ID: 1023170342

View in Genome Browser
Species Human (GRCh38)
Location 7:37385340-37385362
Sequence CAGTGTGGCTGGAGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1387
Summary {0: 1, 1: 3, 2: 24, 3: 174, 4: 1185}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023170342_1023170355 9 Left 1023170342 7:37385340-37385362 CCCCCTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 24
3: 174
4: 1185
Right 1023170355 7:37385372-37385394 TTCCCCAGCAGGCCAAGCACAGG 0: 1
1: 0
2: 0
3: 18
4: 214
1023170342_1023170352 -2 Left 1023170342 7:37385340-37385362 CCCCCTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 24
3: 174
4: 1185
Right 1023170352 7:37385361-37385383 TGGCCCTGCTATTCCCCAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 249
1023170342_1023170356 10 Left 1023170342 7:37385340-37385362 CCCCCTCCCCTCCAGCCACACTG 0: 1
1: 3
2: 24
3: 174
4: 1185
Right 1023170356 7:37385373-37385395 TCCCCAGCAGGCCAAGCACAGGG 0: 1
1: 1
2: 0
3: 26
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023170342 Original CRISPR CAGTGTGGCTGGAGGGGAGG GGG (reversed) Intronic
900136871 1:1121509-1121531 CAGCCTGGCTGGGGAGGAGGTGG - Intergenic
900203751 1:1422275-1422297 CTGTGTGGCTTGGGGGGTGGTGG - Intergenic
900226263 1:1534924-1534946 CAGCTTGGGCGGAGGGGAGGGGG - Intergenic
900357198 1:2270679-2270701 CAGAGGGGCTGGAGGTGGGGCGG + Intronic
900376167 1:2355842-2355864 CAGTGTGGCTGGCCGGGCTGGGG + Intronic
900670532 1:3851067-3851089 GCCTGTGGCTGGAGGGCAGGAGG - Intronic
900686915 1:3954547-3954569 CAGAGGGGCGGGAGGAGAGGCGG - Intergenic
900742032 1:4336178-4336200 CAGGGAGGCTGGGGAGGAGGAGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900804370 1:4757529-4757551 GAGTGTGGCTGGAGGGGGTGAGG + Intronic
901013067 1:6211831-6211853 CAGTGTGGATGCAGGGGGGTGGG - Intronic
901133185 1:6975586-6975608 GAGCGTGGCAGGAGAGGAGGAGG + Intronic
901157089 1:7148420-7148442 GAGCGTGGCGGGGGGGGAGGGGG - Intronic
901440217 1:9273231-9273253 CAAGGCGGCTGGAGGGGTGGAGG + Intergenic
901523776 1:9806219-9806241 CAGGGGGGGTGGAGGGGGGGAGG + Intronic
901656289 1:10771689-10771711 CAGTTGGGCTGGTGAGGAGGAGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901926082 1:12567112-12567134 CAGGGTGGCAGGAGGGGAGCAGG - Intergenic
902097511 1:13958807-13958829 CAATGTGGCTGGAGCCAAGGCGG + Intergenic
902323166 1:15683089-15683111 CATTGGGGCTGAAGGTGAGGAGG + Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902440861 1:16429053-16429075 GAGAGGGCCTGGAGGGGAGGAGG - Intronic
902539711 1:17145540-17145562 CAGCGTGGCTGGAGAGAAGTGGG - Intergenic
902646789 1:17805117-17805139 CCGTGTGGCTGGAAGGGAGCTGG - Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
902985098 1:20150112-20150134 CAGTGTGGCATGGGGGGTGGGGG - Exonic
903009843 1:20321845-20321867 CAGAGTGGGTAGAGAGGAGGTGG + Intronic
903116745 1:21184560-21184582 CACTGTGGCTGGAAGGGCTGTGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903479079 1:23639956-23639978 GAGTGTGTCTGGGAGGGAGGAGG - Intronic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
903894830 1:26596440-26596462 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904441676 1:30535821-30535843 CTGTGTGGTTGGAGGGCAGGGGG + Intergenic
904824936 1:33268267-33268289 CAGAGTGGGTGGAGGGGACTTGG + Intronic
904880100 1:33690017-33690039 GAGTGTGGCTGGGGACGAGGAGG - Intronic
904944494 1:34189474-34189496 CAGTGTGGAAGCAAGGGAGGTGG - Intronic
905093047 1:35445100-35445122 CAGTGTGGCTGGGTGGGACCTGG + Intronic
905202453 1:36323546-36323568 CAGCGGGGCCGGAGGGGCGGCGG - Intronic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905674567 1:39816574-39816596 CAGGATGGCTGGAGGGGTTGGGG + Intergenic
905906051 1:41619142-41619164 TGGTGTGGCTGGAGGAGTGGGGG - Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906149295 1:43578232-43578254 GGGTGGGGCTGGCGGGGAGGGGG + Intronic
906514772 1:46432391-46432413 CAGGGTGGCAGGAGGGGCTGGGG + Intergenic
906568878 1:46819601-46819623 CTGGGAGGCTGGATGGGAGGGGG + Intergenic
906606256 1:47174460-47174482 CAGTGTGTGTGGAGGGGCGTGGG - Intergenic
906742107 1:48192890-48192912 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
907216600 1:52869937-52869959 CAGGGTGGCTGGCCGGGCGGGGG + Intronic
907294230 1:53439402-53439424 GAGTGCGCCTGGAGGGGCGGAGG - Intergenic
907304583 1:53506627-53506649 CTGTGTAGATGGAGGGGATGTGG + Exonic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
908432349 1:64071560-64071582 CTGTGTGGGTGGTGGGGCGGGGG - Intronic
909203673 1:72725712-72725734 CAATGTGGCTTTAGGGGAGATGG - Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
909826252 1:80130805-80130827 GAGCATAGCTGGAGGGGAGGAGG + Intergenic
909942533 1:81626919-81626941 GGGTGTGGGTGGAGGGTAGGTGG + Intronic
910214358 1:84828003-84828025 AAGAGGGGGTGGAGGGGAGGAGG + Intronic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910846793 1:91611914-91611936 CAGTGTGGATGGGGGCAAGGAGG + Intergenic
912480802 1:109980983-109981005 AAGTGTGGCTAGAGGGGTGGAGG - Intergenic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912668879 1:111607618-111607640 CAGGGTGGCTGGCCGGGCGGGGG + Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
913173731 1:116255480-116255502 AAGTGTGGCTGGGGGGTGGGGGG - Intergenic
913306817 1:117436754-117436776 CAGTGTGATTGGGGTGGAGGTGG + Intronic
913435342 1:118841715-118841737 CAGTGTGGCTGGTGTGCATGAGG - Intergenic
913701724 1:121380935-121380957 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
914042284 1:144061404-144061426 GAGTGTGGGTGGAGGGGGTGTGG - Intergenic
914135805 1:144899084-144899106 GAGTGTGGGTGGAGGGGGTGTGG + Intronic
914319460 1:146545078-146545100 CAGGGTGGCGGGGGTGGAGGTGG + Intergenic
914824592 1:151132203-151132225 CAGCTTGGCTGGAAGGGAGCGGG + Exonic
914829446 1:151159988-151160010 GAGAGGGTCTGGAGGGGAGGGGG + Exonic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915489246 1:156242306-156242328 CAATGCGGCCTGAGGGGAGGTGG - Intronic
916074703 1:161193661-161193683 CAGTGTTGCAGGAGCGGAAGCGG + Exonic
916091399 1:161310119-161310141 TAGTCTGGGTGGAGGGGTGGGGG + Intergenic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
916623162 1:166523986-166524008 CAGTGTGGCTGGTGCAGTGGAGG + Intergenic
916649645 1:166822809-166822831 CAGTGTGGCTAAAGGGGTAGTGG + Intergenic
916739098 1:167632505-167632527 CTGTGTGGCTTGGGGGGTGGAGG + Intronic
917029326 1:170671758-170671780 CAGGGTGGCAGGAGGGGAGTGGG + Intronic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
917701614 1:177587384-177587406 CTGTGTGGCTGGAAGGGAATTGG - Intergenic
918042883 1:180923894-180923916 CAGTGGGGCAGGATGGGAGCTGG - Intronic
918068739 1:181119577-181119599 CAGGGTGGCTGCAGGGGATCTGG + Intergenic
918107169 1:181425173-181425195 CTGTGTAGCTGGAGGGGCTGGGG + Intronic
918152504 1:181809998-181810020 CAGTGTGGCTATCTGGGAGGTGG + Intergenic
918239896 1:182611876-182611898 CAGAGTGGCGGCGGGGGAGGAGG + Intergenic
918687871 1:187442232-187442254 AATTGTGGCAGAAGGGGAGGGGG - Intergenic
919195927 1:194286316-194286338 CAATGTGGATGGAGTGGATGAGG - Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919417983 1:197335175-197335197 TAGTGTGACTGGAGTGAAGGAGG + Intronic
919506224 1:198400781-198400803 CAGTTTTCCTGGAGGGGGGGTGG + Intergenic
919880566 1:201898001-201898023 CAGTGGGGCTGGGGTGGATGTGG + Exonic
920185229 1:204155283-204155305 CAGTGTGGCTAGGGGAGAGATGG - Intronic
920222903 1:204417042-204417064 GAGTGTGGGGGGAGGGGAGAGGG + Intergenic
920433008 1:205930684-205930706 TGGTGTGGCTGGAGGGTAGAGGG - Intronic
920489148 1:206399655-206399677 GAGTGTGGGTGGAGGGGGTGTGG - Intronic
920711865 1:208302893-208302915 CAGTGGGGCTGGAGAGGTAGTGG + Intergenic
921096246 1:211889526-211889548 CAGTTTGCCGGGAGGGGCGGAGG + Intergenic
921158902 1:212459013-212459035 GGGTGTGGCTGAGGGGGAGGAGG + Intergenic
921291501 1:213662114-213662136 AAGTGTGTCTCGAGGGGAGTGGG - Intergenic
921629040 1:217412043-217412065 CTGTGTGACAGGAGTGGAGGTGG + Intergenic
921819447 1:219600599-219600621 CAGCAAGGCTGGAGGGGAGTGGG + Intergenic
922006060 1:221531846-221531868 AAGTGTGTATGAAGGGGAGGGGG + Intergenic
922162377 1:223088207-223088229 GAGTGTGGAGTGAGGGGAGGAGG - Intergenic
922350304 1:224729758-224729780 CTGTGTGGCTGGATTGGAGGTGG + Intronic
922877574 1:228951921-228951943 CAGTGTGGCAGTATGAGAGGCGG + Intergenic
922896660 1:229106053-229106075 CAGTGTGGCTCAAGGACAGGAGG + Intergenic
923051653 1:230394628-230394650 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923051685 1:230394741-230394763 GAGCGTGAGTGGAGGGGAGGAGG - Intronic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923229497 1:231971550-231971572 CAGGGTGGCTGGAGAGGAAGGGG - Intronic
923271255 1:232357161-232357183 CGGGGTGGCTGCAGTGGAGGTGG + Intergenic
923333352 1:232946177-232946199 CAGTGTGGCCGGAGCAGAGTAGG - Intergenic
923566851 1:235082922-235082944 GGGGGTGGCTGGTGGGGAGGAGG - Intergenic
924177359 1:241405723-241405745 CAGTGTGGCTGATGAGAAGGGGG + Intergenic
924947310 1:248855336-248855358 CTGTGTGGCTGCTGGGGTGGGGG - Intronic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1063487162 10:6430686-6430708 GAGTGGGGCTGGTGGGGAGTTGG + Intronic
1063969801 10:11373727-11373749 CACCCTGGCAGGAGGGGAGGCGG - Intergenic
1064103818 10:12484816-12484838 CAGTGACTCTGGGGGGGAGGGGG + Intronic
1064227575 10:13500892-13500914 CAGTTACGCTGCAGGGGAGGTGG - Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065001971 10:21345526-21345548 CATTGGGGCTGGAGGGGGAGGGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066952942 10:42138389-42138411 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
1066981682 10:42422463-42422485 CAGTGTAGCTGAAGGAGAGATGG - Intergenic
1067064085 10:43093913-43093935 CACAGTGGCAGGTGGGGAGGCGG + Intronic
1067146057 10:43694732-43694754 CAGAGGGGCTGGAGGAGGGGAGG + Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067325227 10:45260160-45260182 CAGGGTGGCTGGCCGGGTGGGGG - Intergenic
1067850549 10:49751302-49751324 GAGTGTGGCAGGAGGGTAGTGGG - Intronic
1067903118 10:50262819-50262841 CAGTGAGGCTGGGGGAGGGGCGG + Intergenic
1068007245 10:51406154-51406176 CAGTGGGGCTGGAGTGGCTGCGG - Intronic
1068131904 10:52905671-52905693 GTGTGTGGGTCGAGGGGAGGAGG + Intergenic
1068962063 10:62877037-62877059 CAGGGAGGCTGCAGGGGAAGGGG - Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069729416 10:70601206-70601228 AACTGTGGGTGGTGGGGAGGGGG + Intronic
1069859404 10:71461139-71461161 CTGTGTGGCTGCAGGGGTGGAGG - Intronic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1070662925 10:78320377-78320399 AAATGTGGCTGGAAGGGAGGTGG + Intergenic
1070685528 10:78477603-78477625 CAGAGTGGCTGGAGCGTTGGGGG - Intergenic
1070939263 10:80328915-80328937 TACTGTGGCTGGAGGGAAGGAGG - Intergenic
1070941415 10:80351488-80351510 CAGTGTGGATGGAGTGGTGGGGG - Intronic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071733960 10:88277313-88277335 CAGGGTGCCTGCCGGGGAGGTGG + Intronic
1071816333 10:89235502-89235524 CAGTGTGGGTGGAAGCCAGGAGG + Intronic
1072050864 10:91701667-91701689 GAGCATGGCTGGAGGGCAGGTGG + Intergenic
1072210948 10:93246670-93246692 CAGTGTGTCTGGGGCAGAGGTGG + Intergenic
1072390200 10:94976604-94976626 TAGTGTGGGGGGAGGGGAGGTGG - Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072816615 10:98515906-98515928 CAGTGGAGCTGGTGGGGAGAGGG - Intronic
1073000054 10:100278123-100278145 CGGGGTGGCTGGCCGGGAGGGGG - Intronic
1073176401 10:101560074-101560096 CTGTGGGGCTGCAGGGAAGGGGG - Intergenic
1074532263 10:114305697-114305719 GAGCGGGGCTGGAGGGGACGGGG + Intronic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074851132 10:117440494-117440516 GGGTGTGGCTGGAGGGCTGGAGG + Intergenic
1074861649 10:117514576-117514598 AAGTGGGGCGGGTGGGGAGGGGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075518026 10:123125016-123125038 GAGTGAGGCTGGATGGGAGCAGG - Intergenic
1075650999 10:124128358-124128380 CAGAGCGGCTGGAGGGGGTGGGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076064974 10:127441689-127441711 CAGTGGGGGTGGTGGGGGGGTGG - Intronic
1076175240 10:128363140-128363162 CAGTGCAGCTGGCAGGGAGGTGG + Intergenic
1076200636 10:128554920-128554942 ATGTGTGGCTGGTGGGGTGGGGG + Intergenic
1076473473 10:130736278-130736300 CAGGATCGCTGGAGGAGAGGAGG + Intergenic
1077133474 11:986762-986784 CTGTGTGGAGGGAGGGGAAGTGG - Intronic
1077136837 11:1004005-1004027 CAGAGGGGGTGGCGGGGAGGTGG + Intronic
1077311631 11:1891382-1891404 CAGAGCTGCTGGAGGGGTGGGGG + Intronic
1077421808 11:2454214-2454236 AAGGGTGGCGGGGGGGGAGGTGG + Intronic
1077498471 11:2898078-2898100 GACTGTGGCTGGAGGGGAAGTGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077603016 11:3586908-3586930 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1077783207 11:5354633-5354655 CAGTGTGGCTGGTGGCGTGGAGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078064728 11:8070949-8070971 CAGGGGGGCTGGAGGGAAAGGGG + Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078372258 11:10758279-10758301 GAGTGGGGCTCAAGGGGAGGGGG + Intronic
1078759480 11:14240739-14240761 CAATGTGGGTGGAGTGAAGGTGG - Intronic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080411394 11:32028629-32028651 CAGTGTGGCTGGAAACAAGGAGG - Intronic
1080886885 11:36376199-36376221 GAGAGTTGCTGAAGGGGAGGAGG + Intronic
1081549183 11:44096210-44096232 CCCTGTGGCTGGCGGGAAGGTGG - Exonic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1082204380 11:49414668-49414690 CAGTGTGGCTTGTGGGTAGGAGG - Intergenic
1082210785 11:49498653-49498675 ATGTGTGGCTGGAGGTGAGCTGG - Intergenic
1082269781 11:50157397-50157419 TGGTGTGGCTGGAGGGGGGAGGG + Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083631284 11:64096820-64096842 CAGTGTGCTTGGAGGGTATGGGG - Intronic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083681343 11:64353239-64353261 AGGTGTGGCTGGAGGGCCGGTGG + Exonic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083738507 11:64695170-64695192 CAGTGGGGCTGGGGGCCAGGAGG - Intronic
1083764855 11:64836812-64836834 CAGGGCCTCTGGAGGGGAGGTGG + Exonic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084014242 11:66369281-66369303 CAGTAGGGCTGGGGGGCAGGGGG + Intronic
1084258896 11:67961446-67961468 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1084353982 11:68624604-68624626 CAGGGTGTGAGGAGGGGAGGTGG - Intergenic
1084370745 11:68741167-68741189 AAGAGGGGCTGGTGGGGAGGAGG - Intronic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084592677 11:70099617-70099639 CACTGAGGCTGGAGAGGTGGAGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084730699 11:71071720-71071742 CAGAGTGGCTGGAGGGGCCTGGG + Intronic
1084813851 11:71633732-71633754 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1084908136 11:72364698-72364720 CTATGTGGCAGGAAGGGAGGAGG - Intronic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085038753 11:73314694-73314716 CTGTGTGCCGGGAGGTGAGGAGG + Intronic
1085278298 11:75314060-75314082 CAGTGTGGCTGGAGGGTGTGTGG - Intronic
1085303959 11:75474678-75474700 CAGCGTGGATGGAGAGGAAGGGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085519915 11:77131693-77131715 CAGAGGGGCAGGAGAGGAGGGGG - Intronic
1085882255 11:80481353-80481375 TAGGGTGACTGGAGGGGAGCTGG + Intergenic
1086017283 11:82182204-82182226 CGGGGTGGCTGGCCGGGAGGGGG - Intergenic
1086049910 11:82577564-82577586 AAGCGGGGCTGGAGGGGAGGGGG + Intergenic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086638854 11:89126136-89126158 ATGTGTGGCTGGAGGTGAGCTGG + Intergenic
1086650703 11:89285863-89285885 CAGTGTGGCTTATGGGTAGGAGG + Intronic
1086742210 11:90381777-90381799 TAGTGTGGCAGGATGGGTGGTGG - Intergenic
1087630212 11:100641473-100641495 CAGTGTGGCGGGTGGCGGGGGGG - Intergenic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088724978 11:112626386-112626408 GACTGTGGTTGGTGGGGAGGTGG + Intergenic
1088977689 11:114830351-114830373 CACTTTGTCTGGAGGGGAGGAGG + Intergenic
1089162012 11:116445605-116445627 CAGACAGGCTGGAGGGGAAGGGG - Intergenic
1089388169 11:118081384-118081406 CAGAGTGGCAGGCTGGGAGGTGG - Intronic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089495721 11:118907856-118907878 AATTAGGGCTGGAGGGGAGGGGG + Intronic
1089624257 11:119741389-119741411 CAGGGTACCTGGAGGCGAGGTGG - Intergenic
1089660180 11:119980617-119980639 GGGTGTGGCTGGAGGAGCGGAGG + Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089744202 11:120605718-120605740 CAGCGTGGCTGAAGGGCAGGGGG - Intronic
1089778769 11:120858177-120858199 CAGTGTGGCTGGGGCGGGGTTGG + Intronic
1090252078 11:125258743-125258765 CAGGGCGGCAGCAGGGGAGGGGG - Intronic
1090361090 11:126173195-126173217 CCGTGTGGCTTGAGGGGAAAGGG + Intergenic
1090421455 11:126578266-126578288 CAGAGAAGCTGGAGGGGAGAGGG - Intronic
1090429134 11:126631469-126631491 AAGTGTGGCTTATGGGGAGGAGG - Intronic
1090469711 11:126969365-126969387 CAGTGTGGCAGGTGTGAAGGTGG + Intronic
1090547687 11:127783165-127783187 CAGTGGGGAGGGTGGGGAGGGGG + Intergenic
1091309150 11:134560539-134560561 CAGTGAGGCTGGGAGGGTGGTGG - Intergenic
1091595701 12:1877714-1877736 CAGTGTGGCTGTTGGGACGGCGG - Intronic
1091671652 12:2456516-2456538 CAGTGTGGCTGGAGCAGGGCAGG - Intronic
1091814743 12:3429132-3429154 CACTGTGGGTGGGGCGGAGGGGG + Intronic
1092111285 12:5966594-5966616 CACAGTGGCCAGAGGGGAGGGGG - Intronic
1092209554 12:6637521-6637543 GAGTGTGGCTGGAGCCCAGGAGG + Intergenic
1092244670 12:6856898-6856920 GAGAGTGGCTGGAGGAGGGGAGG - Intronic
1092430222 12:8402454-8402476 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1094047108 12:26179263-26179285 TAGTGTGGCTGGACAGGAGAAGG + Intronic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094573404 12:31662050-31662072 CAGTGTCCCTGGAGAGGAGCTGG + Exonic
1095130964 12:38541763-38541785 CAGAGGGGCCAGAGGGGAGGTGG + Intergenic
1095554503 12:43483955-43483977 CTGTGTGGCTGGAATGGAAGAGG - Intronic
1096182299 12:49557603-49557625 CAGGGTGCCATGAGGGGAGGAGG - Exonic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1096567964 12:52496830-52496852 CAGTGTGGAGGGAGGACAGGAGG + Intergenic
1096580242 12:52580423-52580445 TGAAGTGGCTGGAGGGGAGGTGG - Intergenic
1096648823 12:53052222-53052244 CAGGGTGGGTGGAGGTGAGGAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1096951608 12:55479231-55479253 CAGGGTGGCTGGCCGGGCGGGGG + Intergenic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1097844316 12:64351324-64351346 AAATGTGTCTGCAGGGGAGGGGG - Intronic
1098461431 12:70736982-70737004 CAGTGGGGCAGGAGAGGATGGGG - Intronic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099324022 12:81189069-81189091 CAGGGTGGTTGGAGGGGGAGAGG - Intronic
1099338516 12:81396497-81396519 CAGTGTGGCTGGGGTGGATTTGG + Intronic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1100100243 12:91094739-91094761 CAGTGTGTTTGGAGAGGAGTGGG + Intergenic
1100253783 12:92860414-92860436 CAGTGTTTTTGGCGGGGAGGAGG + Intronic
1100348647 12:93756834-93756856 CAGTGTGGATGAAGGCTAGGAGG - Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1101623694 12:106417309-106417331 CAGTGTGGCTGGAGTGAGTGAGG + Intronic
1101643088 12:106602563-106602585 CAGAGTGACTGACGGGGAGGTGG - Intronic
1101962732 12:109262039-109262061 GACTGTGGCTGGAGAGCAGGAGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102565408 12:113794378-113794400 CACTGTGCATGGAGAGGAGGAGG - Intergenic
1102579777 12:113879030-113879052 CAGTGTGGCTGCAGCTGTGGTGG + Intronic
1102670935 12:114618212-114618234 AAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103359109 12:120343009-120343031 CCGAGTCGCTGCAGGGGAGGGGG + Exonic
1103386131 12:120534182-120534204 CAGTGGGGTTGGGGCGGAGGTGG + Intronic
1103565149 12:121811707-121811729 CCCTGTGGGCGGAGGGGAGGAGG + Intronic
1103583483 12:121933932-121933954 CAGAGTGGCTGGGGGAGGGGAGG + Intronic
1103719034 12:122963760-122963782 CGGTGTGCCTGGAGGTGTGGGGG - Intronic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103954358 12:124567940-124567962 TACTGGGGCTGGAGAGGAGGAGG - Intergenic
1103963156 12:124621973-124621995 CAGAGTGGCTGGACTGGGGGTGG - Intergenic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1103975592 12:124700750-124700772 CATTGTGGCAGCTGGGGAGGGGG + Intergenic
1104001477 12:124863404-124863426 CGGTGAGGGTGGTGGGGAGGCGG + Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104638187 12:130450792-130450814 TGGTGTGGCTGGAGAGGGGGCGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104833876 12:131774111-131774133 CAGTGTGGCTGCGGGGCACGGGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984132 12:132587143-132587165 CAGTGCGGCTGGAGGGTGGACGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105367912 13:19779695-19779717 CAGGGTGGCTGGCCGGGCGGGGG - Intronic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105787055 13:23759863-23759885 CACAGTGGCTGCAGGGTAGGGGG + Intronic
1106346659 13:28886099-28886121 CAGAGTTGCTGGTGGGGAGAGGG + Intronic
1106602128 13:31197177-31197199 TAGTGTGGCGGGTGGGGAGAGGG - Intergenic
1106603747 13:31208968-31208990 CAGGGTCCCTTGAGGGGAGGGGG - Intronic
1106778652 13:33033476-33033498 CAGTGTGGCTGGATGGCGTGGGG - Intronic
1106907878 13:34427909-34427931 CACTGGGGCTGGGGAGGAGGTGG + Intergenic
1107420328 13:40240107-40240129 CAGTGTGGAGGGAGGGCAGGGGG - Intergenic
1108020993 13:46127564-46127586 CAATGGGGCTGGGTGGGAGGCGG - Exonic
1108450583 13:50558805-50558827 GAGTGTGGATTGAAGGGAGGTGG + Intronic
1108482838 13:50892287-50892309 CTATGTGGCTGGAGGGGTGGGGG - Intergenic
1109442628 13:62394909-62394931 CACTGTGGGTGGTGGGAAGGAGG + Intergenic
1110289165 13:73784591-73784613 CAGAGATGCTGGAGTGGAGGAGG - Intronic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1113049094 13:106188641-106188663 CAGTCAGGAAGGAGGGGAGGAGG - Intergenic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113720628 13:112553302-112553324 CAGCGTAGCTGGTGGGTAGGAGG - Intronic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1113787761 13:113011605-113011627 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787857 13:113012096-113012118 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787873 13:113012177-113012199 CAGTGTGGATGGTGGACAGGCGG + Intronic
1113787895 13:113012300-113012322 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113787968 13:113012689-113012711 CAGTGTGGATGGTGGACAGGTGG + Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1113868834 13:113545960-113545982 CAGTGGGGCTGGAGATGAAGGGG + Intronic
1114069063 14:19094044-19094066 GAGTGTGGATGGGGGGGGGGTGG + Intergenic
1114165319 14:20213032-20213054 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
1114405693 14:22453927-22453949 GTGTGTGGCTGGAGGAGGGGAGG + Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114450322 14:22821283-22821305 CAGTGAAGCTGGAGTGGAGTGGG - Intronic
1114474170 14:22982290-22982312 CAGGGTGCCAGGCGGGGAGGGGG - Exonic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115731180 14:36271503-36271525 CACTGGGGCTTGAGGGGAGGGGG + Intergenic
1117422329 14:55559059-55559081 CAGAGTCCCTGGAGGGGAAGAGG - Intronic
1117474332 14:56078617-56078639 AAGTTTGGATGGATGGGAGGAGG - Intergenic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1118351701 14:64976810-64976832 CAGTGTGGCTGGGGTGGGGATGG - Intronic
1118389189 14:65282068-65282090 CAGGCTGGCTGGAGGGGGAGTGG - Intergenic
1118793313 14:69116010-69116032 TGGGGTGGGTGGAGGGGAGGAGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119580875 14:75779572-75779594 CAGTGAGGCTGAACTGGAGGAGG + Exonic
1119722017 14:76898110-76898132 CAGGGCGGCTGGCGGGGCGGGGG + Intergenic
1119768372 14:77205114-77205136 CCCTGTGGCAGGAGGGAAGGTGG + Intronic
1119986872 14:79148191-79148213 AAGAGTGACTGGATGGGAGGAGG + Intronic
1120411266 14:84159079-84159101 AAGTATGGCAGGCGGGGAGGTGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121007351 14:90498927-90498949 GAATGTGGCTGGTGTGGAGGAGG + Intergenic
1121014620 14:90540949-90540971 AAGTGGGGCAGGAGGGGTGGTGG + Exonic
1121230672 14:92355277-92355299 GAGTGTGGCTGGAGCGGGGTGGG + Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121327732 14:93031256-93031278 CAGCGTGGGTGCAGGGGACGGGG + Intronic
1121333044 14:93059931-93059953 CAGTGTGGATGGGGGTGAGCAGG - Intronic
1121567754 14:94923501-94923523 CAGTGAAGGTGGAGGGGGGGAGG - Intergenic
1121632583 14:95432019-95432041 CAGGGTGCCTGGAGGGTTGGTGG - Intronic
1122005156 14:98697392-98697414 CAGAGAGGCAGGAGTGGAGGTGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122132771 14:99614771-99614793 TAGTGACGCTGGAGGGGACGAGG + Intergenic
1122267829 14:100554886-100554908 CAGCGTGCCTGGCGGGAAGGTGG - Intronic
1122339790 14:101020464-101020486 CAGTGTGACTGGATGGGGTGTGG - Intergenic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1122412952 14:101535235-101535257 CAGTGGGGATGGAGGGGACCCGG - Intergenic
1122745786 14:103896568-103896590 CCATGTGGCTGGAAGGAAGGCGG - Intergenic
1122847152 14:104506281-104506303 CAGGGAGGCAGGAGAGGAGGAGG - Intronic
1122847831 14:104510415-104510437 CCCTGGGGCAGGAGGGGAGGGGG - Intronic
1122874288 14:104656384-104656406 CATGGTGGCGGCAGGGGAGGTGG + Intergenic
1122985016 14:105208055-105208077 CACAATGGCTGGAGGGGAGGTGG - Intergenic
1123016346 14:105377368-105377390 CTCTGTGGCTGGATGGGAGGAGG + Intronic
1123097615 14:105773869-105773891 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123097632 14:105773948-105773970 CAGTGTAGCTGCAGGTGAGCAGG - Intergenic
1123115981 14:105894247-105894269 CGGTGTAGCTGGCGGGGAAGGGG + Intergenic
1123126805 14:105952697-105952719 GAGTGTGGCTTGAGGCCAGGAGG - Intergenic
1123185259 14:106510613-106510635 CAGGATGGCTGTAGTGGAGGAGG + Intergenic
1123631196 15:22260833-22260855 CCTTGGGGCTGGGGGGGAGGGGG - Intergenic
1123707340 15:22959786-22959808 CTGAGAGGCTGGTGGGGAGGGGG - Intronic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1125919806 15:43518639-43518661 CAGTGAGGCAGAAGGGGAGGGGG - Intronic
1125971240 15:43913436-43913458 CACTGTGGCAGAAAGGGAGGGGG - Intronic
1126425553 15:48523701-48523723 AAGGGTGGCTGGGGGGGGGGGGG + Intronic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1126842366 15:52729711-52729733 CTTTGGGGCTGGAAGGGAGGAGG - Intergenic
1126965250 15:54044545-54044567 CAATGTGGCAGGCGGGGTGGGGG + Intronic
1127077626 15:55343439-55343461 TTGTGTGCCTGGAGGGGACGGGG + Intronic
1127154421 15:56110604-56110626 CAGGGTGGCTGGCCGGGTGGGGG - Intronic
1127154499 15:56110781-56110803 CAGGGTGGCTGGCCGGGTGGGGG - Intronic
1127154602 15:56111036-56111058 CAGGGTGGCTGGCCGGGTGGGGG - Intronic
1127172907 15:56322194-56322216 CAGTGTGGATAGAGAGGAGTAGG + Intronic
1127842138 15:62840825-62840847 CGGTGAGGCATGAGGGGAGGCGG - Exonic
1128143166 15:65316474-65316496 CGGTGGGGCGGGAGGGGTGGCGG - Intergenic
1128161389 15:65424925-65424947 TCTTGAGGCTGGAGGGGAGGAGG - Intergenic
1128278013 15:66370467-66370489 GTGGGGGGCTGGAGGGGAGGAGG + Intronic
1128352222 15:66898764-66898786 CATGGTGGCTGAAAGGGAGGTGG + Intergenic
1128506489 15:68276814-68276836 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1128510756 15:68312752-68312774 GGGTGAGGCTGGAGGGGAGCCGG - Exonic
1128525004 15:68406356-68406378 CAGTATGGCTGGAGGAGAGGAGG - Intronic
1128566800 15:68706134-68706156 CAGGCTGGCTGGTGGAGAGGAGG - Intronic
1128776629 15:70325250-70325272 CAGCCTGACTGGAGAGGAGGTGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1128988352 15:72237574-72237596 CATTCTGGCTGGTGGGGAGAGGG - Intergenic
1129115893 15:73365258-73365280 GAGTGTGTCTGGAGGAGCGGTGG - Intronic
1129272100 15:74424468-74424490 CAGGGTGGCTGGAGGTTTGGTGG - Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129675405 15:77630577-77630599 CTGTGTGACTGGGAGGGAGGTGG - Intronic
1129692348 15:77721039-77721061 CATTGAGGCAGGAGGGGCGGTGG - Intronic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1130897818 15:88184292-88184314 CTATGTGTCTGCAGGGGAGGAGG + Exonic
1130987168 15:88852091-88852113 CAGTGTGCCTGGTGGGGCGGGGG + Intronic
1131076388 15:89497709-89497731 AAGAGGGGCTGGAGGGGAGCAGG + Intergenic
1131167689 15:90154351-90154373 CAGTGTAGCTTGAGGGCAGATGG - Intergenic
1131527242 15:93162269-93162291 GAGTGTGTCTGGTGGGGAGGGGG - Intergenic
1132219265 15:100093171-100093193 CAGTGTGGCACCAGGGGAAGTGG - Intronic
1132311593 15:100861721-100861743 CTGGGAGGCTGGAGGGGAAGTGG - Intergenic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132672728 16:1108317-1108339 CAGAGTGGCCAGTGGGGAGGTGG + Intergenic
1132715219 16:1286675-1286697 CAGTGTGGTTGGAAGGAAAGCGG + Intergenic
1132723103 16:1326499-1326521 CAGAGTCGCTGGAGGGGTGGTGG - Exonic
1132767867 16:1543691-1543713 CAGTCATGCAGGAGGGGAGGAGG - Intronic
1132990760 16:2791685-2791707 GAGTGGTGCTGAAGGGGAGGTGG - Intergenic
1133039251 16:3051421-3051443 TAGTGTGGCTGGGGGTGGGGTGG - Intronic
1133353301 16:5117299-5117321 CAGGCTGCCTGGAAGGGAGGCGG + Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133837130 16:9377343-9377365 CAGTGTGGCTGGTCTGGAAGGGG - Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134066024 16:11228887-11228909 CAGTGTGCCTGGCGCGGAGCAGG - Intergenic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135490659 16:22906518-22906540 CCCTGTGGCTGGTGGGGAAGGGG - Intronic
1135828857 16:25755121-25755143 ATGTGTGGGTGGAGGGGTGGAGG - Intronic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1136012465 16:27372696-27372718 CACTGTGGCTGGGGGAGAGAAGG - Intergenic
1136036857 16:27547109-27547131 CGGTGTGGCTGGAGAGGTAGAGG - Intronic
1136054789 16:27680319-27680341 CAGCATGGCTGCAGGGGAGACGG + Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136608603 16:31352897-31352919 CAGTGAGGCAGGAGATGAGGAGG - Intergenic
1136918907 16:34245710-34245732 CAGGGTGGCTGGCCGGGCGGAGG + Intergenic
1137501507 16:49014985-49015007 CAGTGTGGCCGGAGCAGAGTGGG + Intergenic
1137513161 16:49119004-49119026 CAGAGTGGTGGGAGGGCAGGAGG - Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1138151176 16:54658553-54658575 CAGTGTGGCTGGAAGGTTAGAGG + Intergenic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1138537671 16:57668420-57668442 CAGCGTGGCAGGAGGGGATGAGG - Intronic
1138555625 16:57769743-57769765 CTGTGAGGCGGGAGGGGATGAGG + Intronic
1138603455 16:58071676-58071698 GAGTGTGTCTGGAGAGGATGAGG - Intergenic
1138657926 16:58501391-58501413 CACTGCGGCAGCAGGGGAGGGGG - Intronic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1139578555 16:67857868-67857890 AGGTGTGGGTGGAGGGGAAGTGG + Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1139936789 16:70577376-70577398 CAGAGTGGGTGGAGGTGATGGGG - Exonic
1139964285 16:70736989-70737011 CAGAGTGGCTGGGGGCGATGGGG - Intronic
1140014063 16:71165003-71165025 CAGGGTGGCGGGGGTGGAGGTGG - Intronic
1140236891 16:73167315-73167337 ACGTGTGGCTGGGAGGGAGGGGG - Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1140487434 16:75304816-75304838 CACTGCGGGTGGAGGGAAGGCGG - Intronic
1141003566 16:80331152-80331174 TAGGGATGCTGGAGGGGAGGAGG - Intergenic
1141057343 16:80830856-80830878 GAGTGTGGCTGCAGGACAGGAGG - Intergenic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1141602390 16:85134632-85134654 GGGTGTGGCGGGAAGGGAGGAGG - Intergenic
1141784974 16:86193413-86193435 CAGGGTGGCTGAAAGGGTGGTGG + Intergenic
1141884268 16:86880966-86880988 CCGTGTGGCTGGTTGGGGGGTGG + Intergenic
1142088323 16:88196534-88196556 TGGAGTGGCTGGAGGGGAAGTGG - Intergenic
1142131447 16:88433299-88433321 CACTGTGGAAGGAGGGAAGGTGG + Exonic
1142211044 16:88808574-88808596 GAGTGTGGCTGGGGGTGAAGGGG + Exonic
1142434075 16:90046305-90046327 CCTTCTGGCTGGAAGGGAGGGGG + Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142509365 17:384826-384848 GGGGGCGGCTGGAGGGGAGGGGG + Intronic
1142604638 17:1074688-1074710 CAGGGAGGCTGGAGGCCAGGAGG + Intronic
1142621160 17:1166478-1166500 CAGTGTGGCCGGAGGCCCGGGGG + Intronic
1142759431 17:2034548-2034570 GAGGGTGGCAGCAGGGGAGGGGG - Intronic
1142759536 17:2034773-2034795 GAGTGGGGGAGGAGGGGAGGGGG - Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143045757 17:4078003-4078025 CAGTGGGGCCCCAGGGGAGGTGG - Exonic
1143092228 17:4455674-4455696 CAGTGTCGTGGGAGGGGAGAGGG - Intronic
1143580419 17:7822344-7822366 CTGCGTGGCTGGAGTGGAGTGGG - Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1143965735 17:10755538-10755560 CAGGGTTGCGGGATGGGAGGTGG - Intergenic
1144339059 17:14297775-14297797 GAGGGTGGCTGTTGGGGAGGCGG + Intergenic
1144422632 17:15112011-15112033 CACTGTAGCAGGAGGGGAGTGGG + Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144513136 17:15894674-15894696 CAGATTGGTTGTAGGGGAGGAGG + Intergenic
1144517511 17:15928857-15928879 CAGAGTGGCTGGAGGTCTGGAGG + Intergenic
1144537487 17:16105012-16105034 CAGTGTGGTTGGAGCAGAGGGGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144944701 17:18963942-18963964 CAGTGTGGCTGGAGCGGGTGGGG - Intronic
1144996924 17:19276111-19276133 AGGTGTGGCTGGTGGGGTGGTGG + Intronic
1145125760 17:20298687-20298709 CAGATTGGTTGTAGGGGAGGAGG + Intronic
1145280507 17:21464000-21464022 CAGTCTGGCAGGCGGGGAGGCGG - Intergenic
1145779604 17:27553529-27553551 AAGTGAGGCTGGAGTGGATGGGG + Intronic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1145844148 17:28023105-28023127 CGGTGTGGTTGGAGAGGATGTGG + Intergenic
1145875624 17:28316921-28316943 GGGTTTGGCTGGAGAGGAGGAGG - Intergenic
1145978797 17:28999421-28999443 CAGTCTGGCAGGAAGGGAGGGGG - Intronic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146056283 17:29582900-29582922 GAGTGGGGCTGGAGGGGTGGTGG - Intronic
1146259720 17:31413483-31413505 CTCAGTGGCTGGAGGGCAGGGGG - Intronic
1146371770 17:32268938-32268960 CAGTGAGGATGGACGGGAAGAGG + Intronic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1146832314 17:36080928-36080950 CTGTGTGACTGGAGGGGCTGAGG + Intergenic
1146846798 17:36187251-36187273 CTGTGTGACTGGAGGGGCTGAGG + Intronic
1147169309 17:38608869-38608891 CAGTGTATTTGGTGGGGAGGGGG + Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147317480 17:39627703-39627725 CAGTGAGGCTGGGGGTGCGGGGG + Intronic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147461965 17:40578443-40578465 CATTGTTGCTGGAGAGGATGTGG + Intergenic
1147584126 17:41643252-41643274 CTGTGTGGCTGGGGTGGAGTGGG + Intergenic
1147620835 17:41865557-41865579 CAGAGCTGCTGGAGGCGAGGCGG - Intergenic
1147899218 17:43773044-43773066 CAGTACAGCTGGAGTGGAGGAGG + Intronic
1147907777 17:43833703-43833725 AAGTCAGGCTGGAGAGGAGGGGG + Intergenic
1147939890 17:44038956-44038978 CAGTGTGGGGTGGGGGGAGGCGG + Intronic
1148205774 17:45778982-45779004 CTGGGGGGCTGCAGGGGAGGGGG - Intergenic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1149424964 17:56546007-56546029 GAGGGTGGGGGGAGGGGAGGAGG + Intergenic
1149868682 17:60164336-60164358 CAGACTGGAGGGAGGGGAGGAGG - Intronic
1150056454 17:62021343-62021365 CAGGGTGGCTGGCCGGGCGGGGG + Intronic
1150472513 17:65449137-65449159 AACTTTGGCAGGAGGGGAGGAGG + Intergenic
1150627461 17:66850697-66850719 CATTATGGATGGAGGAGAGGAGG - Intronic
1150676076 17:67246222-67246244 CAGTGTGGCCGGCGGGCTGGGGG - Intergenic
1150806174 17:68320759-68320781 CTGGGTGGCTGGAAGGGCGGGGG + Intronic
1150919742 17:69470263-69470285 GATTATGGCTGGAGGGGATGTGG + Intronic
1151210821 17:72542630-72542652 AAGTGGGGCTGGACGGTAGGAGG - Intergenic
1151242343 17:72767969-72767991 CAGTTTGGGTGAAGGGGTGGGGG + Intronic
1151362072 17:73595186-73595208 GAGTGTGGGTGAAGGTGAGGAGG + Intronic
1151480953 17:74369813-74369835 CAGTGTGGCTTCAGGGGAACAGG + Intronic
1151618758 17:75232067-75232089 CAGTGTGGCTCGTGAGGAGGAGG - Intronic
1151677409 17:75605769-75605791 TGGTTTGGCTGGAAGGGAGGAGG + Intergenic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152584056 17:81181360-81181382 CAGCGGGGCTGGACGGGCGGGGG - Intergenic
1152641838 17:81452516-81452538 CAGTGTGTGTGGATGGTAGGAGG + Intronic
1152655561 17:81517762-81517784 GAGTGGGACTGGAGGGGGGGGGG - Intronic
1152793979 17:82297958-82297980 CAGCGAGGCTGGGGAGGAGGAGG + Intergenic
1152925212 17:83084545-83084567 CAGGGTGGCTGGAGGTGCTGGGG - Intronic
1153094358 18:1383661-1383683 CAATGCAGCTGGAGGGGAGCAGG - Intergenic
1153280708 18:3411738-3411760 CAGCGTGGCTGGGGCGGAGTAGG - Intronic
1153827904 18:8893662-8893684 CTGTGTGGCTGGAGGAGAGGAGG + Intergenic
1153988216 18:10372135-10372157 CTGTGAGGCTGGATGGGCGGTGG - Intergenic
1154278541 18:12980670-12980692 CAGGGTGGCTGGCAGGGCGGGGG + Intronic
1154935939 18:21056792-21056814 CAGTGTGGCTGGAGAGGATTAGG - Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155250852 18:23951856-23951878 CACTGTGGATGGAGGGGCTGAGG - Intronic
1156808111 18:41211848-41211870 AAGTGTGGCTGGAAGGAAGAAGG + Intergenic
1157288672 18:46394502-46394524 CAGCCTGGCTGGGGGGAAGGTGG - Intronic
1157493535 18:48139700-48139722 GAGGGAGGCTGGAGGGGTGGTGG - Intronic
1157606525 18:48929422-48929444 CAGGGTGGCAGGTGGGTAGGTGG - Intronic
1157674123 18:49555853-49555875 CAGTGTGGCAGGAAGGCAGAGGG + Intergenic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159827104 18:73226977-73226999 CAGTGAGGAGGGAGGGCAGGGGG - Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159965707 18:74594081-74594103 CAGAGTGGCTTGCTGGGAGGAGG - Intergenic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160451161 18:78966665-78966687 GAGTCTGGCTGCAGGTGAGGGGG + Intergenic
1160468871 18:79108187-79108209 CAGGGATGCTGGAGGGAAGGAGG + Intronic
1160612758 18:80101399-80101421 CAGTGTGGTTTGGGGGTAGGAGG - Intergenic
1160764712 19:802317-802339 GAACGTGGGTGGAGGGGAGGCGG + Intronic
1160779646 19:872136-872158 CGGTGTGGCTGGGGCGGCGGGGG + Intronic
1160910998 19:1473786-1473808 CAGGGTGGAAGGTGGGGAGGGGG - Exonic
1161125055 19:2551115-2551137 CAGCGTGGCTGGACGGCAGGTGG - Intronic
1161204605 19:3034461-3034483 CAGGGTGGCTGGAGGGGGTTGGG - Intronic
1161205550 19:3039384-3039406 CTGTGTGGCTGGAACAGAGGGGG - Intronic
1161284893 19:3463904-3463926 TGGAGAGGCTGGAGGGGAGGGGG - Intronic
1161407354 19:4097991-4098013 CAGTCTGGCTGGAGAGGAGGAGG + Intronic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161906105 19:7157724-7157746 CAGAGTGGCAGCAGGGGAGGTGG - Intronic
1162087845 19:8259362-8259384 CTGTGTGGCTGGAGCAGAGTGGG + Intronic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1162801921 19:13116081-13116103 CAGTGTGGATGGCGGGGGCGGGG - Intronic
1162818140 19:13208244-13208266 CAGGGAGGAGGGAGGGGAGGAGG + Intronic
1163005888 19:14396494-14396516 CCGTGAGGCTGGACGGGAGCTGG + Intronic
1163061857 19:14766935-14766957 CTGTGAGGCTGGACGGGAGCTGG - Intronic
1163394706 19:17052959-17052981 CAGGGCGTCTGGAGGGGAAGAGG + Exonic
1163424950 19:17236091-17236113 CATGGGGGCGGGAGGGGAGGCGG + Intronic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163446060 19:17347223-17347245 AATTGGGGCTGGAGGGGCGGTGG + Intergenic
1163497905 19:17657248-17657270 CAGCGTGGCCGGAATGGAGGAGG - Intronic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1164923483 19:32107636-32107658 AAGTCTTTCTGGAGGGGAGGAGG - Intergenic
1165072689 19:33264685-33264707 CAGTCTGGCAGGAGGTGAGCAGG - Intergenic
1165363489 19:35350743-35350765 CAGTGAGCCGGAAGGGGAGGAGG - Intergenic
1165388822 19:35527024-35527046 TAGTCAGGCTGGAAGGGAGGCGG - Exonic
1165422894 19:35731270-35731292 CAGTGTGGCTGTAAGGGGGCCGG - Intronic
1165702459 19:37948954-37948976 CACTGTGGCAGGAGGGCAGCGGG + Intronic
1165837803 19:38770229-38770251 CACTGTGACGGGAGGGGAAGCGG - Intergenic
1165841763 19:38792468-38792490 CACTGTGACGGGAGGGGAAGCGG + Intergenic
1165891235 19:39113502-39113524 CAGTGTGGCTGCAGCAGAGTGGG - Intergenic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166007743 19:39918646-39918668 CAGAGTGGGTGAAGAGGAGGTGG + Intronic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166199002 19:41224196-41224218 AAGTGTGCCTGGAGGGTAGTGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1166280359 19:41788480-41788502 CAAAGTGGCAGGAGTGGAGGGGG - Intergenic
1166611733 19:44204203-44204225 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
1166851742 19:45764641-45764663 CAGAGTGGCTGGGGAGGGGGTGG - Intergenic
1166924824 19:46260387-46260409 CATTGTGGGTGCAGGGGAGCGGG - Intergenic
1167638719 19:50668799-50668821 CTGCGAGGCTGGAGGGGCGGCGG - Exonic
1167792323 19:51689938-51689960 ACGTCTGGCTGGAGGGGAGGGGG + Intergenic
1167902647 19:52633515-52633537 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167925231 19:52816082-52816104 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167929565 19:52853248-52853270 CAGTGAGGCTGGAAGGAGGGTGG + Intronic
1167958505 19:53087207-53087229 CTGTGTGACTGGAGCAGAGGGGG + Intronic
1167992647 19:53373531-53373553 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168001318 19:53448439-53448461 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168005704 19:53485002-53485024 CAGTGAGGCTGGAAGGAGGGTGG - Intronic
1168179478 19:54651063-54651085 CACTGAGGGTGGAGAGGAGGGGG - Intronic
1168266002 19:55224457-55224479 CGGGGTGGCTGGTGGGGATGAGG - Intergenic
1168266789 19:55227778-55227800 CAGAGTGGCTGGAGAGCTGGAGG - Intronic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168475668 19:56673424-56673446 CTGTGTGTGTGGATGGGAGGAGG + Intergenic
1168671497 19:58244361-58244383 CAGTGTGGCTGTCGGGGTGTGGG - Intronic
925017619 2:543730-543752 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925017690 2:543929-543951 CAGGGAGGCTGGAGGGTGGGAGG + Intergenic
925024181 2:594866-594888 CGGGATGGCTGCAGGGGAGGTGG + Intergenic
925066230 2:930739-930761 CGATGTGGCTGGAGCTGAGGTGG - Intergenic
925187554 2:1859753-1859775 CAGGGCGGCTGGATGGGACGTGG - Intronic
925533250 2:4887438-4887460 GGGTGTGGCTGGAGGGGAGGAGG + Intergenic
925769287 2:7266628-7266650 CACTGTATCTGGAGGGAAGGAGG - Intergenic
925921190 2:8639095-8639117 CACTTTGTCTGGAGAGGAGGAGG - Intergenic
926004881 2:9365933-9365955 CAGACTGGATGGAGGAGAGGAGG - Intronic
926163961 2:10506612-10506634 GAGTGTGGCAGGAGGGGTGCAGG - Intergenic
926197274 2:10771607-10771629 CCCTGTCCCTGGAGGGGAGGAGG + Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926964660 2:18396634-18396656 CAGAATGGCTGGAGGAGCGGAGG + Intergenic
927194685 2:20539375-20539397 CACTAGGGCAGGAGGGGAGGTGG + Intergenic
927334755 2:21908901-21908923 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
927425228 2:22973994-22974016 AAGTGTGGCAGTAGGGGATGGGG + Intergenic
927571887 2:24167211-24167233 CAGCGTGGGTGGAGAGGAGCTGG + Intronic
927642307 2:24852861-24852883 GAGTGTGGCTGGTGGGGCTGTGG + Intronic
927736330 2:25525938-25525960 GAGTGTGGCTGGAGGTGGTGGGG - Intronic
927940394 2:27099804-27099826 CAGGCTGGATGGAGGGGAGAAGG - Exonic
928225879 2:29447653-29447675 GAGAGTGGCTGGGGGAGAGGTGG + Intronic
928360060 2:30655474-30655496 GAGAGTGGTCGGAGGGGAGGAGG + Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929259682 2:39851760-39851782 CACTGTGGGTGCAGGGGAGAGGG - Intergenic
929773281 2:44911109-44911131 CATGGTGGCAGGAGGGGAAGGGG + Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
930033540 2:47072229-47072251 CAGGGTGGCTGCAGGCGGGGTGG - Intronic
930552464 2:52852673-52852695 CAGAGTTCCCGGAGGGGAGGGGG - Intergenic
930618781 2:53623031-53623053 AAGTGTGTCTGGAGCGGAAGGGG + Intronic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
930705856 2:54504177-54504199 CAGGTTGGAAGGAGGGGAGGTGG - Intronic
930722575 2:54651972-54651994 CAGTAGGGCTTGTGGGGAGGTGG - Intronic
931226860 2:60339321-60339343 CAGTGTGGCTGGAATGGTGAGGG - Intergenic
931691656 2:64838982-64839004 GAGTGTGGGTGGGTGGGAGGGGG - Intergenic
932036059 2:68248090-68248112 TAGCGTGGCTGGAGAGGAAGGGG - Intronic
932036395 2:68251733-68251755 GAGTGAGTGTGGAGGGGAGGGGG + Intronic
932049935 2:68388294-68388316 CCTCATGGCTGGAGGGGAGGGGG + Intronic
932234916 2:70113166-70113188 CAGTGGGGTGGGAGTGGAGGTGG - Intergenic
932595793 2:73092830-73092852 AGGTGGGGCTGGAAGGGAGGTGG - Intronic
932770187 2:74496846-74496868 CAGTGTGAGGGGAGAGGAGGGGG - Intergenic
933149677 2:78899211-78899233 CAGTGTGGCTGGGAGAGAGAGGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
933707456 2:85302638-85302660 CAGTGCTGCTGCAGGGCAGGCGG + Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
936019014 2:108980793-108980815 CGGTGTCACTGGTGGGGAGGTGG + Intronic
936885685 2:117308314-117308336 GAGTGTGACTGGGAGGGAGGTGG - Intergenic
936981470 2:118269157-118269179 CACTGTGTCAGAAGGGGAGGTGG + Intergenic
937230818 2:120397130-120397152 GAGTGTGGGTGTGGGGGAGGAGG + Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937349878 2:121153988-121154010 CAGAGAGGGTGGAGGAGAGGCGG - Intergenic
937358496 2:121213042-121213064 CATCATGGCTGGGGGGGAGGGGG + Intergenic
937880372 2:126859863-126859885 CTGTATGCATGGAGGGGAGGTGG + Intergenic
937951862 2:127394436-127394458 CAGTGTGGGAGGAAGGGACGAGG - Intergenic
938237376 2:129717308-129717330 CAGCGTGGCTGCAGGTGAGCTGG - Intergenic
938342385 2:130544249-130544271 CAATGTGGCTGCAAGGGAGCAGG + Intronic
938347447 2:130576460-130576482 CAATGTGGCTGCAAGGGAGCAGG - Intronic
938418047 2:131120726-131120748 GAGTGTGGGAGGAAGGGAGGGGG + Intronic
938540647 2:132281228-132281250 CCGTGGGGCTGCAGGGGAGGGGG + Intergenic
938760794 2:134424172-134424194 CAGTGTGACTGAAAGGGAAGAGG + Intronic
938952726 2:136270340-136270362 ACATGTGGCTGGAGGGCAGGAGG + Intergenic
939113910 2:138039178-138039200 AAATCTGGCTGGAGAGGAGGGGG + Intergenic
939476515 2:142694368-142694390 GAGCGAGGCTGGAAGGGAGGTGG + Intergenic
939629164 2:144513853-144513875 CACTGACGCTGGAGAGGAGGGGG - Intronic
939818100 2:146921437-146921459 CAGGGTGGGTGGATGGGAGGAGG + Intergenic
940165335 2:150764515-150764537 CAGTGTGGCTGGAAGAGGGGAGG - Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
940398668 2:153222298-153222320 GAGTCTGGCTGGGGGGGGGGGGG + Intergenic
941029119 2:160492779-160492801 GACTGGGGCTGGAGGGGCGGCGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941463590 2:165799738-165799760 CAGTTGGGCTGGAGGGGATTTGG - Intergenic
941488279 2:166109859-166109881 CTATGTGGGTGGTGGGGAGGTGG + Intronic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
941793206 2:169575116-169575138 CAGGGCGGCTGGCGGGGCGGGGG + Intergenic
941847874 2:170150166-170150188 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
944154214 2:196593499-196593521 CGGCGCGGCTGGAGGTGAGGAGG - Intronic
944486996 2:200217426-200217448 CTGTGTGCCTGGAGTAGAGGTGG - Intergenic
946051817 2:216869245-216869267 CATAGTGGGTGGAGGGGTGGAGG - Intergenic
946217758 2:218198882-218198904 AAGTCTGGCTGAAGGGGAGGAGG - Intergenic
946236484 2:218327425-218327447 CAGCCTGGCAGGAGGGGAGCAGG + Intronic
946691588 2:222312374-222312396 CGGAGAGGCTGCAGGGGAGGAGG + Intergenic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947140806 2:227017942-227017964 ACTTGAGGCTGGAGGGGAGGAGG + Intronic
947152030 2:227125606-227125628 CAGGGTGGCAGGCTGGGAGGAGG - Intronic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
947459461 2:230290667-230290689 CAGTTTGGCTTGAGGGAAGGAGG + Intronic
947469751 2:230390129-230390151 CAGTTTAGCTTGAGGGAAGGAGG + Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947746198 2:232508487-232508509 CAGCCTGGCAGGTGGGGAGGAGG + Intergenic
947809015 2:232988184-232988206 CACTGGGGGAGGAGGGGAGGTGG + Intronic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
947903896 2:233745709-233745731 CAGAATGGCTGGAGGGTAAGAGG + Intronic
948075164 2:235160311-235160333 CACTGTGGGATGAGGGGAGGGGG - Intergenic
948197430 2:236106198-236106220 CAGTGTGGCTGGAGCTGGAGAGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
948458421 2:238117946-238117968 GAGGGTGGATGGAGGGGAGGTGG + Intronic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
948678247 2:239611735-239611757 CAGTGTGACTGGAGGTGTGATGG - Intergenic
948826401 2:240575306-240575328 CAGGGTGGCAGAAGGGGAGGTGG - Intronic
948850737 2:240704151-240704173 CAGTGCAGCGGGTGGGGAGGAGG + Intergenic
948861629 2:240755341-240755363 GAGTGTGGCGGGAGGGAGGGAGG + Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
949070357 2:242020777-242020799 CCGTGTAGCTGGAGGCGCGGTGG + Intergenic
1168962796 20:1880463-1880485 CAGTGTGGCTGAAGCAGAGTGGG + Intergenic
1169001248 20:2169411-2169433 CACTGTGGCTGGAAGAGGGGTGG + Intronic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169441782 20:5639319-5639341 CGGGGTGGCTGGCGGGGCGGGGG + Intergenic
1169581312 20:7026355-7026377 GAGTGTTGGAGGAGGGGAGGTGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170871374 20:20209795-20209817 CATCGTGGCAGGCGGGGAGGAGG + Intronic
1170994278 20:21336991-21337013 CAGTGTGGAAGGAGCAGAGGAGG + Intronic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171981795 20:31633729-31633751 CAGGGTGGCTGGGAGGGCGGTGG - Intergenic
1172051471 20:32122005-32122027 CAGGGTGGCTGGCCGGGCGGGGG + Intronic
1172165852 20:32898652-32898674 CGGTGGGGCTGGAAGGGAGGGGG + Intronic
1172258019 20:33536403-33536425 CAGGGTGGCTGGCCGGGCGGGGG + Intronic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1172387086 20:34541565-34541587 GAGTGTGGCTGGATGAGGGGTGG - Intergenic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172799825 20:37567953-37567975 CAGAATGGCTGGTGGGGGGGGGG + Intergenic
1172828270 20:37808888-37808910 CACAGTGGGTGGTGGGGAGGAGG - Intronic
1172885106 20:38225685-38225707 CGGTGTGGCAGTAGGGGAAGGGG + Exonic
1172888488 20:38247296-38247318 TGGCGAGGCTGGAGGGGAGGCGG - Intronic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1173350411 20:42239996-42240018 CAGTGTAGCTGAGGAGGAGGTGG - Intronic
1173519213 20:43686721-43686743 CAGTGTTGCCTGAGGGGATGTGG + Intronic
1173560762 20:44003810-44003832 CACTGTGGTTAGAGGGGTGGTGG + Intronic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1173787304 20:45803505-45803527 CAGTGTGGCTGGAGGTGGAGAGG - Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1174081843 20:47975522-47975544 CAGCGTGGCAGGAAGGGAGCTGG - Intergenic
1174150552 20:48483309-48483331 CAGTGGGGCTGGTGGGTGGGAGG - Intergenic
1174259065 20:49280099-49280121 CAGTGTGGCTGGAAGAGTTGAGG - Intergenic
1174273628 20:49387387-49387409 GAGTCTGGCTGGAGGGGACTGGG + Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174403845 20:50291292-50291314 CAGAGTGGCTGGTGGGGAGGTGG + Intergenic
1174406871 20:50308662-50308684 CAGTGAGGCTGGGGAGGTGGCGG + Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1174918444 20:54677353-54677375 CAGGGTGGCTGTAGAGGAAGGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175222852 20:57427139-57427161 CAGTGGGCCTGTGGGGGAGGGGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175853601 20:62107061-62107083 CAGAGTGGCTGGAGGGGCAGAGG - Intergenic
1175934692 20:62509452-62509474 GATGGTGGCTGGAGGGGTGGAGG - Intergenic
1175934704 20:62509482-62509504 GATGGTGGCTGGAGGGGTGGAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176061220 20:63173781-63173803 CAGTGTGGAGCGAGGGGAGCTGG - Intergenic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176195447 20:63834764-63834786 CAGTGAGGGTGGAGGGCAGGTGG - Intergenic
1176230120 20:64028289-64028311 CAGTGGGGCTGGCAGGGATGTGG + Intronic
1176253318 20:64137601-64137623 CAGGGAGGCTGCAAGGGAGGTGG + Intergenic
1177576575 21:22964307-22964329 CATTGTTGCTGAAGGGAAGGGGG + Intergenic
1178317180 21:31576412-31576434 TAGTTTGGGAGGAGGGGAGGAGG + Intergenic
1178466189 21:32850195-32850217 GAGGGGGGCGGGAGGGGAGGAGG + Intergenic
1178640011 21:34338013-34338035 CAGTGTGGCTGGCGAGGGTGTGG + Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1178903569 21:36616958-36616980 CAGCGAGGCTGGAGTGGGGGGGG + Intergenic
1179110056 21:38438670-38438692 CAATGTGGCGGGAGGGAAGGAGG + Intronic
1179320999 21:40291186-40291208 CAGGGTGACTGCAGTGGAGGAGG - Intronic
1179363608 21:40735551-40735573 CAGTGTGTCTGGAATGTAGGTGG - Intronic
1179549643 21:42135733-42135755 CACTTTGGCTGGAGGGTGGGAGG + Intronic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179750818 21:43466534-43466556 CAGGGTGGTCGGAGGGGGGGGGG - Intergenic
1179776320 21:43665765-43665787 CATCTTGGCTGGAGGGGAAGGGG - Intronic
1179887644 21:44321199-44321221 CACGGTGGGTGGAGGGGAGGTGG + Intronic
1180790379 22:18572501-18572523 CAGTTTGGGTTGAGCGGAGGTGG - Intergenic
1180868069 22:19131032-19131054 AAGTCAAGCTGGAGGGGAGGCGG - Exonic
1181057627 22:20267639-20267661 CCGTGAGGCTGGGGTGGAGGCGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181231359 22:21422814-21422836 CAGTTTGGGTTGAGCGGAGGTGG + Intronic
1181247292 22:21512054-21512076 CAGTTTGGGTTGAGCGGAGGTGG - Intergenic
1181379386 22:22488320-22488342 CACTGTAGCTGGAAGGGAGTGGG + Exonic
1181382167 22:22514579-22514601 CACTGTAGCTGGAAGGGAGTGGG + Exonic
1181462803 22:23095313-23095335 CTGAGTGGCTGGAGGGTTGGAGG - Exonic
1181699533 22:24612457-24612479 CAGTGTTCCTTGGGGGGAGGGGG - Intronic
1181967350 22:26666508-26666530 CAGTGTGGCAGGAGCAGAGCTGG + Intergenic
1182061244 22:27399342-27399364 TAGTGTGGCTGGCGGGTGGGGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182249620 22:28989768-28989790 GAGGGTGGGTGGTGGGGAGGGGG - Intronic
1182254802 22:29030733-29030755 CAGGGCTGGTGGAGGGGAGGAGG + Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182659781 22:31917143-31917165 CAGCCTGGCTGGAGGGGATTAGG - Intergenic
1182982393 22:34684346-34684368 CCGTGCGGCTGGCCGGGAGGGGG + Intergenic
1183000875 22:34857605-34857627 CACTGGGGCCTGAGGGGAGGTGG - Intergenic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183427336 22:37746740-37746762 CTAGGGGGCTGGAGGGGAGGTGG - Intronic
1183495408 22:38140551-38140573 CAGTGTGGATGGGAGGGAAGGGG + Intronic
1183503031 22:38192582-38192604 CAGGGTGACTGGGGAGGAGGTGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183750958 22:39720021-39720043 CACTGTGGTTGGAGGGGACTGGG + Intergenic
1183835166 22:40446528-40446550 CACAGAGGCAGGAGGGGAGGAGG + Intronic
1183964615 22:41434341-41434363 CTGTGTGTGTGGATGGGAGGAGG + Exonic
1183971319 22:41479651-41479673 CAGTGAGGCTGGTGGGGGAGAGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184421747 22:44386227-44386249 TAATGTGGCTGGAGAGGTGGTGG - Intergenic
1184786557 22:46674771-46674793 CTGTGTGGCTGCAGGGGAGGGGG + Intronic
1185011875 22:48319105-48319127 CTGAATGGCTGGAGTGGAGGTGG - Intergenic
1185108028 22:48885350-48885372 GAGTGTGGGAGGACGGGAGGAGG - Intergenic
1185111489 22:48902514-48902536 CAGGGTCTCGGGAGGGGAGGAGG + Intergenic
1185118042 22:48949180-48949202 GAGTGAGGCTGGAGGAGGGGGGG - Intergenic
1185264034 22:49888812-49888834 CCGTGAGGCTGCAGAGGAGGTGG + Exonic
1185279444 22:49963693-49963715 CAGTGGGGAGGCAGGGGAGGGGG + Exonic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185336437 22:50272694-50272716 CAGAGTGGTGGGAGGAGAGGTGG - Intergenic
1185347743 22:50317785-50317807 CTGTGTGGCAGGAGAGGAGCTGG - Intronic
949513782 3:4789110-4789132 CAGCGGGGCTGGAAGTGAGGTGG - Intronic
949533675 3:4979411-4979433 AAGTGGGGCGGGCGGGGAGGCGG - Exonic
949917207 3:8974423-8974445 CCATGTGGCTGGAGCTGAGGGGG - Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950704872 3:14773414-14773436 AAGTGAGGGGGGAGGGGAGGGGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953045822 3:39293629-39293651 TAGTGAGGATGGAGGGGAAGGGG - Intergenic
953189034 3:40666235-40666257 CATTGTGGCGGGAGGAAAGGTGG + Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
953538479 3:43793799-43793821 CAGTGTGGCTATAGAGGTGGGGG + Intergenic
953763864 3:45717716-45717738 CACTGTGGCTGGGGAGCAGGGGG - Intronic
953797040 3:45993911-45993933 CAGGGTGGGTGGGGGTGAGGGGG + Intronic
954199432 3:49015373-49015395 CAGCATGCCTTGAGGGGAGGAGG + Exonic
954636638 3:52074439-52074461 CAGTGGGACTGGTGGGGATGGGG + Intergenic
954645165 3:52126888-52126910 CAGTGTGGGTTGTTGGGAGGTGG - Intronic
954681270 3:52347313-52347335 CAGTGTGGCTGGAGTCAGGGAGG + Intronic
954748481 3:52800462-52800484 CAGACAGGCTGGAGCGGAGGAGG - Intronic
955158915 3:56445667-56445689 GAGAGTGGCAAGAGGGGAGGCGG - Intronic
955833744 3:63031333-63031355 CAGGGTGGCTAGAGGGGATGGGG + Intergenic
956189592 3:66596045-66596067 ATGGGTGCCTGGAGGGGAGGTGG + Intergenic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956682096 3:71790439-71790461 CAGTGTGGCAGGAGCAGAGCTGG - Intergenic
956857256 3:73287308-73287330 TTGTGGGGCTGGAGGAGAGGAGG + Intergenic
957073850 3:75585966-75585988 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
959041213 3:101424706-101424728 CAATGTGGCTGATGGGGAGCAGG - Intronic
959703029 3:109316192-109316214 GAGTGTGGGGGGAGGGGCGGGGG - Intronic
959824066 3:110771832-110771854 CAGTGTGGCTGCAGCAGAGCTGG - Intergenic
959871783 3:111337260-111337282 GAATGTGGCTGGAAGAGAGGAGG + Intronic
959997595 3:112695848-112695870 CAGTGTTTTTGGTGGGGAGGAGG - Intergenic
960302368 3:116019148-116019170 CATTGTGGGTGGGGGGGGGGGGG + Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
960882156 3:122356034-122356056 CAGTGAGGTTGGAGGTGAGCAGG + Intergenic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961280237 3:125760754-125760776 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
961657977 3:128453732-128453754 CAGTGTGGTTGGCGGGCAGGTGG + Intergenic
961784377 3:129339690-129339712 CAGGGTGGCTGGCCGGGCGGGGG + Intergenic
961874169 3:130008793-130008815 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
962270654 3:133975653-133975675 CAGTATGGCTGGATGGAGGGAGG - Intronic
962422508 3:135240866-135240888 CAATGTTGCTGCAGGGGAGGTGG - Intronic
962758104 3:138483725-138483747 GGGTGAGGGTGGAGGGGAGGTGG - Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964746240 3:160015389-160015411 CATTATGGCCTGAGGGGAGGTGG - Intergenic
965677374 3:171212179-171212201 CAGTGCAGCCGGAGTGGAGGAGG - Intronic
965694003 3:171387975-171387997 GAGTGTGGGGGGAGGGGACGGGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966439322 3:179926364-179926386 AAGTGTGGCTGGGCAGGAGGAGG - Intronic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967155713 3:186690165-186690187 CAGTGAGGCAGGTGGAGAGGGGG - Intergenic
967157002 3:186702330-186702352 CAGTGAGGCAGGTGGAGAGGGGG - Intergenic
967271863 3:187739113-187739135 CTCTCTGGCTGGAGAGGAGGGGG - Intronic
967569879 3:191016149-191016171 CAGTGAGGCTGGGGGAGGGGCGG - Intergenic
967570490 3:191022493-191022515 CACTGTGGCTGGAGGGGAACAGG + Intergenic
967924326 3:194633962-194633984 GTGTGTGGCTGGACAGGAGGCGG - Intergenic
967946800 3:194810523-194810545 AATTGTGGGTGGCGGGGAGGGGG + Intergenic
967996363 3:195169491-195169513 CACTGTGGCATGAGGGGACGTGG - Intronic
968468128 4:763306-763328 CAGTGGGGCTGCAGGGGGTGGGG + Intronic
968496362 4:919454-919476 GGGTGCGGCTGGAGAGGAGGAGG - Intronic
968582617 4:1402080-1402102 CAGCGTCGTTGGAGGAGAGGTGG + Intergenic
968615072 4:1574023-1574045 CAGTGTGGCTGCTGGGAAGGAGG - Intergenic
968690706 4:1988423-1988445 CAGTGTGGCTGAAGGGTCAGGGG + Intronic
968758428 4:2428526-2428548 CGCTGTGGGTGGAGGGGTGGGGG - Intronic
968862637 4:3184809-3184831 CAGACTGGCTGGAGAGGAGGAGG + Intronic
968918728 4:3511489-3511511 GTGTGTGGCTGGTGGGGCGGGGG - Exonic
968924099 4:3538454-3538476 CAGGGTGGCTGGCCGGGCGGGGG + Intergenic
968945373 4:3660922-3660944 CACTGTGGCAGGAGGTGAGAGGG + Intergenic
968977563 4:3829954-3829976 AGGTGTGGCTGGAGGTGGGGTGG + Intergenic
969017434 4:4113276-4113298 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
969230734 4:5828464-5828486 GAGTGTGTCTGCAGGGGAGCGGG - Intronic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969608307 4:8213097-8213119 CCTTGTGGGTGGAGGGCAGGTGG - Intronic
969736512 4:8995029-8995051 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969795703 4:9526592-9526614 AAGTCTGGCTGGAGGAGAGTGGG - Intergenic
969921085 4:10540434-10540456 GAGTGTGGGTGTGGGGGAGGGGG - Intronic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970272385 4:14360776-14360798 CAGTGTGCCGGGAGGGGGGGCGG + Intergenic
970515806 4:16829057-16829079 CAGTGAGGGAGGAGGGGAGTGGG - Intronic
971158648 4:24109965-24109987 AAGTGAGGCATGAGGGGAGGAGG + Intergenic
971268831 4:25118282-25118304 CAGTTTGGCTGGAATGGAGCAGG + Intergenic
971361489 4:25942431-25942453 CAGGGTAGGTGGAGGGGATGTGG - Intergenic
971384733 4:26132565-26132587 CAGTGCAGCGGGAGGGCAGGTGG - Intergenic
971489371 4:27194837-27194859 CAGAGTGGGTGAAGGGGAGATGG + Intergenic
971490364 4:27205800-27205822 CAGTGAGGCTGAAAGGAAGGAGG + Intergenic
971665315 4:29475972-29475994 ATGGGTGGCTGGAGGGGAAGTGG + Intergenic
972359182 4:38311584-38311606 GAGTGTAGCAGGAAGGGAGGAGG + Intergenic
973772254 4:54217716-54217738 CAGTGCTGGGGGAGGGGAGGAGG - Intronic
974115241 4:57571135-57571157 CAGCCTGGCTGGCGGGGGGGGGG - Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
976035877 4:80820514-80820536 CAGTGTTGCTGGAGCGTAGTGGG + Intronic
976201569 4:82584763-82584785 CAGAGGTGGTGGAGGGGAGGGGG - Intergenic
976591223 4:86851483-86851505 CAGTGCTGATAGAGGGGAGGGGG + Intergenic
977679642 4:99784960-99784982 TAGTGTGGCTGGAGCAGAGCAGG - Intergenic
977908351 4:102501857-102501879 GAGTGGGGCTGGAGGGGGTGCGG - Intronic
978493591 4:109334763-109334785 CAATGTGTGTGGAGGGGTGGGGG - Intergenic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979129260 4:117019975-117019997 TAGTGGGGCTGTAGGGGAGTGGG + Intergenic
979289202 4:118961105-118961127 AAGTGTCCCTGGAGGGGTGGGGG - Intronic
979701573 4:123674091-123674113 TGGTGTGAGTGGAGGGGAGGAGG - Intergenic
980032495 4:127846328-127846350 CTGTGTGGCTGGGGTGGAGGAGG - Intergenic
980120036 4:128718179-128718201 GAGAATGGCTTGAGGGGAGGTGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981387979 4:144153611-144153633 CAGTGAGGCTGGGGGTGGGGGGG - Intergenic
981566112 4:146103775-146103797 CGGGGTGGGTGGAGGTGAGGGGG + Intergenic
981956117 4:150476531-150476553 CTGTGTGGCTAGAGTGGTGGTGG - Intronic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982452601 4:155570788-155570810 CACTGTGGCTGGAGGTGGGGAGG + Intergenic
982469796 4:155774248-155774270 CAATGTGGCTGGAACAGAGGAGG - Intronic
982545816 4:156731770-156731792 CACTGTGGCTGGAAGGGAGAAGG - Intergenic
984852406 4:184165439-184165461 CACCGTGGCTGGAGGGGAGCAGG - Intronic
984867300 4:184292613-184292635 GAGTGTGTGTGGAGGGGCGGGGG + Intergenic
984949298 4:184994816-184994838 GAGTGTGTCTGGAGGTCAGGAGG + Intergenic
984975848 4:185229382-185229404 GAGGGTTGCTGGAGGTGAGGAGG + Intronic
984981615 4:185287433-185287455 CAGTGGGGCTGCAGGGGAGAGGG + Intronic
985432413 4:189893940-189893962 CAGAGGGGGTGGGGGGGAGGCGG + Intergenic
985611377 5:891534-891556 CTGCGTGGCTGGAGGAGGGGAGG - Intronic
985627400 5:996497-996519 CTGTGTGGCTGGTGGGCATGTGG + Intergenic
985792560 5:1938156-1938178 CCGTGGGGCAGGAGGGGTGGTGG + Intergenic
985794617 5:1952894-1952916 CAGTGCAGCTGGCTGGGAGGAGG + Intergenic
985822716 5:2170806-2170828 CACTGTGGCTGCAGGTGAGCAGG + Intergenic
986173801 5:5334761-5334783 CAGTGCGGCTGGGAGGGAGCTGG - Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986403996 5:7407415-7407437 AATTGTGGCTGAAGGGGAAGGGG + Intronic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
987269378 5:16290386-16290408 CATTGTGGCAGGAGCAGAGGGGG + Intergenic
988628178 5:32899950-32899972 AATTGTGGCTGAAGGGGAAGGGG + Intergenic
989378402 5:40789631-40789653 AAGTGGGGCTGGAGGGGAAAAGG + Intronic
989473203 5:41844962-41844984 CACTGTGGCTGCTGGGGTGGTGG - Intronic
989579184 5:43016312-43016334 CAGTGTGGTTGGAGGCGGGGTGG - Intergenic
990365414 5:55065697-55065719 CACAGTGGGTGGAGGGGAGTAGG - Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
991557369 5:67910804-67910826 CAGGGGGCATGGAGGGGAGGAGG - Intergenic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
991972679 5:72156135-72156157 CAGTGTTTCTGAAGGAGAGGAGG - Intronic
992381707 5:76243851-76243873 CAGTGTGGCTGCATGTGAGTTGG - Intronic
992547836 5:77832483-77832505 CAGTGGGACTAGAGGCGAGGAGG - Intronic
992848100 5:80774821-80774843 TAGTGGGGGTGGAGGGGATGAGG + Intronic
994081714 5:95714572-95714594 CAGTGTGACCGGAGTGGTGGAGG + Intronic
994428327 5:99623358-99623380 AAAGATGGCTGGAGGGGAGGTGG - Intergenic
994802051 5:104390979-104391001 CATTGAGGTTGGAGGGGAGATGG + Intergenic
995655206 5:114418568-114418590 AAGTGGGGCTGGCGGGGAGTTGG + Intronic
996024142 5:118624905-118624927 TGGTGTGGCAGGAGGGGAGGTGG + Intergenic
997381902 5:133444374-133444396 CAGGGTGGCTGTAGGTAAGGAGG - Intronic
997719320 5:136065306-136065328 CCGCATGGCTGCAGGGGAGGTGG - Intergenic
997865065 5:137454504-137454526 TGCTGAGGCTGGAGGGGAGGGGG + Intronic
998262435 5:140641783-140641805 CAGTGTGGATGGTGTGGTGGAGG + Intronic
998295611 5:140966668-140966690 CAGGGTGGCACGAGCGGAGGCGG + Exonic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
999450883 5:151677298-151677320 CTTTGTGGCTGCAGGGGAGATGG - Intronic
999894011 5:156009060-156009082 CAGAGTGACTGGAGCGAAGGAGG + Intronic
1000243625 5:159431196-159431218 CAGCGTTGCTGGATGGAAGGAGG + Intergenic
1000326662 5:160177527-160177549 CAGTGTGGCTGGATCAGAGGAGG - Intergenic
1000390568 5:160718802-160718824 CAGTGTAGCAGTATGGGAGGTGG - Intronic
1000812692 5:165882656-165882678 CTGTGTGGCTGTAGGGGCTGTGG + Intergenic
1001019842 5:168173576-168173598 GAGTGTGGCTGGTGTGGGGGAGG - Intronic
1001226564 5:169949447-169949469 CAGTTTGGCTGAAGGGAAGAAGG + Intronic
1001304667 5:170563011-170563033 GTGTGTGGGTGGAGGTGAGGAGG - Intronic
1001411335 5:171514600-171514622 AAGAGTGGCCGGAGGGTAGGAGG + Intergenic
1001485209 5:172115097-172115119 CAGTGTGGTGGGTGGGGAGATGG - Intronic
1001567942 5:172712735-172712757 CAGAGACGCTGGATGGGAGGAGG - Intergenic
1001679903 5:173548864-173548886 CAGTGTGGCTTGTGGGGATTGGG + Intergenic
1001814899 5:174660383-174660405 CAGGGAGGGTGGAGAGGAGGAGG - Intergenic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002202689 5:177539123-177539145 CAGGCTGGCTGGAGGCGGGGGGG + Exonic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002521066 5:179793527-179793549 CAGTGTGGCTGGGGGGGCGCTGG + Intronic
1002872526 6:1179669-1179691 CAGTGTGGCTGGAGCAGGGGAGG - Intergenic
1002936858 6:1681495-1681517 CAGTGTGGCTCCAGGTGAGGAGG + Intronic
1003250075 6:4420079-4420101 CAGGCTGGCAGGAGGGGTGGTGG + Intergenic
1003277419 6:4664510-4664532 AAGTGGGGCTGGGTGGGAGGCGG - Intergenic
1003385174 6:5660805-5660827 CAGTGTGGCTGGAAAAGTGGGGG + Intronic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004152535 6:13134215-13134237 CAGGGCGGCTGGCGGGGCGGGGG - Intronic
1004164016 6:13239825-13239847 CTGTGTGTCAGGAGGAGAGGAGG + Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005161695 6:22871527-22871549 CAGAAAGGCTGGAGGGGAGCTGG + Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1006022167 6:31123704-31123726 CAGGGCTGCTGGAGGGGTGGAGG - Intronic
1006209898 6:32385288-32385310 CGGGGTGGCTGGCCGGGAGGGGG + Intergenic
1006338325 6:33432287-33432309 AGTTGGGGCTGGAGGGGAGGGGG - Intronic
1006342333 6:33453455-33453477 CAGAGGGGCGGGGGGGGAGGGGG - Exonic
1006448710 6:34093608-34093630 CTGTGTGGCTGGAGCAGAGCAGG + Intronic
1006499843 6:34451108-34451130 CAGTGGGGCTGGAGGTGCTGTGG + Intergenic
1006728169 6:36215028-36215050 CAGTTTGGCTGCAGCAGAGGGGG + Intronic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1006841128 6:37028370-37028392 CAGTTTGCCTTGCGGGGAGGGGG + Exonic
1006848135 6:37077621-37077643 CTGTGTGGCTGCAGGTCAGGAGG - Intergenic
1006929388 6:37678592-37678614 CAATGTGGCTGGAGTGGGGAGGG - Intronic
1006966421 6:37990343-37990365 AACTGTGGCTTGAGGGGAGGGGG - Intronic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007363446 6:41374115-41374137 CCGTGTGGCTGGGGGAGGGGTGG + Intergenic
1007400538 6:41600113-41600135 CAGGGTGGATGGAGGAGGGGTGG - Exonic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009566204 6:65313991-65314013 CAGCAAGGCTGGAGGGGAGTGGG - Intronic
1009690873 6:67030962-67030984 CAGTGTGGCCAGAGCGGACGAGG - Intergenic
1010189165 6:73176754-73176776 CAGGCTGGCTTGAGGGGAGATGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011337326 6:86275793-86275815 CAGTGTTGGTGCAGGGGTGGGGG + Intergenic
1012100795 6:95083846-95083868 GAGTGCGGGGGGAGGGGAGGAGG + Intergenic
1012412213 6:98971419-98971441 CAGTGTGAGTGGAGTGGAGCAGG + Intergenic
1013324489 6:109031395-109031417 GTGTGAGGCTGGAGAGGAGGTGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1013667636 6:112365004-112365026 AAGGGTAGGTGGAGGGGAGGGGG + Intergenic
1013874451 6:114806289-114806311 AGGTGTGGGAGGAGGGGAGGAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1014084680 6:117329754-117329776 CCCCTTGGCTGGAGGGGAGGGGG - Intronic
1014372034 6:120621885-120621907 CAATGTGGCTGGATGGGGTGAGG + Intergenic
1014857530 6:126420237-126420259 CAGAGTGGCTGGATGTGAGATGG + Intergenic
1014934751 6:127374410-127374432 CAGTTTGGGTGAAGGGGTGGAGG - Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016612025 6:146000474-146000496 GAGTGTGTGTGGAGGGGATGGGG + Intergenic
1016637188 6:146306148-146306170 CAGTGTGGCTTCTAGGGAGGCGG + Intronic
1016990801 6:149926309-149926331 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1016992203 6:149938163-149938185 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1016994759 6:149954103-149954125 CTGTGAGGCTGGAGGGGGTGGGG + Intergenic
1017003847 6:150015333-150015355 CTGTGAGGCTGGAGGGGGTGGGG - Intergenic
1017007533 6:150038450-150038472 CAGTGAGGGTGGAGGGGGTGGGG - Intergenic
1017084528 6:150701600-150701622 CACTGTGGGGTGAGGGGAGGGGG - Intronic
1017446097 6:154509310-154509332 CAGTGGGGCTGGGGCGGTGGGGG - Intronic
1017467471 6:154707787-154707809 CAGTCTGGCTGAAGTGGAGGAGG + Intergenic
1017646394 6:156543365-156543387 CAATGTTGTTGGTGGGGAGGTGG + Intergenic
1017721769 6:157248083-157248105 CAGTGTGTCTGGGGGTGGGGTGG + Intergenic
1017889608 6:158627673-158627695 CAGCGTGGCTGGAGATGAGCAGG + Intronic
1018441719 6:163820061-163820083 CAGTGTGGCTGGAATAGCGGAGG - Intergenic
1018544941 6:164925015-164925037 GAGGGTGCCTGGAAGGGAGGTGG + Intergenic
1018741008 6:166728570-166728592 GAGTCTGGCTGACGGGGAGGAGG - Intronic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1018926585 6:168211064-168211086 CAGTGTGGCTGCATTGGAGATGG + Intergenic
1018992275 6:168683234-168683256 CACTGTCTCTGGAGGGGAGGAGG - Intergenic
1019275020 7:171639-171661 CCGTGTGGGTGTCGGGGAGGAGG - Intergenic
1019318172 7:401133-401155 GAGTGTGGCTGGGCTGGAGGTGG - Intergenic
1019652850 7:2169947-2169969 CAGTCTGGGTGGAGGGGTTGCGG + Intronic
1020046719 7:5046082-5046104 CAGAGGGGCCGGACGGGAGGTGG + Exonic
1020070814 7:5225868-5225890 CAGTGTTGCTGGAGGCGGAGAGG - Exonic
1020905831 7:14062988-14063010 CTGTGTGGGGTGAGGGGAGGGGG - Intergenic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1021745390 7:23735639-23735661 CAGTGTGGATATAGGGGAAGAGG + Exonic
1021870065 7:24996907-24996929 AAGAGTGGCTGGAGAGGATGTGG - Intergenic
1022098155 7:27153652-27153674 GAGTATGGCTGGAGGGCAGGGGG - Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1023170342 7:37385340-37385362 CAGTGTGGCTGGAGGGGAGGGGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023312492 7:38902340-38902362 CAGTGTGGCTGGAGGGTCACAGG - Intronic
1023393608 7:39732892-39732914 CAGTGTGCATGGCGGGAAGGAGG - Intergenic
1023607476 7:41943351-41943373 GAGTGTGGAGGGAGGGAAGGAGG + Intergenic
1023852411 7:44157804-44157826 CACTGAGGCTGGAGCAGAGGCGG + Intronic
1023875699 7:44285139-44285161 CTATGAGGCAGGAGGGGAGGGGG + Intronic
1024558001 7:50620314-50620336 CAGTCTGGCTGCAGGAGAGGAGG - Intronic
1024982190 7:55166833-55166855 CAGTGTTGGTGGTGAGGAGGTGG + Intronic
1025803512 7:64809288-64809310 CGGGGCGGCTGGAGGGGCGGGGG + Intronic
1026079554 7:67205535-67205557 CATTACAGCTGGAGGGGAGGAGG + Intronic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026496347 7:70906948-70906970 CAGTGGGGATGAAGGTGAGGAGG - Intergenic
1026697295 7:72606447-72606469 CATTACAGCTGGAGGGGAGGAGG - Intronic
1026735174 7:72944762-72944784 CAGTGTGGCTGCAGGAGTGGTGG + Intronic
1026785515 7:73299691-73299713 CAGTGTGGCTGCAGGAGTGGTGG + Intergenic
1026963894 7:74427096-74427118 CAGGGTTGGTGGCGGGGAGGTGG + Intergenic
1026984379 7:74545844-74545866 CAGGGCGGCTGGAGGGGGGCCGG - Intronic
1027108557 7:75420245-75420267 CAGTGTGGCTGCAGGAGTGGTGG - Intronic
1027233396 7:76284509-76284531 CACGGTGGCTGGACAGGAGGTGG - Intronic
1028395513 7:90364832-90364854 CAGTGAGGCTGGCGGGGGAGGGG - Intronic
1028492787 7:91432362-91432384 CAGTGTGGGTGGAGGGGTCGAGG + Intergenic
1028937899 7:96486454-96486476 CAGGCTGGCAGGAGGTGAGGAGG + Intronic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029596661 7:101541307-101541329 AAGTGTGGCAGGAAGGCAGGGGG - Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1030081765 7:105784548-105784570 CAGCATGGCAGGAGGGGAAGTGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1031941461 7:127793797-127793819 AGGTGAGGGTGGAGGGGAGGAGG - Intronic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1032706933 7:134428726-134428748 CAGGGTGGGAGGATGGGAGGGGG - Intergenic
1033169940 7:139075063-139075085 CAGTGGGGCTGGTGGGGGGGTGG + Intronic
1033277724 7:139985305-139985327 CAGTCAGGCTAGAGGGGTGGGGG - Intronic
1033996992 7:147362594-147362616 CAGTATGCCTGTAGGTGAGGTGG - Intronic
1034240327 7:149605843-149605865 CAGAGTAGCTGGAGGGCTGGCGG - Intergenic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034931269 7:155165826-155165848 CACAGTGGCTGGAGTCGAGGGGG + Intergenic
1035242060 7:157538600-157538622 TTGTGTGGCTGGTGGGGACGAGG + Intergenic
1035254750 7:157619121-157619143 CAGTGTGGATGGGGGGGTTGGGG - Intronic
1035359455 7:158300771-158300793 CCGTGTGGAGGGAGGGGAGGTGG + Intronic
1035587191 8:785632-785654 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587204 8:785666-785688 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587216 8:785700-785722 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587229 8:785734-785756 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587242 8:785768-785790 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035587266 8:785836-785858 CAGAGGGGCCTGAGGGGAGGAGG - Intergenic
1035615454 8:996888-996910 CAGTGTGACTTGTGGGAAGGTGG - Intergenic
1036207534 8:6816001-6816023 CACTCAGGATGGAGGGGAGGGGG - Intronic
1036241594 8:7086233-7086255 CAGTCTGGCTGAAGGAGAGTGGG - Intergenic
1036260244 8:7233884-7233906 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036306373 8:7605639-7605661 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036312281 8:7692440-7692462 TAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1036357219 8:8053624-8053646 CAGTCTGGCTGGAGGAGAGTGGG - Intergenic
1036706694 8:11052105-11052127 CAGTTTGGTTGGAGCAGAGGGGG - Intronic
1036831141 8:12020844-12020866 CAGCCTGGCTGGAGGAGAGTGGG + Intergenic
1036901350 8:12671629-12671651 CAGTCTGGCTGGAGGAGAGTGGG + Intergenic
1037324854 8:17678617-17678639 CTGTGTGGGTGATGGGGAGGAGG - Intronic
1037561207 8:20076117-20076139 CAGTGTGAGTGGAGTGGATGAGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037835841 8:22214293-22214315 GATGGTGGCTGGAGAGGAGGAGG + Intergenic
1039064686 8:33598469-33598491 GTGTGTGTCTTGAGGGGAGGGGG + Intronic
1039175460 8:34799259-34799281 AAGTGAGGCTAGAGAGGAGGAGG - Intergenic
1039977677 8:42381191-42381213 GAGTGGGGAGGGAGGGGAGGAGG + Intergenic
1040470954 8:47735478-47735500 CAATGTGGCTGCAAGGGTGGTGG + Exonic
1040594906 8:48827950-48827972 CAGTGTGGTCGGAGGCGAAGTGG + Intergenic
1040607419 8:48947921-48947943 CAGGGTGGCAGGAGGAGATGGGG - Intergenic
1040638738 8:49306272-49306294 CAGTATGGCTGGTTGGGAGATGG - Intergenic
1040644778 8:49385899-49385921 CAGTGTAGGAGGCGGGGAGGAGG - Intergenic
1040668591 8:49659220-49659242 CAATGTGGCTGGGAGGGTGGGGG - Intergenic
1040732039 8:50459673-50459695 CACTGAGGCAGGAGGGAAGGAGG - Intronic
1040981790 8:53251813-53251835 CTGCGGGGCTGGAGGGGACGCGG - Intergenic
1041790805 8:61694268-61694290 CAGTGAGGCTGGGGGAGAAGGGG - Intronic
1042307026 8:67343329-67343351 CCCAGCGGCTGGAGGGGAGGAGG + Exonic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042705709 8:71664134-71664156 CAGTGTGGCTGGAGGAGGGTGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043147530 8:76676823-76676845 GAGTGTAGCTGGAGGAGGGGAGG + Intergenic
1043212475 8:77540358-77540380 CGGTGTGGCAGGAGGGCTGGAGG + Intergenic
1043349537 8:79343575-79343597 CATTATGGCTGGGGGGGGGGGGG - Intergenic
1043516081 8:80996281-80996303 GAGTGTTGGTGGTGGGGAGGTGG + Intronic
1043887747 8:85622044-85622066 TAGTGGTGCTGGTGGGGAGGTGG + Intergenic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1044792247 8:95859454-95859476 CACTTTGGCTGGTGGGGAGGAGG + Intergenic
1044969488 8:97605276-97605298 CGGGGCGGCTGGTGGGGAGGGGG - Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045277322 8:100720669-100720691 CAGAGTGGGAGGAGGGGATGTGG - Intronic
1045381552 8:101632387-101632409 CCCTGTGGATGGATGGGAGGTGG - Intronic
1045489703 8:102658787-102658809 CAATGTGGCTGGAGGTGCAGAGG + Intergenic
1045831404 8:106465309-106465331 CAAGGTGGCAGGAGGGGTGGAGG + Intronic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1047266633 8:123314943-123314965 CGGGGTGGCTGGTGGGGCGGGGG - Intergenic
1047536675 8:125726469-125726491 GAGAGTGGCTGGAGGTGAGATGG + Intergenic
1047579096 8:126193045-126193067 CAGCTTGGGTGGCGGGGAGGGGG + Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048200084 8:132365471-132365493 CACCTTGGCTGGAGGGGATGAGG + Intronic
1048237311 8:132703631-132703653 CAGTGAGGGTGTTGGGGAGGGGG + Intronic
1048552331 8:135445050-135445072 CCGTGGGGGTGAAGGGGAGGGGG + Intergenic
1048859830 8:138716080-138716102 CAGTGTTGATGGAAGGGACGGGG - Intronic
1048896143 8:138994028-138994050 CAATGTGGCAGGAGGGGGAGAGG - Intergenic
1049060497 8:140272724-140272746 CAGTGAGGGGAGAGGGGAGGAGG + Intronic
1049262323 8:141646373-141646395 AAGGGTGGCTGGGGCGGAGGGGG - Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049611862 8:143559582-143559604 CAGGGAGGCTGGATGGGAGAGGG + Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049768429 8:144366883-144366905 CAGTGTGGCAGTATTGGAGGTGG - Intergenic
1049780579 8:144426884-144426906 GAGTGTGGCTGGAAGGGCGCAGG - Intronic
1049822299 8:144643121-144643143 CAGGAAGGCTGGTGGGGAGGGGG - Intergenic
1049829996 8:144694285-144694307 CAGTGTAGGTGGCGGGGAGTGGG + Intergenic
1050028113 9:1356787-1356809 CACTGTGACTGGAGGGCTGGGGG - Intergenic
1050296119 9:4207184-4207206 CTCTGTGTCGGGAGGGGAGGTGG - Intronic
1050495012 9:6231349-6231371 TAGTGTGGCTGGAGCAGAGCGGG - Intronic
1050504300 9:6331459-6331481 CACTGTGGCTAGAGAGGAAGGGG + Intronic
1050581443 9:7061636-7061658 CAATGAGGCAGGAGGGCAGGTGG + Intronic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051144796 9:14015658-14015680 CTGTGTGGCTGGGGTGGAGCTGG - Intergenic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052451259 9:28634444-28634466 AAGTGTGGGGGGAGGGGAGTTGG - Intronic
1052827484 9:33187549-33187571 CAGTGTGGCTGGCGCAGAGGAGG - Intergenic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1052993888 9:34539359-34539381 CGCTGTGGCTACAGGGGAGGTGG - Intergenic
1053417843 9:37957952-37957974 CAGAGTGACTGGAAGGGAGTTGG + Intronic
1055965217 9:81859332-81859354 AAGTGGGGAGGGAGGGGAGGGGG + Intergenic
1056062181 9:82895011-82895033 CAGAGAGGCTGCAAGGGAGGTGG - Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1056564173 9:87758542-87758564 CGGGGTGGCTGGCCGGGAGGGGG + Intergenic
1056595717 9:88006579-88006601 CAGTGTGGCTGTGGGGGCGCTGG - Intergenic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1056708320 9:88970110-88970132 CAGTGTGCCTGGGGGTGTGGGGG - Intergenic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057314319 9:93958889-93958911 GGGTGTGGGTGGAGGGGAGGTGG - Intergenic
1057417865 9:94881303-94881325 CAGTGTGGCCTAATGGGAGGAGG + Intronic
1057488143 9:95502173-95502195 CACAGGGGCTGGAGGGGAGAGGG - Intronic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1057944905 9:99317534-99317556 CAGTGTGGGTGGATTGCAGGAGG + Intergenic
1057964869 9:99492858-99492880 GAGTGGGGCTTAAGGGGAGGAGG + Intergenic
1058067663 9:100567157-100567179 AAGTGTGGCTGCAGAAGAGGGGG - Intronic
1058178843 9:101771206-101771228 CAGTGTGTCAGAAGGGGAGTAGG - Intergenic
1058323618 9:103666507-103666529 TAGTGGGGTTGGAGGGGATGAGG + Intergenic
1058625019 9:106925853-106925875 CAGTGTTGCTGGAAGAGGGGTGG - Exonic
1058638882 9:107064027-107064049 AAGTGGGGGTGGAGGGGTGGTGG - Intergenic
1058940241 9:109806742-109806764 TAGTGTGGCAGGTGGGGAGTGGG + Intronic
1058972378 9:110095492-110095514 CTGAGTGGCTGAAGGGGAGCTGG - Intronic
1058974097 9:110109928-110109950 GGGACTGGCTGGAGGGGAGGGGG + Intronic
1059366455 9:113790138-113790160 AAGTGAGGCTGGAGGAGGGGAGG - Intergenic
1059394652 9:114026850-114026872 CAGTGTTGGTGGAGTCGAGGGGG + Intronic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1059820780 9:117969809-117969831 CAGTGTGCCTGAAGTGGAGAGGG - Intergenic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1059983273 9:119796584-119796606 CAGTTTGGCTGGATTGTAGGGGG + Intergenic
1060149032 9:121275610-121275632 TACTGTGGTGGGAGGGGAGGTGG - Intronic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060329970 9:122659123-122659145 CCTAGTGGCTGGAGGGAAGGAGG + Intergenic
1060521642 9:124297457-124297479 CAGTGAGGCTGGCGGGGAGCTGG - Intronic
1060527515 9:124328800-124328822 CAGCGGGGCTGGCGGGGAGGGGG + Intronic
1060960364 9:127676474-127676496 CAGAGTGGCTGGAGGGGAATCGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061219655 9:129242828-129242850 CAGTCTGGCTGGGGTGCAGGAGG + Intergenic
1061288468 9:129637567-129637589 GAGTGCCGCTGGAGGGAAGGGGG + Exonic
1061327663 9:129874060-129874082 CAGAGTGGCGGGAGGAGAGCTGG + Intronic
1061423023 9:130482317-130482339 CAGTGTGGCGGGGGGTGGGGTGG + Intronic
1061588706 9:131584433-131584455 CCGTGAGGCAGGAGGGCAGGCGG + Intronic
1061725875 9:132581775-132581797 GGGTACGGCTGGAGGGGAGGGGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061897680 9:133656934-133656956 CAGCGGGGCTGGGGAGGAGGTGG + Intronic
1062032126 9:134366505-134366527 CGGGGTGGCTGCTGGGGAGGGGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062051350 9:134448678-134448700 CAGTGTCACTGGAGGGCATGTGG + Intergenic
1062161075 9:135080255-135080277 CAGAGAAGCTGGAGGGGAAGAGG - Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062234069 9:135499849-135499871 CATTGTGCCTGGAGGAGAAGCGG + Exonic
1062239890 9:135531309-135531331 CTGTGCGGCTTGAGGGGTGGGGG - Intergenic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062394685 9:136348069-136348091 CACTGCGGCTAGAGGGGATGGGG + Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062460793 9:136661806-136661828 GAGTGGGGCTGGAGAGGTGGGGG + Intronic
1062523216 9:136968195-136968217 CAGCGTGGCTGGGCGGGTGGGGG + Intergenic
1062541801 9:137044857-137044879 CAGTGCCCCTGGATGGGAGGTGG - Intronic
1185979807 X:4765383-4765405 CAGTGTGGTTCGAGGGGAGGAGG + Intergenic
1186110068 X:6246384-6246406 AAGGGTGGTTGGAGGGGTGGGGG - Intergenic
1186403118 X:9277891-9277913 TAGTATGGCTGGAGGGGACGTGG - Intergenic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187654883 X:21460674-21460696 CAGTGGGGGTGGAGGAGAAGTGG - Intronic
1188304096 X:28541265-28541287 GAGTGGTGGTGGAGGGGAGGTGG + Intergenic
1188963041 X:36516933-36516955 TTGTGGGACTGGAGGGGAGGTGG + Intergenic
1189244671 X:39554336-39554358 TAGTGTGGCTGGAGCAGAGCGGG + Intergenic
1189798735 X:44672586-44672608 CACTGGGGCTTGTGGGGAGGAGG + Intergenic
1190096214 X:47483003-47483025 CAGTGCGGCGGCAGGGGCGGGGG - Intergenic
1190342480 X:49308582-49308604 CAGAGTGGCTGGGGGGCAGCAGG + Intronic
1190375155 X:49782132-49782154 CAGTAAGGCTTGAGGGGAGATGG - Intergenic
1190385380 X:49879041-49879063 CATTGAGGCTGGCGGGAAGGGGG - Intergenic
1190432187 X:50388681-50388703 CAATGAGGCTGCAGGGGATGAGG - Intronic
1190770997 X:53513947-53513969 CACTGTGGTGGGAGGGGTGGGGG - Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192175314 X:68881306-68881328 CCCTGAGGCTGGAGGGGAGGGGG + Intergenic
1192210793 X:69126572-69126594 CACTGTGGGTGGGGGGCAGGGGG - Intergenic
1192215750 X:69156961-69156983 GAGGGTGGCAGGAGGGGAAGGGG + Intergenic
1192491533 X:71579981-71580003 CAGAGTGGCGGGAGGTAAGGGGG + Intronic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192768753 X:74167066-74167088 CAGTGCGGCTGGCCGGGCGGGGG - Intergenic
1193362265 X:80591359-80591381 CAGGGTGGCTGGCCGGGCGGGGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1194016200 X:88624640-88624662 CAGTGTGGCTAGAGGAGTGCAGG + Intergenic
1194887914 X:99340865-99340887 GAGGGTGGCTGGAGGGGAGGTGG - Intergenic
1195548181 X:106137354-106137376 GAAGGTGGCTGGAGGGCAGGTGG - Intergenic
1195925561 X:110021336-110021358 CTGTGTGGCTGGTGGGGGTGAGG + Intronic
1195941207 X:110169394-110169416 CAGTGAGGCTGGAGGAGAGTGGG - Intronic
1195949408 X:110251670-110251692 CAGTGAGGCTGAAGAGGATGGGG + Intronic
1195968262 X:110448685-110448707 CAGGCTGGCTGGCGGGCAGGGGG + Intronic
1196324602 X:114388717-114388739 TGGTGTGGTGGGAGGGGAGGTGG - Intergenic
1196482675 X:116167795-116167817 GTGTGTGGGTGGAGGTGAGGCGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196997914 X:121404264-121404286 CAGTGGGGATAGAGGGGATGGGG - Intergenic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1197871839 X:131068677-131068699 CAGTGGGGCTCGGGGGGTGGGGG - Intronic
1198341516 X:135719148-135719170 CAGTTTCTCTGGAGGGGATGAGG - Intronic
1198346482 X:135764215-135764237 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198348388 X:135781500-135781522 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198350292 X:135798764-135798786 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198352200 X:135816036-135816058 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198354108 X:135833304-135833326 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198356018 X:135850554-135850576 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198357931 X:135867832-135867854 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198359845 X:135885115-135885137 CAGTTTCTCTGGAGGGGATGAGG + Intronic
1198366689 X:135946884-135946906 CAGTTTCTCTGGAGGGGATGAGG + Intergenic
1198453712 X:136794235-136794257 CAGGGTAGCAGCAGGGGAGGAGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199099758 X:143785193-143785215 CAGGGTGGGTGGAGGGCAAGGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1200041785 X:153375964-153375986 CCAGGTGGCTGGAGAGGAGGTGG + Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1200098323 X:153674414-153674436 CAGTGTGGCCGGGGAAGAGGTGG - Intronic
1200137585 X:153882584-153882606 CTGCCTGGCTGGAGGGCAGGGGG + Intronic
1201282258 Y:12352267-12352289 CAGGGCGGCTGGTGGGGCGGGGG - Intergenic
1201383535 Y:13413330-13413352 CGGTGTGGATAGAGGGCAGGAGG - Intronic
1201486191 Y:14496760-14496782 AAATGTGGTTGGAGGGGTGGTGG + Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic