137001811-137001833 GAGCACACAGACTCGGAGGAGGG - Exonic
1015841583 6:137482792-137482814 TAGGAAATAGCCTTAGAAGATGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017636599 6:156450183-156450205 TAGCAAACAGTATTAGAGGAGGG - Intergenic
1017752511 6:157501229-157501251 TGATAAACAGACTTGGAGGAAGG - Intronic
1019716187 7:2540544-2540566 CAGCAGACAACTTTGGAGGAAGG - Intronic
1020399514 7:7759654-7759676 TAGGAAGGAGTCTTGGAGGAAGG + Intronic
1021565700 7:22014409-22014431 TAGCATCCAGCTTTGTAGGATGG + Intergenic
1022896697 7:34757422-34757444 TAGCACACAGCCTGGGATGCAGG + Intronic
1023169592 7:37377751-37377773 TAGCAAACAGCCTTGGAGGAGGG - Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025082402 7:55995226-55995248 AAGCAAGCAGCCATGGAAGAAGG + Intronic
1028213094 7:88099517-88099539 TAGGGAACAGCTTTGGAAGATGG - Intronic
1028420855 7:90631366-90631388 GAGCAGACCACCTTGGAGGAAGG + Intronic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1029042886 7:97596542-97596564 TAGCAACCAGCTCTGTAGGAGGG - Intergenic
1029261163 7:99303831-99303853 AAGCAAACAGCCTTGAGGGAAGG + Intergenic
1029313789 7:99692798-99692820 TAGCTAACAACCTTGGAAAAAGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031241171 7:119242304-119242326 TAGGAAACAGACTGGGAGCAAGG - Intergenic
1032475308 7:132207739-132207761 TTGGAAACAGCCTTGGACAAGGG - Intronic
1033566226 7:142580818-142580840 TAGCATTCACCTTTGGAGGAAGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1035253068 7:157609898-157609920 TGGCAAAGAGCCTTGGGAGATGG + Intronic
1037321098 8:17643995-17644017 TATAAAACATCTTTGGAGGATGG - Exonic
1037908321 8:22728359-22728381 TAGGAACCAGCCTTGGAAGAGGG - Intronic
1039749593 8:40464897-40464919 TAGCAAACAGCCTTTGAAGATGG + Intergenic
1041231415 8:55756843-55756865 CAGCAAGCAGCCTGGCAGGAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042339130 8:67660681-67660703 TAGCAAACAGGATTAGGGGAAGG - Intronic
1042952606 8:74217281-74217303 TAGGACACAGCTTTGGAGTATGG + Intergenic
1043233922 8:77836846-77836868 TAGCAAGCAACCTTGGAAGATGG + Intergenic
1044024368 8:87150210-87150232 TAGAAAACAGCTTTGTAGGATGG + Intronic
1044774668 8:95675812-95675834 TAGTAAACACCATTGGAAGAAGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046093912 8:109535729-109535751 TAACAAACTGACTTAGAGGAAGG + Intergenic
1046934738 8:119874786-119874808 TCCCAAACAGCCCTAGAGGAAGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048134104 8:131729278-131729300 TAGCAAACAGCTTTAGAAGATGG - Intergenic
1048819633 8:138369078-138369100 TAGTAAACAGGCTTGGAGAATGG - Intronic
1050211698 9:3266256-3266278 TTGCAAAAAGCCTTGAAGGTTGG - Exonic
1050474829 9:6030018-6030040 TAGTGAACAGCCTTGGAAGATGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055292056 9:74792461-74792483 TAGCAAAGAGGACTGGAGGAAGG - Intronic
1056214058 9:84391838-84391860 GAGCAAACAGCCCTGGAGTGTGG + Intergenic
1058560648 9:106225543-106225565 TAGCAAACTACATTGGAGGATGG + Intergenic
1058634486 9:107023320-107023342 TAGGACACAGGCTTGGAAGAGGG - Intergenic
1059025663 9:110626308-110626330 TTGCAAACAACCTCGCAGGAAGG - Intergenic
1061719468 9:132542789-132542811 TGTGAAACAGCCTTGGAGAAGGG + Intronic
1061805326 9:133134556-133134578 AAGCAAGCAGCCTTGGGGGCCGG - Intronic
1203613040 Un_KI270749v1:27276-27298 TGGCAAAAAGCCTTGGCGGCCGG - Intergenic
1188550412 X:31358136-31358158 TTACAAACAGCCTTGGGGGTGGG - Intronic
1190103063 X:47537634-47537656 AAGGAGACAGGCTTGGAGGAAGG - Intergenic
1191676488 X:63796995-63797017 ATGCAAACAGCCTTGAAAGAGGG + Intergenic
1191779428 X:64849770-64849792 TAGCAAGCACCCTAGGAGCATGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193698592 X:84738585-84738607 AAGTAAAGAGCCTTGGGGGAAGG - Intergenic
1194026434 X:88758042-88758064 TAGCAAACAACCTTGGAAGCTGG + Intergenic
1197017485 X:121644145-121644167 TAGCAAACAACTTTGGAAGATGG - Intergenic
1198605383 X:138331690-138331712 CAGCAATCAGCCTTGGTGAATGG + Intergenic