ID: 1023172503

View in Genome Browser
Species Human (GRCh38)
Location 7:37403414-37403436
Sequence CCAGGGGTTTGGAGGCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 444}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023172491_1023172503 7 Left 1023172491 7:37403384-37403406 CCCCCAACTCTGAAAAAAAATCA 0: 1
1: 0
2: 6
3: 108
4: 1188
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444
1023172489_1023172503 28 Left 1023172489 7:37403363-37403385 CCTGGGCAACACAGTGAAATCCC 0: 33
1: 931
2: 8600
3: 56202
4: 207476
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444
1023172493_1023172503 5 Left 1023172493 7:37403386-37403408 CCCAACTCTGAAAAAAAATCACT 0: 1
1: 1
2: 4
3: 54
4: 792
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444
1023172494_1023172503 4 Left 1023172494 7:37403387-37403409 CCAACTCTGAAAAAAAATCACTG 0: 1
1: 0
2: 3
3: 53
4: 446
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444
1023172490_1023172503 8 Left 1023172490 7:37403383-37403405 CCCCCCAACTCTGAAAAAAAATC 0: 1
1: 0
2: 3
3: 55
4: 451
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444
1023172492_1023172503 6 Left 1023172492 7:37403385-37403407 CCCCAACTCTGAAAAAAAATCAC 0: 1
1: 0
2: 4
3: 100
4: 1179
Right 1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG 0: 1
1: 1
2: 4
3: 36
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023172503 Original CRISPR CCAGGGGTTTGGAGGCCAGG AGG Intronic
900094085 1:933355-933377 CCAGGGGCGGGGAGGGCAGGTGG + Intronic
900180015 1:1307278-1307300 CCAGGGGCTTGGAGGGGTGGCGG - Intronic
900193989 1:1364701-1364723 CCAGGATTATGGAGACCAGGCGG + Intergenic
900289330 1:1917245-1917267 CCGGGGGAGTGGGGGCCAGGGGG - Exonic
900461524 1:2804348-2804370 TCAGGTGTCTGGAGGGCAGGGGG - Intergenic
900507737 1:3038158-3038180 GCAGAGGTTCCGAGGCCAGGAGG + Intergenic
900520801 1:3104687-3104709 CTAGGGGTTTGTAGCCCAGAGGG - Intronic
900547597 1:3237247-3237269 CCTGGGGTTGGGAAGCCTGGGGG - Intronic
901004443 1:6165184-6165206 CCTGGGGGCTGGGGGCCAGGGGG - Intronic
901051739 1:6428910-6428932 CCAGGGGCTCTGGGGCCAGGAGG - Intronic
901159549 1:7164423-7164445 CTAGGGGTTTGATGGGCAGGTGG + Intronic
901173255 1:7279627-7279649 GCATGGGGTCGGAGGCCAGGAGG - Intronic
901473174 1:9471853-9471875 CCAGGTGGTTGCAGGGCAGGGGG + Intergenic
901517125 1:9755422-9755444 CCAGGGGTTTGGAGGGTCCGTGG + Intronic
901526276 1:9824824-9824846 CCAGGGGTCCAGAGGCGAGGAGG - Intergenic
901626988 1:10630158-10630180 CCAGGCGAGAGGAGGCCAGGTGG - Exonic
902555481 1:17244314-17244336 CCAAGAGAATGGAGGCCAGGTGG - Exonic
902872868 1:19324849-19324871 TCAGGGTTCTGGAGACCAGGCGG - Intronic
903013846 1:20349221-20349243 CCTGGGTTTTGGAGGCCAATGGG - Intronic
905293885 1:36942094-36942116 CCTGGGGTTGGGAGACCTGGAGG + Intronic
907475102 1:54700249-54700271 CCAGTGCATGGGAGGCCAGGGGG + Intronic
907738857 1:57143185-57143207 GCAGGGGTTGGGAGAACAGGGGG + Intronic
907763987 1:57390012-57390034 ACATTGGTTTGGGGGCCAGGTGG - Intronic
908265746 1:62377601-62377623 CCAGAGGTTGGGCGGCAAGGAGG - Intergenic
908329727 1:63059273-63059295 GCATGAGTTTGGAGGCCAGATGG - Intergenic
908477800 1:64505962-64505984 CCCGGGGTTTGCAGGGCAAGAGG - Intronic
909502308 1:76348490-76348512 CCAGTGGTTTGGATGATAGGAGG - Intronic
910136143 1:83972267-83972289 CCAGGGGTTGGGAGGGAATGGGG - Intronic
910265527 1:85333130-85333152 CCTGGGGATAGGACGCCAGGTGG - Intronic
910347913 1:86262413-86262435 CCAGGAGCTTGGAGACCAGCCGG - Intergenic
910805105 1:91181933-91181955 TCATGGCTCTGGAGGCCAGGAGG + Intergenic
910830090 1:91452253-91452275 GGAGGGGTTTGGGGGCAAGGGGG - Intergenic
911707537 1:101031071-101031093 CCAGGGGTACGGAGACGAGGAGG - Intergenic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
912748529 1:112266314-112266336 CCAGGAGCTTTGAGGACAGGAGG - Intergenic
913371248 1:118102217-118102239 CCAGTGGTTTGAAGGCAGGGCGG + Intronic
914287073 1:146236854-146236876 AAAGGGCTTTGGAGGGCAGGAGG + Intergenic
914548105 1:148687596-148687618 AAAGGGCTTTGGAGGGCAGGAGG + Intergenic
915743597 1:158139260-158139282 CCAGGGTTCTGAAGGCCAAGAGG + Intergenic
915977495 1:160400649-160400671 CCCGGGGGCTGGGGGCCAGGGGG - Exonic
916606052 1:166343295-166343317 CCCGGGGCTTGCAGGCCAGCCGG + Intergenic
919997173 1:202763218-202763240 CCAGGAATTTGGAGACCAGGAGG - Intronic
920436122 1:205948146-205948168 TCAGGGCTTGGGAGCCCAGGAGG + Intergenic
920693545 1:208164725-208164747 CCAGGGATCTGAAGGCGAGGAGG - Intronic
921741462 1:218690265-218690287 CCAGGGGTGTGAATGCCAAGAGG + Intergenic
922230283 1:223679854-223679876 CCAGCACTTTGGAAGCCAGGTGG - Intergenic
922730238 1:227945703-227945725 CCAGGGCATTAAAGGCCAGGCGG - Intronic
922801939 1:228368448-228368470 CCTGGGGCCTGCAGGCCAGGTGG + Intronic
923085480 1:230700340-230700362 CCAGTGGTTAGGAGGGAAGGAGG + Intergenic
923232393 1:231999486-231999508 GAAGGGAGTTGGAGGCCAGGAGG - Intronic
923319838 1:232820287-232820309 GCAGGAGATTGGAGGGCAGGAGG + Intergenic
923782888 1:237042052-237042074 CCTCGGGTTTGGCGGCCCGGAGG + Intergenic
924428215 1:243973198-243973220 CCGGGGGTTTGGTGGAAAGGAGG + Intergenic
1062911475 10:1215127-1215149 CCAAGGGGCTGGAGGTCAGGGGG - Intronic
1063951480 10:11227179-11227201 CCAGGAGTTTTCAGGGCAGGAGG - Intronic
1065634935 10:27722199-27722221 CCATGGGGTAGGAGGCCAAGAGG - Intronic
1067432743 10:46254588-46254610 CTATAGGTTAGGAGGCCAGGGGG - Intergenic
1067529071 10:47057481-47057503 CCAGGGGTTGGGGGGACAGAGGG + Intergenic
1067539527 10:47141704-47141726 GCAGGAGGTGGGAGGCCAGGTGG + Intergenic
1067725951 10:48771093-48771115 CCATGTGTTTGGAAGGCAGGCGG + Intronic
1067897180 10:50195890-50195912 CCAGGGGCTAGGAGGTTAGGGGG + Intronic
1067951787 10:50746145-50746167 CCAGGGGCTAGGAGGTTAGGGGG - Intronic
1068756945 10:60666382-60666404 CCAGGGGCTGGGAGGGGAGGGGG + Intronic
1069163814 10:65123859-65123881 TCAGAGTTTTGAAGGCCAGGAGG - Intergenic
1069605450 10:69736154-69736176 CCAGGGGTTTGGATACCAGGAGG + Intergenic
1069907108 10:71738436-71738458 CCAGGTGTTTGGGGCCAAGGAGG + Intronic
1070919653 10:80176614-80176636 CCAGGACTTTGGGGGCCAGACGG - Intronic
1071415277 10:85435570-85435592 CCAGGGGTTAGGAGGACCTGTGG + Intergenic
1071503960 10:86221931-86221953 ACAGGGGTAGGGAGGGCAGGGGG + Intronic
1072695775 10:97601793-97601815 CCAGGGCTTGGGATGCCTGGAGG + Intronic
1072742272 10:97916546-97916568 CCAGGTGTCTGGAGGCAGGGTGG + Intronic
1074405770 10:113179160-113179182 CCAAAGCTTTGGAGGCCATGAGG - Intergenic
1074894575 10:117763854-117763876 CCAGGGATCTGAGGGCCAGGTGG - Intergenic
1075339311 10:121632903-121632925 CAGTGGGTTTGCAGGCCAGGAGG + Intergenic
1076446218 10:130516078-130516100 ACAGGGGTTTGCAGGACAGGAGG - Intergenic
1076594604 10:131617860-131617882 TCGGGGGTTGGGGGGCCAGGAGG + Intergenic
1077300179 11:1843099-1843121 CCAGGGTGTAGGAGGCCATGAGG + Intergenic
1077338191 11:2014667-2014689 CGAGGGGGTGGGTGGCCAGGGGG - Intergenic
1077367543 11:2167204-2167226 CCAGGGGATAGGGGGCCATGAGG + Intronic
1077377893 11:2214084-2214106 CCAGGGGTTAGGGAGGCAGGAGG - Intergenic
1077463604 11:2723035-2723057 GCACGGGAATGGAGGCCAGGAGG - Intronic
1077501199 11:2910502-2910524 CCCTGGGTGTGGAAGCCAGGGGG + Intronic
1077506444 11:2931890-2931912 GCAGGAGCTGGGAGGCCAGGGGG + Intergenic
1077635927 11:3841181-3841203 CCAGGGGTAGGGTGGCCAGGAGG - Intergenic
1078114154 11:8428166-8428188 CCTAGAGTTTGGAGGCCAAGAGG + Intronic
1079233644 11:18671405-18671427 TGTGGGGGTTGGAGGCCAGGTGG + Intergenic
1079708683 11:23653412-23653434 CCCGGGGTTTGCAGGCCGGCCGG + Intergenic
1081675572 11:44967103-44967125 ACAGGGGTCTGGAGCCCTGGAGG + Intergenic
1082105305 11:48215156-48215178 CAAGGGGTCTGGTGGCCTGGAGG - Intergenic
1083235440 11:61347974-61347996 ACGGGGGTTGGGAGGGCAGGAGG - Exonic
1083326790 11:61877007-61877029 CCGGAGGTCTGGAGGCCTGGTGG + Intronic
1083847670 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG + Intronic
1083902555 11:65650667-65650689 CCAGCTGCTTGGAGGCCAGGAGG - Exonic
1084392129 11:68884327-68884349 CCAGGAGTTTTGAGTCCAGCTGG - Intergenic
1084506087 11:69569445-69569467 CCAGCGGTGGGGAAGCCAGGAGG + Intergenic
1087130879 11:94668509-94668531 CCAGGGGGCTGGGGGCCGGGGGG - Intergenic
1087417770 11:97879877-97879899 CCTGGAGGTTGGAGGGCAGGAGG - Intergenic
1088534085 11:110840723-110840745 CCAGGGGAGAGTAGGCCAGGTGG + Intergenic
1088839434 11:113611518-113611540 CCAGTACTTTGGAGCCCAGGCGG - Intergenic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089227260 11:116935915-116935937 ACAGGAGTTTGGAGCTCAGGAGG - Intronic
1089635221 11:119807616-119807638 ACTGGGTTTTGGAGGCCAAGGGG + Intergenic
1090199921 11:124846501-124846523 CCAGGGCTGTGGAGGCCCGGGGG + Intergenic
1090668615 11:128930860-128930882 CCGGGGTTAGGGAGGCCAGGGGG + Intergenic
1090969596 11:131628894-131628916 CCAGGGCTGTGGAGTACAGGCGG + Intronic
1091334251 11:134754601-134754623 CCAGGTGGGTGGAAGCCAGGTGG - Intergenic
1202821175 11_KI270721v1_random:69849-69871 CGAGGGGGTGGGTGGCCAGGGGG - Intergenic
1091461547 12:647052-647074 ACAGGGGTAGGGAGGGCAGGGGG - Intronic
1091695741 12:2627051-2627073 CCAGGCGGGTGGAGGCGAGGGGG - Intronic
1091728843 12:2864985-2865007 CCAGGGGTGTTGAGGACACGTGG - Intronic
1092867361 12:12775280-12775302 CCAGGGGTTAGGAGGGAGGGAGG + Intronic
1094671026 12:32569438-32569460 GCTGGGGTCTGGAGGCCAGCAGG - Intronic
1095976938 12:47946476-47946498 CCAGGGCTTGGGTGGGCAGGAGG - Intergenic
1096157187 12:49347249-49347271 GCAGAGGGTTGGAGGGCAGGAGG - Exonic
1096297115 12:50393171-50393193 CCAGCACTTTGGAGGCGAGGCGG - Intronic
1096867838 12:54575769-54575791 TCCTGGGTTAGGAGGCCAGGGGG + Intronic
1099030246 12:77517390-77517412 CCTGGGGATTGAAGGCCATGTGG + Intergenic
1101509571 12:105380564-105380586 TCAGAGGTTTGGATGCCAGAAGG - Intronic
1102319993 12:111924893-111924915 CCAGGGGTTTGGAGAGAAAGAGG + Intergenic
1102590092 12:113950390-113950412 CCAGGAGTTGGAAGCCCAGGAGG + Intronic
1102819691 12:115897299-115897321 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819700 12:115897335-115897357 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1102819709 12:115897371-115897393 CCCTGAGTCTGGAGGCCAGGTGG + Intergenic
1104702640 12:130918667-130918689 CAGGTGGTTTGGGGGCCAGGTGG + Intergenic
1104749044 12:131226996-131227018 CCAGGGGCCTGGACACCAGGGGG - Intergenic
1105413561 13:20191635-20191657 CCCAGGGTCGGGAGGCCAGGAGG - Intronic
1105580346 13:21689913-21689935 CCAGGATTTAGGAGGCCAGGAGG - Intronic
1106225766 13:27785610-27785632 CCAGGGGCTGGGAGGAGAGGAGG + Intergenic
1106832765 13:33602875-33602897 CCAGGGGTTGGGGGACCAGGGGG - Intergenic
1108344322 13:49530046-49530068 CCATGTGTTTGGTGGCCATGAGG + Intergenic
1109923714 13:69106139-69106161 CCTTGGGTTTGGTGGACAGGTGG - Intergenic
1110819837 13:79901488-79901510 TCTGGGGGTTTGAGGCCAGGGGG + Intergenic
1113856013 13:113445860-113445882 CCAGGGGTTTGCAGCCATGGGGG - Intronic
1113906347 13:113821069-113821091 CCGGGGGTGGGGGGGCCAGGCGG - Intronic
1113923331 13:113926949-113926971 TCAGGGCTTTTGAGGCCTGGAGG + Intergenic
1114796978 14:25727237-25727259 TCAGGGGTGTGGGGGCCTGGGGG - Intergenic
1115203915 14:30880962-30880984 CCAGCACTTTGGAGGCCAAGTGG + Intronic
1116900949 14:50362024-50362046 CCCGGGGCTTGTGGGCCAGGGGG - Intronic
1117007426 14:51436034-51436056 ACAGGTGTTTGGGGGCCATGTGG - Intergenic
1118385219 14:65250633-65250655 CCAGGAGTTTTGAGTCCAGCTGG + Intergenic
1119026548 14:71157261-71157283 GCAAGGGTTTGGATGCAAGGAGG - Intergenic
1119171142 14:72537218-72537240 CCTGGGGCTGGGAGTCCAGGAGG - Intronic
1121341960 14:93110776-93110798 CCAGAGACTTGGAGGCCAGCTGG - Intronic
1121499621 14:94424121-94424143 TCAGAAGTTTGGAAGCCAGGAGG + Intergenic
1121774927 14:96584267-96584289 CAAGGGCATTGGTGGCCAGGTGG + Intergenic
1121929743 14:97961626-97961648 TTAGGGGTTTGGTGGCAAGGAGG + Intronic
1122280712 14:100620687-100620709 ACCGGGCTTTGGAGGCCAGCAGG + Intergenic
1122817010 14:104318900-104318922 ACAGGGGCCAGGAGGCCAGGAGG - Intergenic
1122843057 14:104476090-104476112 GGAGGGGTTGGGAGTCCAGGGGG - Intronic
1122855822 14:104559650-104559672 TCAGGGGGTGGGAGACCAGGAGG + Intronic
1122913156 14:104843587-104843609 CCCGGGGGACGGAGGCCAGGAGG - Intergenic
1202923422 14_KI270724v1_random:4250-4272 CCAGGAGCATGGACGCCAGGTGG + Intergenic
1123476913 15:20597079-20597101 CAAGGGCTCTGGAGGCCTGGAGG + Intergenic
1123641098 15:22403285-22403307 CAAGGGCTCTGGAGGCCTGGAGG - Intergenic
1123795219 15:23764054-23764076 CCAGGGGTTTGGGGACATGGAGG - Intergenic
1124665406 15:31587735-31587757 CCAAGGGCCTGGAGGCCATGGGG - Intronic
1124890316 15:33726309-33726331 CCAGAGGTTTGGAGGTGGGGTGG + Intronic
1125589432 15:40845016-40845038 CCAGGGCTTTGGAGGTGAGGAGG + Exonic
1125594096 15:40873501-40873523 CCTGGGGTGGGAAGGCCAGGTGG + Exonic
1128239836 15:66094374-66094396 TCTGGGGTTTGGGGGTCAGGAGG - Intronic
1128323304 15:66707055-66707077 CCACGGGCTGGGAGGCCAGGAGG - Intronic
1128934587 15:71734481-71734503 CCAGGGGCTGGGAGGACAGAGGG + Intronic
1129248148 15:74292599-74292621 CCTGGGATTTGGAGGCAAGGTGG - Intronic
1129263545 15:74382157-74382179 CCAGGGAAGTGGAGGGCAGGTGG + Intergenic
1129879289 15:78996424-78996446 CCAGGGGTCTGCAGGCCTGCCGG + Intronic
1130017219 15:80196825-80196847 ACAGGAGATTGGAGGGCAGGAGG + Intergenic
1130053420 15:80502789-80502811 CCAGGGGGTTGGAGATTAGGAGG + Intronic
1130989546 15:88868108-88868130 CCAGGGGTCTGGAGAGCAGCAGG + Intronic
1131047544 15:89325767-89325789 CCAGGGCTTTGGAGGGTGGGTGG - Intronic
1131284399 15:91045121-91045143 CCCTGGGTTTGGAGAGCAGGAGG + Intergenic
1131427214 15:92355427-92355449 GAAGGGGTTTGGAGGCATGGAGG - Intergenic
1132671042 16:1102479-1102501 CGCGGGGTTTCGAGGCCTGGGGG - Intergenic
1132672143 16:1106353-1106375 CCAGGGGTTGGGGGGCCATGGGG - Intergenic
1133056288 16:3147138-3147160 GCAGGCGGTGGGAGGCCAGGTGG + Intronic
1133279914 16:4659429-4659451 CCATGGGTTTGCAGGTGAGGTGG + Intronic
1135424669 16:22326330-22326352 CCAGCTGTTGGGAGGCCACGTGG + Intronic
1135991540 16:27221607-27221629 CTGGGGGATTTGAGGCCAGGGGG + Intronic
1136080226 16:27847469-27847491 CCAGGAGTGTTGAGTCCAGGGGG + Intronic
1136319032 16:29470636-29470658 CCAGAGCTTTGGAGGCCCAGTGG - Intergenic
1136433603 16:30209980-30210002 CCAGAGCTTTGGAGGCCCAGTGG - Intergenic
1137270622 16:46900338-46900360 TCAGGGGTTTGCAGAGCAGGGGG - Intronic
1137690756 16:50425570-50425592 CCACGGGTTTCCAGGCCAGCAGG - Intergenic
1138258217 16:55589173-55589195 CTAGGGGTTTCGTGGCCAGCAGG - Intergenic
1139669866 16:68485367-68485389 CCAGGTGGTGGGTGGCCAGGTGG - Intergenic
1139955442 16:70690877-70690899 CCAGGGCATTGAAGGCTAGGGGG + Intronic
1141172633 16:81700889-81700911 ACAGGGATTCGGAGGCCATGGGG + Intronic
1141473891 16:84258906-84258928 CCAGGGGTTTGGAGGGTGTGGGG - Intergenic
1142137577 16:88458703-88458725 CCACGGGTATGGTGGCCAGGTGG - Intronic
1142152014 16:88516843-88516865 CCAGGCCTGTGGAGGCCAGCGGG - Intronic
1142590954 17:1005849-1005871 CTAGAGGTATGGAGGGCAGGAGG + Exonic
1142682929 17:1561263-1561285 CCAGGGGACTGGGGGACAGGTGG - Intronic
1143264180 17:5623415-5623437 CCAGGGGAGTGCAGCCCAGGGGG + Intergenic
1143412116 17:6715594-6715616 TCAGGGGGTTGGAGGGCAAGGGG - Intergenic
1143590656 17:7884642-7884664 CCGGGGGTTTGGGGGGCTGGGGG + Intronic
1145260177 17:21349867-21349889 CCAGGTGTTTGGAGCTCAGAGGG + Intergenic
1145712817 17:26992505-26992527 GCAGGGGGTTTGAAGCCAGGTGG + Intergenic
1146341216 17:32021251-32021273 CCAGGGGGTTAGAGGTCAGCTGG - Exonic
1147200775 17:38799770-38799792 CGAGGCGTTCGGAGGCCAGGCGG - Exonic
1147671559 17:42179867-42179889 CCAATGGGTGGGAGGCCAGGGGG + Intronic
1147944009 17:44070161-44070183 GCAGGGTTTTGGATGGCAGGAGG + Intergenic
1148361673 17:47017333-47017355 CCAGGGGGTTAGAGGTCAGCTGG - Intronic
1148698059 17:49573007-49573029 CCAGGGGCTAGGAGGACAGGTGG - Intergenic
1148865938 17:50628603-50628625 CCTGGGGTTTGAAGGCCCTGGGG - Intergenic
1149462386 17:56840625-56840647 CCAGGATTTGGGAGGCCAGGCGG - Intronic
1150405470 17:64897095-64897117 CCAGGGGGTTAGAGGTCAGCTGG + Exonic
1150478513 17:65491806-65491828 CCAGGGGTTTTGAAGCCACAAGG + Intergenic
1151571976 17:74931008-74931030 CCCGGGGTTGGGTGGGCAGGCGG - Exonic
1152458859 17:80431004-80431026 CCTGGGATCTGGAGGCCAGCCGG - Intronic
1152789838 17:82273120-82273142 CCAGGGGTGGGGAGGGCAGTGGG - Intronic
1152844063 17:82588480-82588502 GCAGGCGGTTGGAGGGCAGGCGG + Intronic
1153045020 18:848095-848117 CCAGGGGCTTTGAGGCCATCAGG + Intergenic
1153598506 18:6754810-6754832 CCAAGGGTAAGGAGGTCAGGGGG + Intronic
1153778591 18:8475383-8475405 CAAGAGGTGTGGGGGCCAGGTGG - Intergenic
1155307933 18:24497614-24497636 CCAGGGATTTAGGGCCCAGGAGG - Intergenic
1155335359 18:24758441-24758463 CCAGGGGTCAGGAGTCGAGGAGG - Intergenic
1156295806 18:35790009-35790031 TCATGGGTTAGGAGTCCAGGTGG + Intergenic
1156486361 18:37468412-37468434 GCAGGGGTTGGGAAGCCAGGAGG + Intronic
1157878330 18:51294380-51294402 CAAGGGGTTTGGAAGCATGGGGG + Intergenic
1158543142 18:58374743-58374765 CCAGGGGACTGGAGACCAGTGGG - Intronic
1159913379 18:74167061-74167083 CAGGGGTTTTGGAGGCCAGAGGG - Intergenic
1160353747 18:78208806-78208828 CAAGGGGTTTGGAGTTCATGTGG - Intergenic
1160492887 18:79352605-79352627 ACAGAGGTTTCGAGGCCATGTGG - Intronic
1160942244 19:1625738-1625760 CCTGGGGTCTGGATGCCAGCTGG - Intronic
1160958576 19:1706760-1706782 CCAGGGCCCGGGAGGCCAGGTGG - Intergenic
1161001133 19:1911886-1911908 CCAGGGGTTAGCAGGACATGAGG + Exonic
1161082471 19:2318030-2318052 CCAGGAGAGTGGAGGCCTGGGGG + Intronic
1161153934 19:2722658-2722680 GAAGGGGTCTGGAGGCCAGGAGG - Intronic
1161282717 19:3454458-3454480 CCAGGGGCTTCCAGGTCAGGTGG - Intronic
1161378952 19:3954438-3954460 CCAGAGGTCAGGAGGCCAGAAGG + Intergenic
1161428408 19:4217055-4217077 CCACGGGAGTGGAGGCCATGGGG + Exonic
1161583170 19:5091708-5091730 CCAGGGGGAGGGAGCCCAGGGGG + Intronic
1161959711 19:7516625-7516647 CCTGGGGTCTGGAGTTCAGGAGG + Intronic
1162249730 19:9431823-9431845 CCAGGGGTATGAATGCCAGCAGG - Intronic
1162831713 19:13288718-13288740 CCAGGGGTCTGTAGTCCAGAAGG - Intronic
1163020199 19:14477524-14477546 CCAGGGGGTAGGAGGCCTTGTGG + Intergenic
1163035478 19:14566692-14566714 CCAGGGGTGTGGAAGGCTGGGGG + Intronic
1163485042 19:17580521-17580543 CCAGGGGTCTGGCGGTCATGGGG - Intronic
1163577667 19:18120112-18120134 CCAGGGATCTGGTGGCCAGAAGG + Intronic
1163698102 19:18774168-18774190 GCTGGGGTGTGGAGGCGAGGAGG - Intronic
1164445318 19:28312568-28312590 AGAGGGACTTGGAGGCCAGGAGG + Intergenic
1164799866 19:31067670-31067692 GCAGGGCTTTGGATGCCAGAGGG - Intergenic
1165158676 19:33803240-33803262 TCAGGGGACAGGAGGCCAGGGGG + Intronic
1166002478 19:39886018-39886040 CCAGGCGGCTGGAGGCCACGTGG - Exonic
1166005263 19:39902270-39902292 CCAGGTGGCTGGAGGCCACGTGG - Exonic
1166181627 19:41113042-41113064 CAAGGGTCTGGGAGGCCAGGTGG - Intergenic
1167659948 19:50790617-50790639 CCATGGGGTAGGAGGCCAGCGGG - Exonic
1168108852 19:54180813-54180835 CCCGGGCTTTGGCGGCCACGGGG + Exonic
1168586354 19:57596716-57596738 CCAGGGGTTTGGGGGAAGGGAGG + Intergenic
926217768 2:10915749-10915771 CCAGGGGGTGCAAGGCCAGGTGG + Intergenic
927197043 2:20555263-20555285 CCACGGCTTAAGAGGCCAGGTGG + Intergenic
927812144 2:26186144-26186166 CCAGCTGTTTGGAGTCGAGGTGG + Intronic
927869260 2:26613393-26613415 CCAGGGGCTTAGAGGGAAGGTGG - Intronic
929555201 2:42921544-42921566 ACTGGGGTTTGGAGGCAAAGGGG + Intergenic
930057471 2:47263237-47263259 TCAGGGGTTTTGGGGGCAGGAGG - Intergenic
930914663 2:56672314-56672336 CCAGGGGGTTGGAGGCAAGATGG + Intergenic
931345276 2:61440206-61440228 GGTGGTGTTTGGAGGCCAGGAGG - Intronic
931460708 2:62448064-62448086 CCAAGGGTTTGGTGGCCATAAGG + Intergenic
931484790 2:62679834-62679856 CCAAGTGTTTAGAGGCCTGGAGG + Intronic
932566800 2:72916051-72916073 CCAGGGGTGGGGAGGCGAGGCGG - Intergenic
933998301 2:87686072-87686094 CCAGGTGCTTGCAGTCCAGGGGG - Intergenic
935203499 2:100878319-100878341 CAAGGGCTCTGCAGGCCAGGAGG + Intronic
936144914 2:109974417-109974439 CCAAGGGTTTTGAGGCCTGCAGG - Intergenic
936181600 2:110272380-110272402 CCAAGGGTTTTGAGGCCTGCAGG - Intergenic
936199772 2:110397050-110397072 CCAAGGGTTTTGAGGCCTGCAGG + Intergenic
936230966 2:110699300-110699322 CCAAGGGTTTTGAGGCCTGCAGG + Intergenic
936295547 2:111264801-111264823 CCAGGTGCTTGCAGTCCAGGGGG + Intergenic
938850056 2:135250922-135250944 TCTGGGGTCTGGAGGACAGGTGG - Intronic
939422615 2:141993267-141993289 CCAGGAGTCTTGAGGCAAGGGGG - Intronic
939717979 2:145609492-145609514 CCAGGAGTAGGGAGTCCAGGGGG - Intergenic
940790418 2:158025403-158025425 CCTGGAGTGTGGAGGCCAGCAGG + Intronic
943636364 2:190311265-190311287 CCAGGGGTTTGGGGGACGGAAGG + Intronic
944894233 2:204147649-204147671 CCAGGGGTTGGGAGGTGGGGAGG - Intergenic
946396803 2:219447523-219447545 GCAGGGGTGTGGGGGCCAGCTGG + Intronic
946422559 2:219572695-219572717 GCATGGGTTTGCAGGCCAGGCGG + Intronic
947133438 2:226953507-226953529 CCAGGGATTGAGAGGCCATGTGG - Intronic
947345055 2:229182039-229182061 CCAGGGGTTTGAAGGGAGGGAGG + Intronic
948379329 2:237541922-237541944 CCAGGGGGCAGGAGGCCGGGTGG + Intronic
948795529 2:240400417-240400439 TCAGAGGATTGGGGGCCAGGTGG + Intergenic
1169027047 20:2380248-2380270 CCAGGAGCTTAGAGGCCTGGTGG - Intergenic
1169860544 20:10147089-10147111 CCTGGGGTTTGGGGGGCGGGGGG - Intergenic
1170794971 20:19539303-19539325 CCAGAGGTGGGGAGGGCAGGAGG - Intronic
1171369882 20:24655157-24655179 CCAGGAGTGTGAACGCCAGGAGG + Intronic
1172146560 20:32762171-32762193 CCCGGGGTTGGGAGGGCAGGGGG + Intergenic
1172531326 20:35633068-35633090 GGAGGGGTTTGGAGGCTATGAGG - Intronic
1172814662 20:37676941-37676963 CCTGGGGTCCTGAGGCCAGGTGG - Intergenic
1175171208 20:57082665-57082687 GCTGGGGTGGGGAGGCCAGGAGG + Intergenic
1175211081 20:57355763-57355785 GCAGGGGTTAGGAGAACAGGAGG + Intronic
1175297445 20:57918732-57918754 GCAGGAGTTTGGGGCCCAGGAGG - Intergenic
1175504282 20:59470735-59470757 CGTGGGGATTGGAGGCCAGAAGG - Intergenic
1175517772 20:59579721-59579743 CCAGCTGCTTGGAGGACAGGAGG + Intronic
1175644746 20:60661513-60661535 CCAGTGGCTTGGAGGGAAGGGGG + Intergenic
1176124617 20:63469903-63469925 CCAGGGGTCTGGGAGCCGGGCGG + Intronic
1176132528 20:63502358-63502380 ACAGGGGCTTGGAGGCAGGGTGG + Intergenic
1176138774 20:63536162-63536184 GGAGGGGGTGGGAGGCCAGGTGG - Intronic
1176299968 21:5094901-5094923 CCAGGGCTTCAGGGGCCAGGCGG - Intergenic
1176382022 21:6118389-6118411 TCAGTGGTTTGGAGGTGAGGGGG + Exonic
1179238574 21:39568571-39568593 CAAGGCGTCTGGAGTCCAGGTGG - Intronic
1179439358 21:41382393-41382415 TCTGGGCTATGGAGGCCAGGAGG - Exonic
1179533297 21:42034647-42034669 CCTGGGGTTAGGAGGACAAGAGG - Intergenic
1179741450 21:43419850-43419872 TCAGTGGTTTGGAGGTGAGGGGG - Exonic
1179857054 21:44167010-44167032 CCAGGGCTTCAGGGGCCAGGCGG + Intergenic
1180056065 21:45359821-45359843 CCAGGGGTGTGGATGGCAAGAGG - Intergenic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1180595411 22:16969883-16969905 CCAGGAGTTTGGGGGCCACCTGG - Intronic
1181170845 22:21009012-21009034 CCAGGGCGTAGGTGGCCAGGGGG + Intergenic
1181312491 22:21952775-21952797 CCAGGGGTGAGGAGGCCGGGGGG - Exonic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1181521561 22:23451265-23451287 CCTGAGGGTTGCAGGCCAGGTGG + Intergenic
1182316283 22:29449448-29449470 CCAGGGGATTGGTGGGCAGGCGG + Intergenic
1182624797 22:31638047-31638069 CCAGTGGTTTGGAGGACAGAGGG - Intronic
1183304889 22:37077347-37077369 CCAGGCGTGTGGAGGACATGGGG - Intronic
1183332624 22:37229567-37229589 CCAGGGCTGGGGAGTCCAGGTGG + Intronic
1183332872 22:37230653-37230675 CCAGTGATTTGGAGGCAAAGAGG + Intronic
1184189464 22:42885321-42885343 CCACCAGTTTGGTGGCCAGGTGG + Intronic
1184399302 22:44264522-44264544 GCAGGGGTTTGGGGCACAGGTGG + Intronic
1184913715 22:47552697-47552719 CCAGGGGGGTGGGGGTCAGGAGG - Intergenic
1185098847 22:48826751-48826773 CCAGGTGCTGGGAAGCCAGGTGG - Intronic
1185284478 22:49994174-49994196 CCAGGGGCAGGGAGGCCAGTGGG - Intergenic
1185295274 22:50049943-50049965 CCTGGGGCAGGGAGGCCAGGAGG + Intronic
951915805 3:27799564-27799586 CCAGGGGTTTAGAGGTGAGCAGG + Intergenic
953525945 3:43690489-43690511 CCGCGGGTTGGGGGGCCAGGGGG - Intronic
954156083 3:48685598-48685620 CCAGGGGCGCGGAGGCCGGGCGG + Intronic
954437801 3:50505096-50505118 CCAGGGGCCTGGTGGACAGGTGG + Intergenic
954934398 3:54313449-54313471 CCAGGGGTGTTGAGGGTAGGAGG - Intronic
955237201 3:57150051-57150073 CCAGGGTTTTGGAGGGATGGAGG - Intronic
955334158 3:58071239-58071261 ATAGGGGTGTGTAGGCCAGGCGG - Intronic
956076997 3:65516423-65516445 CAATGCGTTGGGAGGCCAGGCGG - Intronic
957700195 3:83700383-83700405 TCAGGGGGTTGGGGGCCTGGGGG - Intergenic
959166376 3:102784296-102784318 TCAGGGGTTAGGAGGCCCAGAGG - Intergenic
959925721 3:111919649-111919671 CTAGAGGTTTGGAAACCAGGGGG + Intronic
961755089 3:129122369-129122391 GCAGCGGTTTGGGGGCCAGACGG - Intronic
962292038 3:134145410-134145432 TCAGGGGAGTGGAGGGCAGGGGG + Intronic
962964568 3:140341593-140341615 CCAGCAGTTTGGAGGACAGTCGG + Intronic
965080498 3:164025439-164025461 CCGAGGGTCTGGAGGCCGGGAGG + Intergenic
968762938 4:2451665-2451687 ACAGGGGTTTGCAGCCCTGGTGG - Intronic
968974546 4:3814370-3814392 CCAGGTGTGAGGTGGCCAGGGGG - Intergenic
969179530 4:5426598-5426620 TCAGGAGTCTGAAGGCCAGGAGG + Intronic
969343464 4:6556907-6556929 CCAGGAGCTGGGAGGGCAGGTGG - Intronic
969350109 4:6593480-6593502 CCAGGGGTCTGCAGGGAAGGAGG - Intronic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969449969 4:7267461-7267483 CCAGGGCTGGGGTGGCCAGGAGG - Intronic
971692785 4:29859046-29859068 CAAGGGGTTGGGAGGTAAGGGGG - Intergenic
972338494 4:38129573-38129595 CCAGCAGATTGGAGGGCAGGGGG + Intronic
977091133 4:92677102-92677124 CCAGGGGTTGGGAAGAGAGGAGG + Intronic
978782112 4:112567036-112567058 CTAGGAGTTTGGAGGTGAGGTGG - Intronic
980380472 4:132007982-132008004 CCAGGGGTTCTGGGGCAAGGAGG - Intergenic
981172050 4:141636590-141636612 CCAGGGGTTGGGACTCCGGGTGG + Exonic
983008973 4:162521691-162521713 ACAGGGGTTTCCTGGCCAGGTGG - Intergenic
983255304 4:165393555-165393577 CCAAGGTTTTGAAGCCCAGGAGG + Intronic
983972514 4:173892411-173892433 CCAGGGGCTTGCAGTCCAGTGGG + Intergenic
984473009 4:180200977-180200999 CCTAGGATTTGGAGGGCAGGGGG - Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985950317 5:3217813-3217835 CCAGGGGTGTGGGGGCAGGGGGG + Intergenic
988907194 5:35801834-35801856 CCAGGAGTTTGGTGGGGAGGAGG + Intronic
989261779 5:39426381-39426403 CTAGGGGTGTGGAGGCAGGGAGG + Intronic
991533297 5:67638623-67638645 CTAGGTGTTTGTAAGCCAGGAGG + Intergenic
991958903 5:72022018-72022040 ACAGGGGTTTGGGGCACAGGTGG + Intergenic
993095165 5:83472489-83472511 CCAGGGGCTGGGAAACCAGGTGG - Intronic
993176154 5:84488556-84488578 CCAGGGGTTTGAAGGGAAGGAGG + Intergenic
993289061 5:86041338-86041360 CCAGGGATATTGAGGCAAGGAGG - Intergenic
994922408 5:106064935-106064957 CCAGGGATTTGGAGGAAGGGGGG - Intergenic
995659160 5:114461813-114461835 CCAGGGCTGTGGTGGCAAGGAGG - Intronic
996236191 5:121133324-121133346 CCACGGGTTAAGAGACCAGGTGG + Intergenic
997419515 5:133755023-133755045 GCAGGGGGATGGAGGCCATGTGG - Intergenic
998396079 5:141818937-141818959 CAATGGGATTGGAGGCCAGTGGG + Intergenic
998699378 5:144680332-144680354 CTAGAGGTTTGGAGGGTAGGGGG + Intergenic
999033841 5:148324940-148324962 CCAGGGGTTGGGAGGATAGTAGG - Intronic
999305874 5:150519326-150519348 CCAGGGCTAAAGAGGCCAGGGGG - Intronic
999961130 5:156756832-156756854 CCAGGGGCTGGGAGGGGAGGTGG - Intronic
1000064096 5:157680389-157680411 CCAGTGGTAAGGAGGTCAGGGGG + Intergenic
1001881799 5:175251041-175251063 CCAGGGGTGGGGTGACCAGGTGG - Intergenic
1001955519 5:175845911-175845933 CCAGAGGGGTGGAAGCCAGGAGG - Intronic
1002061083 5:176626539-176626561 GAAGGGGTTTGGGAGCCAGGGGG + Intronic
1002570260 5:180136109-180136131 CCTGGGCTTTTGGGGCCAGGTGG - Intronic
1002651875 5:180703743-180703765 TCAGGGGGTTGGGGGCAAGGGGG + Intergenic
1002710562 5:181192298-181192320 CCAGGTGTTTGGAGGCGCTGGGG + Intergenic
1003086801 6:3066895-3066917 CCAGGGATTTGCAGGGAAGGAGG - Intronic
1005761278 6:28970225-28970247 CATGGGGTCTGGAGGCCTGGCGG - Intergenic
1005955315 6:30659558-30659580 CCCGGATTTTGGAGCCCAGGCGG + Exonic
1006337806 6:33429541-33429563 TTAGGGATTTGGAGGGCAGGGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010774494 6:79869699-79869721 CCTGGGCCTTGGAGCCCAGGTGG + Intergenic
1011422309 6:87186067-87186089 CCAGAGGTTGGGGGGACAGGTGG + Intronic
1016450320 6:144175793-144175815 CCACGGGTGTGGAAGTCAGGTGG - Intronic
1018258709 6:161948744-161948766 CCATGTGTTTGGAGGGCAAGAGG + Intronic
1018702286 6:166436683-166436705 TCAGAGGCTGGGAGGCCAGGAGG - Intronic
1018847453 6:167565501-167565523 CAAGGGGGTTGGAGGCTATGGGG + Intergenic
1019564247 7:1671706-1671728 CCAGGGGGCAGGAGGCCAGGGGG - Intergenic
1019589778 7:1825217-1825239 CCCGAGGGTTGCAGGCCAGGTGG - Intronic
1019630230 7:2045153-2045175 AGAGGGGTGTGGAGGCCGGGTGG - Intronic
1019704347 7:2490370-2490392 CCAGGGGCCTGGGGGGCAGGAGG - Intergenic
1019779585 7:2931424-2931446 ACAGAGGTGTGGAGACCAGGAGG - Intronic
1020214670 7:6180473-6180495 CCACGGCTGTGGAGACCAGGAGG + Intronic
1020468754 7:8511630-8511652 CCAGGGGGTTGGAAGAGAGGTGG - Intronic
1021928032 7:25552100-25552122 CCAGGGGTCTCCAGTCCAGGGGG + Intergenic
1022606272 7:31817448-31817470 GCAGGGCTTTGGAGGCAATGAGG + Intronic
1023104407 7:36749423-36749445 CCAGGGGCTTGGGGGCAAAGGGG + Intergenic
1023157301 7:37263769-37263791 TCTGGGGTCTGCAGGCCAGGGGG + Intronic
1023172503 7:37403414-37403436 CCAGGGGTTTGGAGGCCAGGAGG + Intronic
1023177431 7:37448096-37448118 CCAGAGGAATGGGGGCCAGGAGG - Intronic
1024573648 7:50746789-50746811 CCTGGGGACTGGAGGCCCGGGGG - Intronic
1024751182 7:52467334-52467356 CCAGGGGCTTGGATGCCTAGGGG + Intergenic
1026916000 7:74120806-74120828 CCAGGTGGTTTGAGGGCAGGTGG - Intronic
1027180597 7:75936664-75936686 GCAGGGGGTTGGGGGGCAGGTGG + Intronic
1029167340 7:98601939-98601961 CCAGGGGTTGGCAGACCTGGGGG + Intergenic
1029217208 7:98959189-98959211 CCAGCTGTGTGGAGGTCAGGCGG + Intronic
1029297406 7:99552081-99552103 CCTGGGCTCTGAAGGCCAGGGGG - Exonic
1029334106 7:99885860-99885882 CTGGGGGTTGGGAGGGCAGGTGG + Intronic
1030313562 7:108091958-108091980 CCAGGGCCATGGAGCCCAGGCGG + Intronic
1031416752 7:121504574-121504596 CCTGGGGGTTTGAAGCCAGGTGG - Intergenic
1034170727 7:149061046-149061068 CCAGTACTTTGGAGGCCAAGCGG + Intergenic
1034265894 7:149780496-149780518 GCTGGGGGTTGGTGGCCAGGTGG + Intergenic
1034460546 7:151195691-151195713 CCTGGGGCTGGGAGGACAGGTGG + Intronic
1034746857 7:153530466-153530488 CAAGGGCCTTGGAGGCCAGGTGG + Intergenic
1035198856 7:157246795-157246817 CCGGGGGTGTGGAGAACAGGTGG - Intronic
1035250742 7:157595461-157595483 CTGGGGGTTAGGAAGCCAGGAGG + Intronic
1035250777 7:157595605-157595627 CCGGAGGTTAGGAAGCCAGGAGG + Intronic
1035251853 7:157603101-157603123 CCGGGGCTTTGGAGACCTGGCGG - Intronic
1035748687 8:1979840-1979862 CCAGGAGTGTGGAAGCCACGCGG - Intronic
1036727148 8:11230407-11230429 CCAGGGGTGAGGAGCCAAGGAGG + Intergenic
1037538832 8:19852814-19852836 CCAGGGGCTTTGGAGCCAGGTGG + Intergenic
1037657007 8:20893189-20893211 GGAGAGGTTTTGAGGCCAGGTGG + Intergenic
1037920635 8:22803053-22803075 ACAGGGCCTTGGAGGCCATGAGG - Intronic
1038446106 8:27605386-27605408 CCAGGGGGTGGGAGGCCAGGAGG - Intronic
1038490771 8:27969486-27969508 CCAGGGATTGGGAGGGCAGGAGG + Intronic
1038591961 8:28847328-28847350 CCAAGGGTTGGGAGGAAAGGGGG + Intronic
1038695108 8:29799457-29799479 CCAGTGATTTGGGGGTCAGGAGG + Intergenic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1039520486 8:38166799-38166821 TCATGGGTTGGGAGGGCAGGTGG - Intronic
1039555011 8:38468878-38468900 GCAGCGGTTTGGGGGCTAGGGGG + Intergenic
1039959541 8:42235682-42235704 CCAGAGGCTTGGAGGTTAGGAGG - Intergenic
1040080026 8:43275923-43275945 CCAGGAATATGGAGTCCAGGTGG + Intergenic
1042314851 8:67414958-67414980 CCAGGGGCTTTGAGGGGAGGAGG - Intergenic
1045017148 8:98009886-98009908 CCAGGAGCTTGCAGGCCAGTGGG - Intronic
1046854162 8:119010173-119010195 CCAGGGGTTAGGAGGGAGGGAGG - Intronic
1047651054 8:126921902-126921924 CCAGGGGTTAGGAGGAAGGGAGG - Intergenic
1048571750 8:135662634-135662656 ACAAGGGTGTGGATGCCAGGAGG + Intergenic
1048963201 8:139596916-139596938 CCAGGGGTTTGGTGCCCTGGAGG - Intergenic
1049382708 8:142325423-142325445 CTAGGGGTGGGGAGGCCAAGAGG + Intronic
1049419392 8:142510342-142510364 CCAGGGGTGATGAGGCCCGGGGG + Intronic
1049448200 8:142641309-142641331 CCAGGGCTTTGCAGGCCATAAGG - Intergenic
1049465511 8:142749618-142749640 CCAGGGGTCAGGTGCCCAGGGGG - Intergenic
1049596019 8:143483768-143483790 ATAGGGGTTTGGAGGATAGGGGG - Intronic
1049643437 8:143725711-143725733 CCAGCGTTGGGGAGGCCAGGGGG + Exonic
1049781300 8:144430192-144430214 CCATGGGTTAGGGGGCGAGGTGG - Intronic
1053333976 9:37247082-37247104 CCAGGAGTTTGGTGGAGAGGGGG - Intronic
1054791285 9:69259208-69259230 CCAGCACTTTGGAGGCCAAGGGG + Intergenic
1054968713 9:71059912-71059934 CAAGGGGTCTGGAAACCAGGAGG + Intronic
1056106291 9:83349853-83349875 CCTGGGGAGTGGGGGCCAGGAGG + Intronic
1056215749 9:84404494-84404516 CCAGGGCTTTGGATCCCAGGAGG - Intergenic
1056262512 9:84862903-84862925 CCTGGGGTGGGGAGGGCAGGTGG + Intronic
1056825306 9:89872908-89872930 CCCTTGGTTTGGAGGCCACGTGG + Intergenic
1058585383 9:106501557-106501579 CCTGGGGCTTGCTGGCCAGGGGG + Intergenic
1058844662 9:108945038-108945060 CAAGGGGTTTGCAGGCTAGAAGG - Intronic
1059408178 9:114115294-114115316 CCAGCTGGTTGGAGGGCAGGGGG + Intergenic
1060270263 9:122135169-122135191 CAGGGGGTTTTGAGGCAAGGTGG - Intergenic
1060666245 9:125433677-125433699 CCAGAGGTGTGGCGGCCAGGGGG - Intergenic
1060743076 9:126112321-126112343 ACAGGGGTGTGGATACCAGGAGG - Intergenic
1060973457 9:127752091-127752113 CCAGGAGTTTCTGGGCCAGGTGG - Intronic
1061195347 9:129104158-129104180 GCTGGGGTTTGGGGGCCAGGAGG - Intronic
1061800748 9:133112378-133112400 CTAGGGGATTGGAAGCCTGGTGG - Intronic
1062042082 9:134408807-134408829 GCAGGGGTCTGGAGACCAGCAGG + Intronic
1062595569 9:137297559-137297581 CCAGGTGTTGAGAGCCCAGGAGG - Intergenic
1062607041 9:137353090-137353112 GCGGAGGCTTGGAGGCCAGGAGG - Intronic
1062607059 9:137353144-137353166 GCAGAGGCTTGGAGGCCAGGAGG - Intronic
1187020301 X:15374555-15374577 CCAGAGGTTGGGAGGCTGGGAGG + Intronic
1187839286 X:23470090-23470112 CCAGGGGTTGGGTGGCGAGGGGG + Intergenic
1188423731 X:30022422-30022444 CCAGGGGTTTGGAGGCAAGGAGG - Intergenic
1189736728 X:44078896-44078918 CCAGGGGTTAGGATGGAAGGAGG + Intergenic
1190008006 X:46758664-46758686 CGAGGGGTGTGGAGGGCGGGGGG + Intronic
1190521774 X:51286447-51286469 CCAGGGGTTTGGAGATGAGAGGG - Intergenic
1190955692 X:55191012-55191034 CCAGCACTTGGGAGGCCAGGCGG + Intronic
1190972700 X:55367302-55367324 CCAGTGGCCTGAAGGCCAGGTGG - Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1194025599 X:88746589-88746611 CCCGGGGCTTGCAGGCCAGCCGG + Intergenic
1196304577 X:114086760-114086782 CCAGCGGGATGGTGGCCAGGTGG - Intergenic
1196463127 X:115949511-115949533 ACAGGGGTTTGGAGGATAGGTGG + Intergenic
1197189262 X:123627512-123627534 CCAGGAGTTTGGTGACTAGGTGG - Intronic
1198176970 X:134166109-134166131 CTAGAAGTTTGGAGGCCTGGAGG - Intergenic
1198441188 X:136664890-136664912 CTTGGGGTTTGGTGGCCAGCAGG - Intergenic
1199704426 X:150411556-150411578 CCAGGTGGTTGGAGGCCAAGAGG - Intronic
1199846047 X:151693983-151694005 CCTGGGGGTTGGAGGGGAGGCGG + Intergenic
1200053922 X:153448867-153448889 CCTGGGGCTTGGGGGGCAGGGGG - Intronic
1201491256 Y:14544248-14544270 CCAAGCATTTGGAGGCCATGGGG - Intronic
1202342955 Y:23888696-23888718 CCAGGGGTCTGGAGCATAGGAGG - Intergenic
1202527813 Y:25781389-25781411 CCAGGGGTCTGGAGCATAGGAGG + Intergenic