ID: 1023171500

View in Genome Browser
Species Human (GRCh38)
Location 7:37394125-37394147
Sequence CAGGGACACTAATATAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 467}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023171495_1023171500 -6 Left 1023171495 7:37394108-37394130 CCTCTCCCTGTTAGGCCCAGGGA 0: 1
1: 0
2: 1
3: 13
4: 245
Right 1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG 0: 1
1: 0
2: 1
3: 31
4: 467
1023171491_1023171500 14 Left 1023171491 7:37394088-37394110 CCACTTATATTTATGGGGAGCCT 0: 1
1: 0
2: 0
3: 14
4: 109
Right 1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG 0: 1
1: 0
2: 1
3: 31
4: 467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023171500 Original CRISPR CAGGGACACTAATATAATGT TGG Intronic
902086976 1:13870592-13870614 AAGGAACACTTATATACTGTTGG - Intergenic
903566760 1:24273391-24273413 CAGGTACACCAATCAAATGTAGG + Intergenic
906571020 1:46840391-46840413 AAGGGACACTTATACACTGTTGG - Intergenic
906689975 1:47786040-47786062 CAGGGACCCTGAAATAATGGTGG + Intronic
906753087 1:48284057-48284079 CAGGTACACCAATCAAATGTAGG + Intergenic
906850899 1:49249596-49249618 AAGGTACACTCATATATTGTTGG + Intronic
908344179 1:63214754-63214776 CTGGAACACTCATATATTGTTGG + Intergenic
909384386 1:75038170-75038192 CAGGTACACCAATAAAATATAGG - Intergenic
909570831 1:77108719-77108741 CAGGTACACCAATCAAATGTAGG + Intronic
910646598 1:89521941-89521963 CAGGAACACTTATACACTGTTGG + Intergenic
911402876 1:97398559-97398581 CAGGAACACTATTACACTGTTGG - Intronic
911458049 1:98152731-98152753 AAGGAACACTTATACAATGTTGG - Intergenic
911691894 1:100844267-100844289 CAGGTACACCAATCAAATGTGGG + Intergenic
911860691 1:102944338-102944360 TAGGGACAGTAACATAAAGTGGG - Intronic
912133199 1:106627389-106627411 CAGGAACACCAATCAAATGTAGG + Intergenic
912235486 1:107845813-107845835 CAGGTACACCAATCAAATGTAGG - Intronic
912270876 1:108208055-108208077 CAGGTACACCAATCAAATGTAGG + Intergenic
913036144 1:114968306-114968328 CAGGTACACCAATCAAATGTTGG + Intronic
913078122 1:115358837-115358859 CAGGTACACCAATCAAATGTAGG - Intergenic
913241159 1:116830972-116830994 CAGGGACTCTCATACACTGTTGG + Intergenic
913431625 1:118800399-118800421 AAGGGACACTTGTATACTGTGGG + Intergenic
913446035 1:118951758-118951780 CTGGGACACTAACATCAAGTTGG - Intronic
915990335 1:160509031-160509053 CAGGAACACTTTTACAATGTTGG + Intronic
916362997 1:163991653-163991675 CAGGTACACCAATCAAATGTAGG - Intergenic
916406435 1:164501995-164502017 CAGGTACACCAATCAAATGTAGG - Intergenic
916509505 1:165459570-165459592 CAGGGATGCTCATAAAATGTTGG - Intergenic
917781346 1:178400471-178400493 CACCGACACTATTATATTGTAGG + Intronic
917918088 1:179724593-179724615 CAGGGACTCTAATATATGTTTGG - Intergenic
918159429 1:181883725-181883747 CAGGTACACCAATCAAATGTAGG - Intergenic
918353612 1:183683793-183683815 CAGGTACACCAATCAAATGTAGG + Intronic
918570981 1:185991894-185991916 CAGGTACACTTATATTCTGTTGG - Intronic
918913838 1:190609279-190609301 CAGGAACACTATTACACTGTTGG + Intergenic
919599149 1:199600977-199600999 CAGGCACACCAATCAAATGTAGG - Intergenic
921484706 1:215702447-215702469 CAGGTACACCAATTAAATGTAGG + Intronic
922037904 1:221867262-221867284 CAGGAACAGTATTGTAATGTGGG - Intergenic
922065508 1:222135591-222135613 CAGGAACACTTTTATACTGTTGG + Intergenic
922396945 1:225211514-225211536 CAGGTACACCAATCAAATGTAGG - Intronic
922400583 1:225250192-225250214 CAAGAACCCTAATATATTGTTGG - Intronic
924322931 1:242867906-242867928 TAGGAACACTATTATACTGTTGG + Intergenic
924717368 1:246589728-246589750 CAGGGACACTTTTACACTGTTGG - Intronic
924828870 1:247571827-247571849 CAGGTACACCAATCAAATGTAGG + Intronic
1062789892 10:296415-296437 CAGGGACACTTTTACACTGTTGG + Intronic
1063092898 10:2883888-2883910 CAGGAACACTTATACACTGTTGG + Intergenic
1063338145 10:5236283-5236305 CAGGTACACCAATCTAATGTAGG - Intergenic
1064843122 10:19618446-19618468 AAGGAACACTTATATACTGTTGG - Intronic
1065621758 10:27588825-27588847 CAGGTACACCAATAAAATGTAGG - Intergenic
1066422067 10:35272882-35272904 AAGGAACACTTATACAATGTTGG - Intronic
1067213354 10:44280281-44280303 CAGGGACTCTCATATAATGGAGG + Intergenic
1067825202 10:49566895-49566917 AAGGAACACTTATATACTGTTGG + Intergenic
1068623161 10:59208940-59208962 CAGGTACACCAATCAAATGTAGG - Intronic
1068857010 10:61808101-61808123 AAGGGACAGAAATATAAAGTTGG - Intergenic
1069093326 10:64228612-64228634 CAGGTACACCAATCAAATGTAGG + Intergenic
1070095493 10:73334193-73334215 CAGGTACACTGATATTGTGTAGG - Intronic
1070234302 10:74607859-74607881 CAGGTACACCAATCAAATGTAGG + Intronic
1070709388 10:78667842-78667864 CAGGTACACCAATAAAATGTAGG - Intergenic
1072045040 10:91645674-91645696 CAGGTATACCAATAAAATGTAGG - Intergenic
1072394558 10:95025388-95025410 CAGGTACACCAATGAAATGTAGG + Intergenic
1072493544 10:95933008-95933030 CAGGTACACCAATCAAATGTAGG + Intronic
1073655128 10:105406138-105406160 AAGGGACACTTATACACTGTTGG - Intergenic
1073884329 10:108020622-108020644 CAGGCACAATAATCAAATGTAGG - Intergenic
1073962532 10:108950045-108950067 CAGGTACACTAATCAAATGTAGG - Intergenic
1075983757 10:126765677-126765699 CAGGTACACCAATCAAATGTAGG + Intergenic
1076389956 10:130091929-130091951 CAGGTACACTAGTCAAATGTAGG - Intergenic
1077950266 11:6949362-6949384 CAGGAACACTTTTATACTGTTGG - Intronic
1079262406 11:18896230-18896252 CAGGTACACCAATCAAATGTCGG + Intergenic
1080033446 11:27687033-27687055 CAGGTACACCAATGAAATGTAGG + Intronic
1080366416 11:31579312-31579334 CAGGAACACTTTTATACTGTTGG + Intronic
1080736170 11:35016373-35016395 CATGAGCACTAATATAATTTTGG - Intronic
1080977301 11:37358079-37358101 CAGGTACACCAATCAAATGTAGG - Intergenic
1081363438 11:42206846-42206868 CAGGTACACCAATCAAATGTAGG - Intergenic
1083385372 11:62305261-62305283 CAGGTACACCAATCAAATGTAGG + Intergenic
1083499333 11:63088938-63088960 CAGGGACACCAATTTATCGTAGG - Intronic
1084412301 11:69011936-69011958 CAGGGACACCCACATAATGGAGG - Intronic
1086556786 11:88120363-88120385 CTTGGACACTAAGAAAATGTAGG - Intronic
1086645127 11:89210482-89210504 CAGGTACACGAATCAAATGTAGG - Intronic
1087356698 11:97102648-97102670 CAGGGACACTTTTACACTGTTGG - Intergenic
1087434808 11:98101233-98101255 CAGACACACTAATATAAAGGAGG + Intergenic
1087594264 11:100234171-100234193 CAGGGACACTTTTACACTGTTGG + Intronic
1087703642 11:101465415-101465437 CTGGTACACTAATCTAATGTAGG + Intronic
1088078152 11:105877536-105877558 CAGGTACACCAATCAAATGTAGG + Intronic
1088091046 11:106040393-106040415 AAGGAACACTAATACACTGTTGG + Intergenic
1090415446 11:126537137-126537159 GAGGGTCACTAATATAAGGATGG + Intronic
1091604804 12:1941137-1941159 CAGGTACACCAATCAAATGTAGG + Intergenic
1092640527 12:10503547-10503569 AAGGGACACTGATACACTGTTGG - Intergenic
1092703406 12:11257863-11257885 CAGGTACACCAATCAAATGTAGG - Intergenic
1093544893 12:20335235-20335257 CAGGTACACCAATCAAATGTAGG + Intergenic
1093613179 12:21188043-21188065 CAGGGACTCTTGTCTAATGTGGG + Intronic
1093664313 12:21794174-21794196 CAGGTACACTAATCAAATGTAGG + Intergenic
1093902658 12:24653713-24653735 CAGGTACACCAATCAAATGTAGG + Intergenic
1094407527 12:30133890-30133912 TAGGGAAAATAATATAATCTTGG - Intergenic
1094758010 12:33494086-33494108 CAGGTACACTAGTCAAATGTAGG - Intergenic
1095230214 12:39730779-39730801 CAGGTACACTAATCAAATGTAGG + Intronic
1095855313 12:46854078-46854100 TAGGGACACTTTTATACTGTTGG + Intergenic
1096260969 12:50091237-50091259 CATGAACAGTAATGTAATGTTGG + Intronic
1097460630 12:59857645-59857667 CAGGTACACCAATCAAATGTAGG - Intergenic
1098053088 12:66474341-66474363 CAGGTACACCAATCAAATGTAGG - Intronic
1098680722 12:73350004-73350026 CAGGTACACCAATCAAATGTAGG + Intergenic
1100136432 12:91558300-91558322 CAGGTACACTAATCAAATGTAGG - Intergenic
1100671252 12:96815168-96815190 CAGGAACACTTTTATACTGTTGG - Intronic
1100935394 12:99659513-99659535 CAGTCACAATAATATACTGTAGG + Intronic
1101069697 12:101061509-101061531 CAGGTACACCAATCAAATGTAGG + Intronic
1101687491 12:107039688-107039710 CTGGAACCCTAATGTAATGTTGG + Intronic
1102345412 12:112157833-112157855 CAGGTACACCAATCAAATGTAGG + Intergenic
1105645641 13:22315069-22315091 CAGGTACACCAATCAAATGTAGG + Intergenic
1105769567 13:23595623-23595645 CAGGGACACCAATAAAATGTAGG - Intronic
1106361728 13:29037639-29037661 CAGGTACACCAATCAAATGTAGG + Intronic
1106382098 13:29249423-29249445 CAGGAACACTTATACACTGTTGG - Intronic
1106429582 13:29667090-29667112 CAGGTACACCAATCAAATGTAGG - Intergenic
1106453729 13:29908862-29908884 CAGGGAAACTAATATCTTATTGG + Intergenic
1107455576 13:40551582-40551604 CAGCTTCACTAATATAATTTGGG - Intergenic
1107968697 13:45620992-45621014 CAGGGACACCAATCAAACGTAGG + Intergenic
1108029926 13:46219229-46219251 CAGGTACACCAATCAAATGTAGG + Intronic
1108092495 13:46863794-46863816 AAGGAACACTTATATACTGTCGG + Intronic
1109023207 13:57125942-57125964 CAGGCAAACTAATAAAATTTAGG + Intergenic
1109075571 13:57830800-57830822 CAGGGAAAATAATATAATAGGGG + Intergenic
1109196074 13:59378641-59378663 CAGGTACACCAATCAAATGTAGG - Intergenic
1109293814 13:60505895-60505917 CAGGTACACCAATCAAATGTAGG - Intronic
1109331367 13:60934819-60934841 CAGGGACACTTTTACACTGTTGG - Intergenic
1109608441 13:64730962-64730984 CAGGAACACTATTACACTGTTGG + Intergenic
1109635386 13:65108516-65108538 CAGGTACACTAATCAAATGTAGG + Intergenic
1109986009 13:69985518-69985540 AAGGGAAACTCATATTATGTTGG + Intronic
1110135650 13:72063783-72063805 CAGGTACACCAATCAAATGTAGG - Intergenic
1110890440 13:80691159-80691181 CAGGTACACCAATCAAATGTAGG - Intergenic
1111267940 13:85843822-85843844 CAGGAACACTATTACACTGTTGG + Intergenic
1111474650 13:88728092-88728114 AAGGAACACTTATATACTGTTGG - Intergenic
1111579432 13:90203804-90203826 TAAGAATACTAATATAATGTTGG + Intergenic
1111628114 13:90814716-90814738 CAGGTACACCAATCAAATGTAGG - Intergenic
1111774474 13:92642084-92642106 TAGGGATTGTAATATAATGTAGG + Intronic
1112648511 13:101364101-101364123 CAGGAACACTCATACACTGTTGG + Intronic
1112841578 13:103585641-103585663 CAGGGACACAAAGATAAATTAGG + Intergenic
1112860492 13:103824576-103824598 CAGGGACACTTTTACACTGTTGG - Intergenic
1113697554 13:112356779-112356801 CAGGTACATGAATATAATGGAGG + Intergenic
1114374399 14:22128331-22128353 AAGGAACACTTATATACTGTTGG - Intergenic
1115048543 14:29028007-29028029 CAGGCACACCAATCAAATGTAGG + Intergenic
1115511430 14:34141153-34141175 CAGGTACACCAATCAAATGTAGG - Intronic
1115538213 14:34393027-34393049 CAGGTACACCAATCAAATGTAGG - Intronic
1115912011 14:38267569-38267591 CAGGTACACCAATCAAATGTAGG + Intergenic
1116511740 14:45755243-45755265 CAGGTACACCAATCAAATGTAGG + Intergenic
1116540463 14:46096033-46096055 CAGGGACACTTTTACATTGTTGG - Intergenic
1116679337 14:47945963-47945985 CAGGGAGACTATTATTATGACGG - Intergenic
1116751664 14:48893937-48893959 CAGAGAGATTAATATATTGTAGG + Intergenic
1116775869 14:49179988-49180010 CAGGTACACCAATCAAATGTAGG - Intergenic
1117238121 14:53799685-53799707 CAGGTACACCAATCAAATGTAGG - Intergenic
1117466358 14:55998690-55998712 CAGGTACACCAATCAAATGTAGG + Intergenic
1117822008 14:59659253-59659275 CAGGTACACCAATCAAATGTAGG - Intronic
1118493072 14:66280481-66280503 CAGGGGCACTCAAATAATGCTGG + Intergenic
1119018316 14:71083477-71083499 CAGGTACACCAATCAAATGTAGG + Intronic
1120507564 14:85371560-85371582 CAGGTACACTAATCAAAGGTAGG + Intergenic
1120553963 14:85906545-85906567 CAGGTACACCAATCAAATGTAGG + Intergenic
1120929999 14:89838792-89838814 CAGGATCTCTGATATAATGTTGG - Intronic
1123045877 14:105514134-105514156 AAGGAACACTTATATACTGTTGG + Intergenic
1123834158 15:24170770-24170792 AAGGAACACTTATACAATGTTGG - Intergenic
1123869807 15:24558929-24558951 AAGGAACACTTATACAATGTTGG - Intergenic
1125329849 15:38572217-38572239 CAGGTACACCAATCAAATGTAGG + Intergenic
1126292993 15:47102329-47102351 CAGGCACACAAATAAAATATTGG - Intergenic
1126466349 15:48964634-48964656 TAGGGACAATAAGATAATGAAGG - Intergenic
1126470604 15:49006375-49006397 CAGGTACACCAATCTAACGTAGG + Intronic
1126869554 15:52973063-52973085 CAGGTAGATTAAAATAATGTGGG + Intergenic
1127030169 15:54852550-54852572 CAGGTACACAAATCAAATGTAGG - Intergenic
1127227183 15:56943830-56943852 AGGTGACACTAATACAATGTTGG - Intronic
1130398422 15:83526199-83526221 AAGGAACACTTATATACTGTTGG + Intronic
1130728396 15:86465031-86465053 CAGGTACACCAATCAAATGTAGG + Intronic
1131740888 15:95390190-95390212 CAGGTACACCAATCAAATGTAGG + Intergenic
1135997547 16:27263072-27263094 AAGGGAAACTTATATACTGTTGG + Intronic
1137465159 16:48701166-48701188 AAGGAACACTAATACACTGTTGG - Intergenic
1137707616 16:50546550-50546572 CAGGTACACTAAAATCCTGTTGG - Intergenic
1137828261 16:51518294-51518316 CAGGTACACCAATCAAATGTAGG - Intergenic
1138756732 16:59495249-59495271 GAGGTACATTCATATAATGTAGG - Intergenic
1140884201 16:79228760-79228782 CAGGAAGACGAATATAATGGTGG + Intergenic
1141126667 16:81405512-81405534 TAGGGACACTTTTATACTGTTGG - Intergenic
1142815482 17:2421775-2421797 CAGGGCCACTAAGATCACGTGGG + Intronic
1144428013 17:15163190-15163212 AAGGAACACTTATATACTGTTGG + Intergenic
1146742994 17:35302668-35302690 CAGGTACACAAATCAAATGTAGG - Intergenic
1146746172 17:35332557-35332579 CAGGTACACCAATCAAATGTAGG + Intergenic
1146825782 17:36022159-36022181 CAGGTACACAAATCAAATGTAGG + Intergenic
1148432888 17:47656772-47656794 CAGAGACACTAATATAAGTATGG + Intronic
1148706616 17:49639296-49639318 CAGGGAGACTATCATACTGTTGG + Intronic
1148967547 17:51448502-51448524 CAGGTACACCAATCAAATGTTGG - Intergenic
1149194836 17:54107372-54107394 AAGGAACACTCATATACTGTTGG + Intergenic
1149365602 17:55940491-55940513 CAGGTACACCAATCAAATGTGGG - Intergenic
1150884763 17:69072109-69072131 CAGGTACACCAATAAAATGTAGG - Intergenic
1152500157 17:80702752-80702774 CAGGGACACCAATAAAATTAAGG - Intronic
1156232726 18:35170265-35170287 CAGGAACACTTATACACTGTTGG + Intergenic
1156414992 18:36878641-36878663 CAGGTACACCAATCAAATGTAGG + Intronic
1156626725 18:38918880-38918902 CAGGTACACTAATCAAACGTAGG + Intergenic
1157067147 18:44365611-44365633 CAGGTACACCAATCAAATGTAGG + Intergenic
1157214943 18:45774927-45774949 CAGGAACTTAAATATAATGTTGG - Intergenic
1158644492 18:59232566-59232588 TAGGTACAGGAATATAATGTAGG - Intergenic
1159236719 18:65684107-65684129 CAGGGACCTTAAAATAATGTCGG + Intergenic
1159254871 18:65932450-65932472 CAGGTACACCAATCAAATGTAGG - Intergenic
1160466250 18:79079275-79079297 CAGGAACACTTTTATACTGTTGG - Intronic
1167344718 19:48937992-48938014 CAAGGACACAAATAAAATGGAGG - Intronic
925793485 2:7518034-7518056 CAGGGTAACTGATTTAATGTGGG + Intergenic
926461980 2:13141100-13141122 TAGGGACACTTTTACAATGTTGG - Intergenic
926727268 2:16008372-16008394 CAGGGGCTCTACTAAAATGTTGG + Intergenic
928750812 2:34468024-34468046 CAGGTACACCAATCAAATGTAGG - Intergenic
928895134 2:36253047-36253069 AAGGGCCACTAATATAATAATGG - Intergenic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
930440046 2:51393004-51393026 CAGATACACTAATCAAATGTGGG - Intergenic
930497010 2:52158319-52158341 CAGGGGCATTAACATATTGTGGG - Intergenic
931380302 2:61746649-61746671 AAGGGACACTTATACACTGTTGG + Intergenic
931556136 2:63507948-63507970 CAGGTACACCAATCAAATGTAGG - Intronic
931886558 2:66624615-66624637 CAAGTACACCAATAAAATGTAGG + Intergenic
932383893 2:71312893-71312915 CATGGACCCTTTTATAATGTGGG - Intronic
932748534 2:74355812-74355834 CAGGGATACTAAAATACTTTTGG + Intronic
932943524 2:76198313-76198335 CATAGACACCAGTATAATGTAGG - Intergenic
933361192 2:81287082-81287104 TATGGACCCTATTATAATGTTGG + Intergenic
933488125 2:82949201-82949223 CAGGTACACCAATCAAATGTAGG + Intergenic
934622091 2:95818132-95818154 CAGGAACACTTTTATACTGTTGG - Intergenic
936807906 2:116359379-116359401 CAGGTACACCAATCAAATGTAGG - Intergenic
937147223 2:119657989-119658011 CTGGGACATTAATATAATCATGG + Intronic
939247983 2:139649643-139649665 CAGGTACACCAATCTATTGTAGG - Intergenic
939639525 2:144622399-144622421 AAGGGACACTTACACAATGTTGG - Intergenic
939640689 2:144637298-144637320 CAGGTACACCAATCAAATGTTGG + Intergenic
940030399 2:149256267-149256289 CAGGTACACCAATCAAATGTAGG + Intergenic
940457924 2:153924674-153924696 AAGGGACGCTTATATACTGTTGG - Intronic
941682176 2:168411670-168411692 CAGGTACTCTAATCAAATGTAGG + Intergenic
942953532 2:181749173-181749195 CAGGTACACCAATCAAATGTAGG + Intergenic
943352634 2:186813376-186813398 CAGGTACACCAATAAAATGTAGG - Intergenic
943359499 2:186900738-186900760 CAGGTACACCAATCAAATGTAGG + Intergenic
943375206 2:187068094-187068116 CAGGAACACTTATACACTGTTGG + Intergenic
943891743 2:193296323-193296345 CAGGTACACCAATCAAATGTAGG - Intergenic
944938819 2:204599801-204599823 CAGGAACACTTATACACTGTTGG - Intronic
945129157 2:206548417-206548439 TAGGTACACTTAGATAATGTGGG - Intronic
945927561 2:215820843-215820865 CAGGTACACCAATCAAATGTAGG - Intergenic
946587808 2:221209928-221209950 CATGAACACTAATACACTGTTGG + Intergenic
947483716 2:230526938-230526960 CAGGTACACTAATCAAACGTAGG - Intronic
947596365 2:231414344-231414366 CATGGACACTTTTATAAGGTCGG - Intergenic
1169311011 20:4539990-4540012 CAGAGAAATTAATATAATCTGGG + Intergenic
1169610140 20:7369917-7369939 CAGGAACACTTTTATACTGTTGG - Intergenic
1169908427 20:10626439-10626461 CAGGGACTTGAATATAATTTGGG - Exonic
1177042534 21:16131826-16131848 CAAGGACACCAATAAAATGTAGG + Intergenic
1177092140 21:16782430-16782452 CAGGTACACCAATCAAATGTAGG - Intergenic
1177184030 21:17774374-17774396 CAGGTACACCAATCAAATGTAGG + Intergenic
1178561754 21:33644338-33644360 GAGGGACACTAATTTGATGATGG + Intronic
1179031406 21:37723301-37723323 AAGGGAAACTTATATACTGTTGG + Intronic
1182870460 22:33641895-33641917 CAGGTACACCAATAAAATGTAGG - Intronic
1184949540 22:47831048-47831070 CAGGACAAGTAATATAATGTTGG + Intergenic
949175900 3:1062412-1062434 CAGGTACACCAATCAAATGTAGG + Intergenic
949532224 3:4967268-4967290 CAGGTACACCAATCAAATGTAGG - Intergenic
949580446 3:5382918-5382940 CAGGTACACCAATCAAATGTAGG + Intergenic
949731682 3:7121149-7121171 CAGGAACACTCATTTAAAGTTGG + Intronic
950244491 3:11403721-11403743 CAGGGTCATTAATATGTTGTTGG - Intronic
951167035 3:19494816-19494838 AAGGAACACTTATATACTGTTGG - Intronic
951254341 3:20431745-20431767 CAGGTACACCAATCAAATGTAGG + Intergenic
951311054 3:21126377-21126399 CAGGTACACTAATCAAACGTAGG - Intergenic
952718664 3:36509530-36509552 CAGGTACACCAATCAAATGTAGG + Intronic
953102187 3:39841088-39841110 CAGGTACACCAATCAAATGTAGG + Intronic
953264423 3:41372158-41372180 CAGGTACACCAATCAAATGTAGG - Intronic
953287688 3:41628620-41628642 CAGAGAAACAAATGTAATGTGGG + Intronic
954524231 3:51255495-51255517 CAGGTACACCAATCAAATGTAGG + Intronic
955085927 3:55702843-55702865 CAGGAAAACTAATATAGAGTTGG + Intronic
955811069 3:62790243-62790265 CAGAGATACTACTATAAAGTTGG - Intronic
956207521 3:66770135-66770157 CAGGTACACAAATCAAATGTAGG + Intergenic
956300200 3:67764130-67764152 CAGGTACACCAATCCAATGTAGG + Intergenic
956301757 3:67780219-67780241 CAGGTACACCAATCAAATGTAGG + Intergenic
957475551 3:80717983-80718005 GAGGGAAACTAATATAATTGTGG - Intergenic
957683592 3:83471480-83471502 CAGGGACACTTTTACACTGTTGG + Intergenic
957776653 3:84762525-84762547 CAGGGATACCAATCAAATGTAGG - Intergenic
957811467 3:85228252-85228274 CAGGTACACCAATCAAATGTAGG + Intronic
957839918 3:85654652-85654674 CATGGGCACTAATATTAAGTGGG - Intronic
957993097 3:87652494-87652516 CAGGTACACCAATCAAATGTAGG + Intergenic
959025803 3:101238233-101238255 CAGGTACACCAATCAAATGTAGG - Intronic
959098106 3:101978503-101978525 CAGGGACACTAAGAGGATGGAGG + Intergenic
959354534 3:105308921-105308943 CAGGTACACCAATCAAATGTAGG + Intergenic
959534754 3:107471876-107471898 CAGGTACACCAATCAAATGTAGG - Intergenic
959677501 3:109053147-109053169 AAGGGACACTTACACAATGTTGG + Intronic
959735131 3:109649408-109649430 CAGGTACACCAATCAAATGTAGG - Intergenic
959801150 3:110496542-110496564 CAGGTACACAAATCAAATGTAGG - Intergenic
961020683 3:123503682-123503704 CATGGAAACTAATATAAATTGGG - Intronic
961996575 3:131251397-131251419 CAGGCACACTAAAGTAATGGAGG - Intronic
962157019 3:132958237-132958259 CAGGTACACCAATCAAATGTAGG - Intergenic
962239122 3:133735819-133735841 CAGGTACACAAATCAAATGTAGG - Intergenic
962913281 3:139874866-139874888 AAGGAACACTTATATACTGTTGG + Intergenic
963013822 3:140801908-140801930 CAGGTACACTAATCAAATGTAGG + Intergenic
963804400 3:149708927-149708949 CTGGAACACTAGTATGATGTTGG - Intronic
963998406 3:151738621-151738643 CAGGTACACCAATCTAACGTAGG + Intronic
964010532 3:151886659-151886681 CAGGTACACCAATCAAATGTAGG - Intergenic
964056685 3:152469522-152469544 CAGGGTAACTATAATAATGTGGG + Intergenic
964099514 3:152972155-152972177 CATAGTCAATAATATAATGTTGG - Intergenic
964313869 3:155422902-155422924 AGGGGACACTTATATACTGTTGG + Intronic
964566834 3:158065910-158065932 CAGGTACACCAATCAAATGTAGG - Intergenic
964727228 3:159826032-159826054 CAGGGCCAATAACATAATGCTGG + Intronic
965017196 3:163173291-163173313 CAGGTACACCAATTAAATGTAGG + Intergenic
965025945 3:163302075-163302097 CAGGAACACTTTTACAATGTTGG + Intergenic
965227343 3:166006635-166006657 CAGGAACACTTATACACTGTTGG - Intergenic
966291338 3:178362627-178362649 CAGGTACACCAATCAAATGTAGG - Intergenic
966309581 3:178577891-178577913 CAGGTACACCAATCAAATGTAGG - Intronic
966453580 3:180090299-180090321 CGGGAACACTTATATACTGTTGG - Intergenic
966649927 3:182288900-182288922 AAGGGACACAAAGATATTGTGGG - Intergenic
967594755 3:191316198-191316220 CCGGCACACTAATATGCTGTTGG - Exonic
967637884 3:191825651-191825673 AAGGAACACTTATATACTGTTGG + Intergenic
968024532 3:195428812-195428834 CAGGAACACTCAAATATTGTTGG + Intronic
969111650 4:4848246-4848268 CAGAGATAATAATAAAATGTTGG + Intergenic
969123237 4:4924946-4924968 CAGGTACACCAATAAAATGTAGG + Intergenic
969727626 4:8932197-8932219 CAGGGAAACTAATATATTAAAGG - Intergenic
969970871 4:11046878-11046900 CAGGTACACTAATCAAATGTAGG + Intergenic
970304829 4:14720244-14720266 CAGGTACACCAATCAAATGTAGG - Intergenic
970685393 4:18560944-18560966 CAGGCACACCAATCAAATGTAGG - Intergenic
970851870 4:20613030-20613052 AAGGAACACTTATATACTGTTGG + Intronic
971807650 4:31380900-31380922 TAGGGATACTAGGATAATGTGGG + Intergenic
972219470 4:36937134-36937156 CAGGCACACCAATCAAATGTAGG - Intergenic
972962901 4:44475228-44475250 CAGGTACACCAATCAAATGTAGG - Intergenic
974263809 4:59559124-59559146 CAGGTACACAAATGAAATGTAGG + Intergenic
975638946 4:76479495-76479517 CAGGTACACCAATCAAATGTAGG - Intronic
976370951 4:84287444-84287466 CAGGTACACCAATCAAATGTAGG - Intergenic
976511890 4:85920905-85920927 CAGGAACACTTATACACTGTTGG + Intronic
976716093 4:88123679-88123701 CAGGTACACCAATAAAACGTAGG - Intronic
976809818 4:89088992-89089014 CAGGTACACCAATCAAATGTAGG + Intronic
977185503 4:93931434-93931456 CAGGAACACCAATCAAATGTAGG + Intergenic
977425700 4:96864380-96864402 CAGGTACACCAATCAAATGTGGG - Intergenic
977632825 4:99262425-99262447 CAGGTACACCAATCAAATGTAGG + Intergenic
977774571 4:100901944-100901966 CAGGCACACCAATCAAATGTAGG - Intergenic
977859918 4:101944493-101944515 CAGGGGAACTAATGTAATCTGGG - Intronic
978176408 4:105737203-105737225 AAGGGAAACTTATATACTGTTGG - Intronic
978278176 4:106977367-106977389 CAGGTACACCAATCAAATGTAGG + Intronic
978601250 4:110430796-110430818 CAGGTACACCAATCAAATGTAGG + Intronic
979300285 4:119079153-119079175 CAGGGACACTTTTACACTGTTGG + Intergenic
979417606 4:120462241-120462263 CAGGTACACAAATCAAATGTAGG - Intergenic
979421548 4:120510621-120510643 CAGGTACACCAATCCAATGTAGG - Intergenic
979588089 4:122444934-122444956 CAGGTACACCAATAAAATGTAGG + Intergenic
979698147 4:123637887-123637909 CAAGTACACTAATCAAATGTAGG + Intergenic
979830106 4:125288903-125288925 CAGGAACACTTATACATTGTTGG - Intergenic
980887963 4:138784247-138784269 CAGGTACACCAATCAAATGTAGG + Intergenic
981273329 4:142869227-142869249 CAGGTACACCAATCAAATGTAGG - Intergenic
981481313 4:145242122-145242144 CAGGTACACCAATCAAATGTAGG + Intergenic
981789489 4:148520530-148520552 CAGGTACACCAATCAAATGTAGG + Intergenic
981846671 4:149177358-149177380 CAGGTACACCAATCAAATGTCGG - Intergenic
981901699 4:149872941-149872963 CAGGGACACAAACACAATTTTGG - Intergenic
982794381 4:159628353-159628375 CAGGTACACAAATCAAATGTAGG + Intergenic
982825881 4:160003173-160003195 CAGGTACACCAATCAAATGTAGG - Intergenic
982884409 4:160760302-160760324 ACGGGACACTAATACATTGTTGG + Intergenic
986917487 5:12639867-12639889 CAGGTACACCAATCAAATGTAGG + Intergenic
987270127 5:16299193-16299215 AAGGAACACTTATATACTGTTGG + Intergenic
987957115 5:24754416-24754438 CAGGTACACAAATAAAATGTAGG + Intergenic
989545624 5:42669472-42669494 CAGTGACAGAAATTTAATGTTGG + Intronic
989817640 5:45755966-45755988 TAAGGACACTAAAATAATGTAGG - Intergenic
990803656 5:59633251-59633273 CAGGTACACTAATCACATGTAGG - Intronic
990897436 5:60714542-60714564 CAGGTACACCAATCAAATGTAGG + Intergenic
991223727 5:64244602-64244624 CAGGTACACCAATCAAATGTAGG - Intronic
992038722 5:72807663-72807685 CAGGTACACCAATCAAATGTAGG + Intergenic
992055138 5:72981572-72981594 CAGGTACACCAATCAAATGTAGG + Intronic
993071223 5:83166434-83166456 CAGGAACACTTATATACTGTTGG - Intronic
993265631 5:85722825-85722847 CAGGTACACCAATCAAATGTAGG - Intergenic
993541775 5:89160695-89160717 CAGGTACACTAATCAAATGTAGG - Intergenic
993757480 5:91749840-91749862 CAGGTACACCAATCAAATGTAGG + Intergenic
994005012 5:94827593-94827615 CAGGTACACCAATCAAATGTAGG + Intronic
994256067 5:97597636-97597658 CAGGAACACTTTTATACTGTTGG + Intergenic
995211034 5:109539500-109539522 CAGGTACACCAATCAAATGTAGG - Intergenic
995900670 5:117062569-117062591 GAGGAACACTTATATAATGTTGG + Intergenic
996237342 5:121147791-121147813 AAGGAACACTAATATACTGCTGG - Intergenic
997069809 5:130608301-130608323 CAGGTACACCAATCAAATGTAGG - Intergenic
997170438 5:131713825-131713847 CACTGACACTAATTTACTGTAGG + Intronic
999452862 5:151691476-151691498 CAGGGACCCCAATATACTGATGG - Intergenic
999608043 5:153338085-153338107 CAGGTACACCAATCAAATGTAGG + Intergenic
999965724 5:156807371-156807393 CAGGTACACCAATCAAATGTAGG - Intergenic
1000523916 5:162331827-162331849 TAGGGACACTTTTATATTGTTGG + Intergenic
1001071905 5:168593161-168593183 TAGGGACACTTTTATACTGTTGG - Intergenic
1004808098 6:19226344-19226366 CAGGAACACTTTTATACTGTTGG + Intergenic
1007195789 6:40059113-40059135 AGGGAACACTTATATAATGTTGG + Intergenic
1007767832 6:44171394-44171416 CTGGGTCCCCAATATAATGTGGG + Intronic
1008785261 6:55159851-55159873 CAGGTACACTAATCAAATGTAGG - Intronic
1009264264 6:61533302-61533324 GAGGTACACTAATAAAACGTAGG - Intergenic
1009285531 6:61811565-61811587 AAGGAACACTTATATACTGTTGG - Intronic
1009305746 6:62087820-62087842 CAGGTACACCAATCAAATGTAGG + Intronic
1009509052 6:64525051-64525073 AAGGGAAACTCATATACTGTTGG + Intronic
1009536826 6:64897969-64897991 CAGGTACACCAATCAAATGTAGG - Intronic
1009705377 6:67243349-67243371 CAGATACATTAATATAATTTTGG - Intergenic
1009776028 6:68207137-68207159 AAGGTACACTAATCAAATGTAGG - Intergenic
1009945207 6:70335252-70335274 CAGGTACACCAATCAAATGTAGG + Intergenic
1010360333 6:74986285-74986307 CAAGAACACTAATATAAAATTGG + Intergenic
1010668160 6:78654448-78654470 CAGGGACCCTAATCAATTGTAGG + Intergenic
1011174255 6:84542332-84542354 CAGGTACACCAATCAAATGTGGG - Intergenic
1011296988 6:85836944-85836966 CAGGAACACTTATACAATGCTGG + Intergenic
1011298792 6:85852504-85852526 CAGGTACACCAATCAAATGTAGG + Intergenic
1011340153 6:86305511-86305533 CAGGTACACCAATCAAATGTAGG + Intergenic
1011887615 6:92116713-92116735 CAGGGAAATTAATATTATGAGGG + Intergenic
1012514212 6:100039834-100039856 CAGGTACACCAATCAAATGTAGG - Intergenic
1014386920 6:120814814-120814836 CAGGTACACCAATCAAATGTAGG + Intergenic
1014413253 6:121152628-121152650 CAGGTACACCAATCAAATGTAGG + Intronic
1014466485 6:121762012-121762034 CAGGTACACCAATCAAATGTAGG - Intergenic
1015108431 6:129564832-129564854 CAGGGAGACTAAAATTATGTTGG - Intergenic
1015387119 6:132636635-132636657 CAGGTACACCAATCAAATGTAGG - Intergenic
1015790991 6:136964541-136964563 CAGGGACCCAAATAAAATGAGGG - Intergenic
1016132131 6:140487477-140487499 CAGGGACAACAAAATAGTGTGGG - Intergenic
1016242015 6:141941602-141941624 CAGGTACACCAATCAAATGTAGG - Intergenic
1016494473 6:144644587-144644609 CAGGGAAAAAAATATAAAGTAGG - Intronic
1017204284 6:151788479-151788501 TGGGAACACTTATATAATGTTGG + Intronic
1017388168 6:153909383-153909405 AAGGAACACTCATATACTGTTGG + Intergenic
1017568829 6:155719539-155719561 CAGGAACTCTTATATACTGTTGG + Intergenic
1018388309 6:163323980-163324002 CGGGGAAATTAATAGAATGTAGG + Intergenic
1020338835 7:7087906-7087928 CAGGTACACCAATCAAATGTAGG + Intergenic
1020519429 7:9167984-9168006 CAGGTACACCAATCAAATGTAGG + Intergenic
1020578723 7:9968232-9968254 CAAGGCCACTCATATAAAGTTGG - Intergenic
1020690781 7:11352245-11352267 CAGGTACACTAGTAAAACGTAGG + Intergenic
1020884509 7:13804924-13804946 CAGGTACACCAATCAAATGTAGG - Intergenic
1020928355 7:14360532-14360554 CAGGGAAGTTAATTTAATGTAGG + Intronic
1022058685 7:26769084-26769106 CAGGTACACTAATCAAACGTAGG + Intronic
1023051590 7:36257450-36257472 CAGGTACACCAATCAAATGTAGG + Intronic
1023171500 7:37394125-37394147 CAGGGACACTAATATAATGTTGG + Intronic
1024950364 7:54854644-54854666 CAGGTACACCAATCAAATGTAGG + Intergenic
1026408327 7:70092033-70092055 CTGGCACACTAATATAATTTGGG - Intronic
1027831226 7:83180425-83180447 AAGGGACACTAACATACTGTTGG - Intergenic
1028327169 7:89541478-89541500 CAGGTACACCAATCAAATGTAGG - Intergenic
1028786112 7:94795888-94795910 CAGGTACACCAATCAAATGTAGG - Intergenic
1028801246 7:94968768-94968790 CAGGTACACTAATCAAATGTAGG + Intronic
1029850950 7:103461371-103461393 CAGGTACACCAATCAAATGTAGG + Intergenic
1030705486 7:112688800-112688822 CAGGTACACCAATCAAATGTAGG + Intergenic
1030801487 7:113857781-113857803 CAGGTACACCAATCAAATGTAGG - Intergenic
1031031954 7:116744553-116744575 CAGGTACACCAATCAAATGTAGG - Intronic
1031084938 7:117293133-117293155 CAGAGAAACTTATATAATTTCGG + Intronic
1031397587 7:121292137-121292159 CAGGTACACCAATCAAATGTAGG + Intronic
1034714955 7:153233630-153233652 CAGGTCCACTAATCAAATGTAGG + Intergenic
1035696361 8:1600500-1600522 CAGGTACATTAATCTAATGTAGG + Intronic
1036558156 8:9878103-9878125 CAGGTACACCAATCAAATGTAGG - Intergenic
1037120430 8:15279340-15279362 CAGGGACATTGATATGCTGTTGG - Intergenic
1039285075 8:36030595-36030617 GAGTGACACTATTATTATGTGGG - Intergenic
1039754690 8:40511056-40511078 CAGGTACACCAATCAAATGTAGG + Intergenic
1039859881 8:41447997-41448019 CTGGGACACTGAGAAAATGTGGG - Intergenic
1040976729 8:53201563-53201585 CAGGTACACCAATCAAATGTAGG - Intergenic
1041245208 8:55882219-55882241 CAATGACTCTAAAATAATGTAGG - Intronic
1041371720 8:57167962-57167984 CAGGCACACTAAAACATTGTTGG - Intergenic
1041560281 8:59209706-59209728 AGGGAACACTAATATGATGTTGG - Intergenic
1041630415 8:60081575-60081597 CAGGTACACCAATCAAATGTAGG + Intergenic
1042195744 8:66230031-66230053 CAGGTACACCAATCGAATGTAGG - Intergenic
1042360336 8:67875876-67875898 AAGGAACACTTATATACTGTTGG + Intergenic
1043532588 8:81167177-81167199 CAGGTACACCAATCAAATGTAGG - Intergenic
1044101379 8:88144581-88144603 GAGAGAGACTAATATAATATGGG + Intronic
1044940096 8:97333770-97333792 CAGGTACACCAATCAAATGTAGG + Intergenic
1045140971 8:99281843-99281865 CAGGGTCAATAACATAATCTTGG - Intronic
1045327128 8:101125940-101125962 CAGGGGCACTTATTAAATGTAGG + Intergenic
1045554250 8:103200226-103200248 AAAGGACACTTATATACTGTTGG + Intronic
1045688452 8:104735835-104735857 CAGGAAGACTAATATAATAGAGG + Intronic
1046049059 8:108999336-108999358 CAGGGAGTGTGATATAATGTTGG - Intergenic
1046277956 8:111987092-111987114 CAGGTACACCAATCAAATGTAGG - Intergenic
1046562291 8:115853102-115853124 CAGGAACACTTTTACAATGTTGG - Intergenic
1046988453 8:120418480-120418502 CAGGCACACTTATACATTGTTGG - Intronic
1048957042 8:139545852-139545874 CAGGGACACTTATACAGTCTTGG - Intergenic
1050300336 9:4252233-4252255 CAGGTACACCAATCAAATGTAGG + Intronic
1050730295 9:8701743-8701765 CAGGGAGATTAAAATAATTTGGG - Intronic
1050765660 9:9130237-9130259 TAGGGAAACTAATTTAATGATGG + Intronic
1051619717 9:19038134-19038156 CAGGGACACTTTTACACTGTTGG + Intronic
1052114625 9:24635226-24635248 CAGGAACACTTTTATATTGTTGG - Intergenic
1052281067 9:26734194-26734216 CAGGTACACCAATCAAATGTAGG + Intergenic
1052382180 9:27783832-27783854 CAGGTACACCAATCAAATGTAGG + Intergenic
1052415187 9:28168741-28168763 CAAGGACCCTAATACAATTTAGG - Intronic
1052627754 9:30999548-30999570 CAGGAACACTTTTATACTGTTGG - Intergenic
1054821781 9:69529444-69529466 CAGGAAAAGAAATATAATGTGGG + Intronic
1055099571 9:72449334-72449356 CAGTGACACGAATAGAATCTAGG + Intergenic
1055352836 9:75406924-75406946 TAGGGATACAAATATTATGTGGG + Intergenic
1055910770 9:81348233-81348255 AAGGGACTCTTATATACTGTTGG - Intergenic
1058021439 9:100093901-100093923 CAGGGAAACTATTACATTGTTGG + Intronic
1058428377 9:104896227-104896249 CAGTTAAATTAATATAATGTGGG + Intronic
1059185345 9:112264120-112264142 CAGGAAAACAAATTTAATGTGGG + Intronic
1060251493 9:121989793-121989815 GAGGGAAAACAATATAATGTCGG - Intronic
1187078279 X:15958329-15958351 CAGGGACACTTTTACACTGTTGG - Intergenic
1188129859 X:26418390-26418412 CAGGTACACCAATTAAATGTAGG + Intergenic
1188345038 X:29053492-29053514 AAGGAACACTTATATACTGTTGG - Intronic
1188561088 X:31469797-31469819 CAGGTACACCAATCAAATGTAGG + Intronic
1188921768 X:35986233-35986255 CAGGTACACCAATCAAATGTAGG + Intronic
1189574947 X:42341993-42342015 CAGGTACACCAATCAAATGTAGG + Intergenic
1190506041 X:51126735-51126757 CAGGTACACCAATCAAATGTAGG - Intergenic
1190995541 X:55605144-55605166 CAGGTACACCAATCTATTGTAGG + Intergenic
1191024418 X:55897885-55897907 CAGGTACACCAATCAAATGTAGG - Intergenic
1191206852 X:57843591-57843613 CAGGTACACCAATCAAATGTAGG - Intergenic
1191725634 X:64277855-64277877 CAGGTACACCAATCAAATGTAGG + Intronic
1191848441 X:65567949-65567971 CAGGTACACCAATCAAATGTAGG + Intergenic
1191931212 X:66375268-66375290 CAGGTACACCAATAAAATGCAGG + Intergenic
1192018605 X:67359263-67359285 CAGGTACACCAATCAAATGTAGG - Intergenic
1192228611 X:69247426-69247448 CAGGTACACCAATCAAATGTAGG - Intergenic
1192273520 X:69607238-69607260 CAGGCACACTCTTATAATTTGGG - Intergenic
1192386299 X:70674513-70674535 AAGGAACACTTATATACTGTTGG - Intronic
1192545423 X:72008847-72008869 CAGGGATACTAAAATAATCCAGG - Intergenic
1192662282 X:73053887-73053909 CAGGTACACCAATCAAATGTAGG - Intergenic
1192674721 X:73183894-73183916 CAGGTACACCAATCAAATGTAGG - Intergenic
1192931957 X:75815695-75815717 CAGGTACACTAATCAAACGTAGG - Intergenic
1193284475 X:79695908-79695930 CAGGTACACCAATCAAATGTAGG + Intergenic
1193350981 X:80464000-80464022 CAGGTACACCAATCAAATGTAGG - Intergenic
1193858602 X:86637273-86637295 AAGGAACACTTATATACTGTTGG + Intronic
1193960465 X:87918952-87918974 AAGGAACACTTATATACTGTTGG + Intergenic
1193971128 X:88055021-88055043 CAGGGACACTTTTACACTGTTGG + Intergenic
1194029975 X:88801151-88801173 CAGGTACACCAATCAAATGTAGG - Intergenic
1194229027 X:91299177-91299199 CAGGTACACCAATCAAATGTAGG + Intergenic
1194245417 X:91505599-91505621 AAGGAACACTTATATACTGTTGG + Intergenic
1194484168 X:94466608-94466630 AGGGGACACTAATACACTGTTGG + Intergenic
1194515187 X:94843815-94843837 CAGGTACACCAATCAAATGTAGG + Intergenic
1194559665 X:95404441-95404463 CAGGTACACTAATTAAATGTAGG - Intergenic
1195985734 X:110627831-110627853 CAGGTACACCAAAAAAATGTAGG - Intergenic
1196273014 X:113734627-113734649 CAGGTACACCAATCAAATGTAGG + Intergenic
1196530264 X:116778325-116778347 AAGGGACACTTATACACTGTTGG + Intergenic
1196602795 X:117621709-117621731 CAGGTACACCAATCAAATGTAGG + Intergenic
1196988326 X:121299488-121299510 CAGGGACACTTTTACACTGTTGG - Intergenic
1197098179 X:122620471-122620493 CAGGTACACCAATTAAATGTAGG + Intergenic
1197880609 X:131163036-131163058 CAGGTACACCAATCAAATGTAGG + Intergenic
1198519160 X:137434883-137434905 CAGGTACACCAATCAAATGTAGG - Intergenic
1199119290 X:144031880-144031902 CAGTGGCATAAATATAATGTTGG + Intergenic
1200381007 X:155837302-155837324 AGGGAACACTAATATACTGTTGG + Intergenic
1200564386 Y:4746903-4746925 AAGGAACACTTATATACTGTTGG + Intergenic
1200762182 Y:7049483-7049505 CAGGAACACTTTTATACTGTTGG - Intronic
1201543327 Y:15133005-15133027 CAGGTACACCAATCAAATGTAGG - Intergenic