ID: 1023175254

View in Genome Browser
Species Human (GRCh38)
Location 7:37429800-37429822
Sequence GAATGGAACTAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 402}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023175254 Original CRISPR GAATGGAACTAGAGGGAAGA GGG Intronic
902127132 1:14224262-14224284 GCCTGGAACCAGTGGGAAGAAGG + Intergenic
902703895 1:18191404-18191426 GAATGGCTTTAGAGGGATGAGGG + Intronic
905512472 1:38533037-38533059 TAATGAAAATAGAGGGAAGTAGG + Intergenic
905961918 1:42050143-42050165 GGATGGGAGTAGAGGGAAGCTGG + Intergenic
907238182 1:53065516-53065538 GAATGGAGGAAGAGGTAAGAAGG - Intronic
907653760 1:56321582-56321604 GTATTGAACTAGAGGAAACAGGG + Intergenic
907934274 1:59028230-59028252 GAAAGCAACAAGAGGAAAGAGGG + Intergenic
907934300 1:59028387-59028409 GAAAGCAACAAGAGGAAAGAGGG + Intergenic
908079106 1:60556151-60556173 GATTGGACATAGAGGAAAGAAGG - Intergenic
909319063 1:74259399-74259421 GAATAGAACTAAAAGGTAGAGGG - Intronic
909749893 1:79145943-79145965 GAATGGGACAAAAGGGAAAAAGG - Intergenic
910530046 1:88225524-88225546 AAATGGTACTAGAGGGATAAAGG - Intergenic
910901839 1:92129672-92129694 AAATGGCCCTAAAGGGAAGAGGG - Exonic
910985684 1:93002663-93002685 GAATGGGAATAGAGGGAGGTGGG - Intergenic
911155703 1:94634797-94634819 GAATGTGACTAGAAGGAAAAAGG - Intergenic
911165566 1:94721434-94721456 TAATGCAACCAGAGGGCAGAAGG + Intergenic
911372700 1:97013304-97013326 GCATTGAACTAGAGCCAAGACGG + Intergenic
912634633 1:111280329-111280351 GAATGGAAATAGAGGGGAGTGGG + Intergenic
912898741 1:113623885-113623907 TAATGGAGCTAGAGAGTAGAAGG - Intronic
914058627 1:144187754-144187776 GAAAAGAAGGAGAGGGAAGAAGG - Intergenic
914120522 1:144778617-144778639 GAAAAGAAGGAGAGGGAAGAAGG + Intergenic
914700036 1:150123778-150123800 GGATAGAAGTAGAGGGAAAAAGG + Intronic
915525527 1:156473798-156473820 GGAAGGAAGAAGAGGGAAGAAGG - Intronic
915701811 1:157803666-157803688 GAATGGAAACAGAGTGAATAAGG + Intronic
915878201 1:159635614-159635636 GGATAGAACAAGAGGAAAGATGG + Intergenic
916670697 1:167016986-167017008 GAAGGGTACTAGAGGGGTGAGGG + Intronic
916810186 1:168298742-168298764 GAATGGAAGGGAAGGGAAGAAGG - Intronic
917123153 1:171661912-171661934 GAAAAGAGCTAAAGGGAAGATGG + Intergenic
917533002 1:175853871-175853893 GACAGGAATTAGAAGGAAGAAGG + Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
920131188 1:203733103-203733125 GAATGGAAGTAGATGGGAAAAGG - Intronic
920667602 1:207975340-207975362 GAAAGAAACTAGAGGGAGGCTGG + Intergenic
920805358 1:209228716-209228738 GAATGAAACAAGAGGGAAAATGG + Intergenic
922691214 1:227693110-227693132 GAAGGGGACTGGAGGCAAGAGGG - Intergenic
922699308 1:227749351-227749373 GGATGGAACCTGAGGGCAGAGGG - Intronic
922799622 1:228359246-228359268 GGATGGACCTGGAGGGGAGACGG + Intronic
923078537 1:230632087-230632109 GAATGGAGCAAGAGGGGAAATGG + Intergenic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
924773985 1:247102896-247102918 GAATGGAATAAGAGGAAATATGG + Intronic
1063599410 10:7466705-7466727 GAATGGGGCTTGGGGGAAGACGG - Intergenic
1064336212 10:14445069-14445091 AAATGGAAATAAAAGGAAGAAGG + Intronic
1064351801 10:14583731-14583753 GAAGGAAACTACAGGGAAAAAGG + Intronic
1064753278 10:18553530-18553552 GAATGGAATGAAAGGGAGGATGG + Intronic
1064754611 10:18562801-18562823 GAATGGAATGAAAGGGAGGATGG + Intronic
1064755023 10:18565766-18565788 GAATGGAATGAAAGGGAGGATGG - Intronic
1065169106 10:23010180-23010202 GAAGGGAAGGAGAGGGAAGCTGG - Intronic
1065482304 10:26208128-26208150 GAATGGCACTAGAGGAAAAGAGG + Intronic
1068778234 10:60890783-60890805 GAAGGGAAGTTCAGGGAAGAAGG + Intronic
1069077526 10:64053374-64053396 GCATGGGACAAGGGGGAAGAAGG + Intergenic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1072429724 10:95360139-95360161 AAATGCAACCAAAGGGAAGAGGG - Intronic
1073072710 10:100805101-100805123 GAATAGATATGGAGGGAAGATGG + Intronic
1073502662 10:103955519-103955541 TCATGGAACTTGAGGGTAGAAGG + Intergenic
1074514201 10:114149699-114149721 GAATGGAAGGAAAGGGAGGAAGG + Intronic
1074799371 10:116983830-116983852 GAATGGAAGAAAAAGGAAGATGG + Intronic
1074918975 10:117988076-117988098 GTATGGAAATAGAGAAAAGAAGG - Intergenic
1075051376 10:119184728-119184750 GAATGGGGCTACATGGAAGACGG - Intergenic
1075153623 10:119956338-119956360 GACTGGAGACAGAGGGAAGAAGG + Intergenic
1077199743 11:1300010-1300032 GAATGGAACTCGAGGGAAACAGG + Intronic
1077559649 11:3251353-3251375 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1077565542 11:3297156-3297178 AACTGAAACTAGAGGCAAGAGGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078276167 11:9849568-9849590 GAATGGAATAAGAGGGAAGTGGG + Intronic
1079288819 11:19167212-19167234 GAATGTAACAAGAGGGTGGATGG - Intronic
1079545236 11:21626011-21626033 GAATCGCGGTAGAGGGAAGATGG + Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1079869258 11:25776032-25776054 TATTGCAACTAGAGGGAAAATGG + Intergenic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080409224 11:32007756-32007778 GAGTGGAACTAGAGAAAGGAAGG + Intronic
1080461931 11:32462301-32462323 GAGGGGAACTGGAGAGAAGAGGG - Intergenic
1080539005 11:33248784-33248806 GAATATAAAGAGAGGGAAGAAGG + Intergenic
1081625823 11:44654529-44654551 GAATGGAGGAAGGGGGAAGATGG - Intergenic
1081751507 11:45514330-45514352 GAAGGGACCCAAAGGGAAGATGG + Intergenic
1083033733 11:59616708-59616730 GAAGGGAACTAGGGGGACCATGG - Intergenic
1083887727 11:65581031-65581053 GAATGGTAGGAGAGGGGAGAAGG - Intronic
1084936950 11:72592019-72592041 GAGTGGATCTAGAGGGGGGAAGG - Intronic
1085951537 11:81338339-81338361 GTATGGCAAAAGAGGGAAGAGGG + Intergenic
1086458143 11:86979526-86979548 GAAAGGAAGTAAAGGGAGGAGGG + Intergenic
1086497814 11:87422195-87422217 GAATGGAAGTAGGGGCAGGATGG + Intergenic
1087343120 11:96934471-96934493 CAAAGGAACTAGATGGAAGCAGG + Intergenic
1087416371 11:97861277-97861299 GAATGGATGGAGAGGGAATATGG - Intergenic
1088140490 11:106609910-106609932 GTGTGGAAGTAGTGGGAAGAAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088922491 11:114271199-114271221 GAATGGGAATAGAAGGGAGAGGG + Intronic
1089689421 11:120178011-120178033 GGAAGGAAGGAGAGGGAAGAAGG + Intronic
1090703258 11:129314945-129314967 GAATGCAGCCACAGGGAAGAAGG - Intergenic
1090908763 11:131099864-131099886 GGATGCAGATAGAGGGAAGAAGG - Intergenic
1090913643 11:131143442-131143464 GATTGGAATTAGTGAGAAGAGGG + Intergenic
1091956884 12:4652350-4652372 AAATGGAACTAGAGAAAACAAGG - Intronic
1092079295 12:5700867-5700889 GATTCAAACTAGAAGGAAGATGG - Intronic
1092992909 12:13920403-13920425 GAATGGAAGTAGGGAAAAGATGG + Intronic
1093423768 12:19004432-19004454 AAGTGGAACTAGGGCGAAGAGGG - Intergenic
1093940193 12:25044892-25044914 GAATGGCACTAGAGAGTAAATGG + Intronic
1093960755 12:25270298-25270320 GAATGGAGGTAAAGGGAAGAGGG + Intergenic
1094009639 12:25793850-25793872 GAATGGAAAGAAAAGGAAGAGGG - Intergenic
1094267462 12:28575092-28575114 GCATGAAACTAGACAGAAGAGGG + Intronic
1094716426 12:33018995-33019017 GATGGGAACTAGAAAGAAGATGG - Intergenic
1094836295 12:34323667-34323689 AAATGGAACTTCAGAGAAGAGGG - Intergenic
1095702023 12:45200550-45200572 GAATGGAAGTTGGGGGAGGAGGG + Intergenic
1095734050 12:45536856-45536878 TAATGGCACCAGAGGGAAAATGG - Intergenic
1096232613 12:49904674-49904696 GAATGGAAAAGGGGGGAAGATGG - Intergenic
1096817256 12:54209429-54209451 GAATGGAAGAAGAGAGATGAAGG + Intergenic
1099330368 12:81277342-81277364 GAAAAGAACTAGAAAGAAGACGG - Exonic
1099336489 12:81366041-81366063 GAAGGGAAGGAAAGGGAAGAGGG - Intronic
1101197754 12:102402886-102402908 GAAAGGATCTAGAGGCCAGAAGG - Intronic
1101423386 12:104567539-104567561 GAATGGAACTAGAGGTACTTTGG - Intronic
1102081734 12:110103881-110103903 GAATGGAGAAAGAGGGAATAAGG + Intergenic
1103662242 12:122529828-122529850 AAATGGAACTAGAGCTATGATGG - Intronic
1104301724 12:127570596-127570618 GAAAGGAAAGAGAGGAAAGAAGG + Intergenic
1104579768 12:130002676-130002698 GAATGGGTCTAGAGGGATAAAGG - Intergenic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105299511 13:19119318-19119340 GAAGAGAACGAGTGGGAAGAGGG + Intergenic
1105444395 13:20440103-20440125 GCATGAAACTGGAGGGAAGTTGG - Intronic
1105831874 13:24169721-24169743 GAATGGGAGGTGAGGGAAGAAGG + Intronic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1108074311 13:46663476-46663498 GAATGGAACAAGCAGGAAAAAGG + Intronic
1108114616 13:47113212-47113234 GCATGGATTTAGAGGGAAAATGG + Intergenic
1108123222 13:47212458-47212480 GGATAGAAACAGAGGGAAGAAGG + Intergenic
1108420546 13:50244768-50244790 GAATGTGACAAGAGGGAAGGTGG - Intronic
1108694889 13:52894297-52894319 GAATGAAACCATATGGAAGATGG - Intergenic
1108721868 13:53140526-53140548 GAAGAGAACTAGAGGGAGGTGGG - Intergenic
1109279496 13:60339634-60339656 GATTGGAGCTAGAGGGCAAAGGG + Intergenic
1110001288 13:70204834-70204856 GGATGGGACTACAGGGAAGAAGG - Intergenic
1110325234 13:74206499-74206521 GAATGGAAGAAAAGAGAAGAAGG - Intergenic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1111427798 13:88111237-88111259 GAATTGAACAAGAAGGATGAAGG + Intergenic
1111629566 13:90832736-90832758 GAATGGAAAAAAAGGGAAGAGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112063081 13:95761642-95761664 GATAGGAACAAGAGGGAAGTAGG - Intronic
1112792863 13:103022477-103022499 GAATGGAACCATAGAGAAGCTGG - Intergenic
1114389821 14:22295074-22295096 GAATGAACCAAGATGGAAGAAGG - Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1116735462 14:48685246-48685268 GATAGGAATTAGAGAGAAGACGG + Intergenic
1116779242 14:49217863-49217885 CAATGGAACAAGATGGAAAAAGG + Intergenic
1116851162 14:49910814-49910836 TTATTAAACTAGAGGGAAGAAGG - Intergenic
1116936259 14:50743539-50743561 GAAGGGAAAAAGAGGTAAGAGGG + Intronic
1117942611 14:60984308-60984330 CACTGGAAGTAGAGGGAGGAAGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1120128907 14:80781662-80781684 GAAAGGAACTAGAGGGAAGTAGG + Intronic
1120178609 14:81320996-81321018 GAAGGGAGGTAGAGTGAAGAGGG - Intronic
1120907632 14:89634090-89634112 GAACAAAACTAGAGGGAAGAAGG + Intronic
1120936933 14:89905852-89905874 GAATGGATTTAGAGCAAAGACGG + Intronic
1121034488 14:90689099-90689121 AAATGGAACTAGATATAAGAAGG - Intronic
1121163847 14:91772604-91772626 GATTGGAGAGAGAGGGAAGAAGG + Intronic
1121169270 14:91839473-91839495 GAATGCATCTAGAGGGAAGTGGG - Intronic
1121473221 14:94173404-94173426 GAATGGGACGAGATGGAAGGGGG - Intronic
1121496602 14:94396172-94396194 GAACAGAGGTAGAGGGAAGAGGG - Intergenic
1123774558 15:23565949-23565971 GACTGGAGCTACAGGGAAGGGGG - Exonic
1124359375 15:29024487-29024509 TAATGGAACAAAAAGGAAGAGGG - Intronic
1124531882 15:30515803-30515825 GAAAGGAAATAAAGGGAAGAAGG + Intergenic
1124873418 15:33566577-33566599 GAAAGGAATAAGAGGGATGAGGG + Intronic
1124928709 15:34098070-34098092 GAGTGGATCTAGAGGGCAAATGG - Intronic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1127475993 15:59333676-59333698 GAATGGATCTAGAAAGAAGTAGG - Intronic
1127479552 15:59365961-59365983 GAAGGGAAGAAGAGGGAAGGAGG - Intronic
1128402937 15:67303268-67303290 GCCTGGAACTAGTGGGAAGAGGG + Intronic
1128724266 15:69976185-69976207 TTATGCAACTAGAGGGAAGTAGG - Intergenic
1129290151 15:74559636-74559658 GAAGGGAGCAAGAGGGAATATGG - Intronic
1129790527 15:78338015-78338037 GGATGGACAAAGAGGGAAGAGGG - Intergenic
1130143602 15:81254357-81254379 GAATGGACCCAGAATGAAGATGG - Intronic
1131680693 15:94719536-94719558 GAATGGAAGTTAAGGAAAGAAGG + Intergenic
1134052481 16:11146494-11146516 GAATGGATGTAGAGGGAGGGAGG + Intronic
1134299356 16:12975750-12975772 GACTGGAAAAAGAGGGAAGATGG + Intronic
1135843724 16:25899354-25899376 GAAAGGAGCAAGAGAGAAGATGG - Intronic
1137367509 16:47873551-47873573 GCATGGCACAAGAGGGAGGAAGG - Intergenic
1138039813 16:53650916-53650938 GAATGTAAATAAAGGAAAGAAGG - Intronic
1138118624 16:54380283-54380305 GAAGTTAACTAGAGGGAAGTGGG + Intergenic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1142787532 17:2235852-2235874 GTGTGGAAGTAGAGGGGAGAAGG - Intronic
1143286091 17:5790372-5790394 GAAAGGAAATACGGGGAAGACGG + Intronic
1144416031 17:15048139-15048161 TAATGGAACTGGAGGAAAGGAGG - Intergenic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1144952218 17:19000460-19000482 GAATGGAACTAGTGGACAGCAGG - Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1148019220 17:44542415-44542437 GGTTGGAAGCAGAGGGAAGATGG - Intergenic
1148987081 17:51632433-51632455 GAAGGGAACAAGGGGGAAGTAGG + Intronic
1149414815 17:56448228-56448250 GAAAGAAAATAGAAGGAAGAAGG + Intronic
1150851559 17:68708246-68708268 GATGGGAACAAGAGGCAAGAGGG - Intergenic
1151042877 17:70883945-70883967 GAAAAGAGCTGGAGGGAAGAAGG + Intergenic
1151190410 17:72393912-72393934 GAAAGAAAATAGAGGGAAGAGGG + Intergenic
1151734150 17:75928350-75928372 AAATGGAACTAAAGGTAAGCAGG + Intronic
1153193432 18:2568338-2568360 GAAATGAATTAGAGGGAAGAAGG + Intronic
1153196071 18:2597805-2597827 GAATGAAACTTGATGAAAGAGGG + Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1155318935 18:24599340-24599362 GCATGGAACTCAAGGGAAGAGGG - Intergenic
1157422249 18:47556958-47556980 GACTTGGACTAGGGGGAAGATGG - Intergenic
1157997398 18:52575208-52575230 GAATGGATACAGAGAGAAGATGG - Intronic
1158197524 18:54905370-54905392 GAAAGAAAGGAGAGGGAAGAGGG + Intronic
1158213041 18:55071234-55071256 GAATGGAAATCGAGGGCAGCTGG - Intergenic
1159554791 18:69933748-69933770 GAATTGAACTAAAGGGAAAATGG - Intronic
1161558280 19:4956694-4956716 AACTGGAACTAGAGGGAAGCGGG - Exonic
1163350987 19:16777035-16777057 AAAGGGAACTGGAGGGAAGAGGG + Intronic
1164438213 19:28250898-28250920 GAAAGTAACTGTAGGGAAGAAGG + Intergenic
1166647511 19:44543148-44543170 GAAAGCAACTAGAAGGGAGATGG - Intergenic
1166695483 19:44849166-44849188 GAATGGAATCAGAGGATAGAAGG + Intronic
1166703343 19:44894773-44894795 GAAAGGAACTTGAGGGAGGATGG + Intronic
925294648 2:2768943-2768965 GAAGGGACCTGGAGGGAAAAGGG - Intergenic
925391023 2:3494191-3494213 GACTGGAACTAGGTGGAAGCAGG - Intergenic
926081934 2:9994476-9994498 GGATGGAAGATGAGGGAAGAGGG - Intronic
926445886 2:12942455-12942477 GAATGGAAGTTGAGTGAAGGGGG + Intergenic
926634201 2:15163287-15163309 GAGTGGGACTAGAAGGGAGAAGG + Intergenic
926756279 2:16238685-16238707 GAATGAAAGGAGAGGGAAGAAGG - Intergenic
926771258 2:16378042-16378064 GATTGGAGCTAGAGAGAAGCTGG - Intergenic
926802844 2:16675452-16675474 GAATTGACCCAGAGGGAAAAAGG + Intergenic
927792672 2:26022641-26022663 GAAGGCAATGAGAGGGAAGAAGG - Intergenic
927896965 2:26789043-26789065 GAAGGGAAGTAGAGGGAAATGGG - Intronic
928032289 2:27791402-27791424 GGATGGAACTAAAAGGCAGAAGG + Intronic
929115269 2:38438683-38438705 GAATGGCAGGAGGGGGAAGATGG - Intergenic
929494252 2:42425476-42425498 GAAGAGAAATAGAGGGATGATGG + Intergenic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930804334 2:55475194-55475216 GGAAGGAAAAAGAGGGAAGAAGG - Intergenic
931418972 2:62108281-62108303 CACTGAAACTAGAGGGCAGAGGG - Intronic
932199985 2:69817558-69817580 GAATGGCACAGGAGGGAAAATGG + Intronic
932465869 2:71923705-71923727 GACTGAAACAAGAGGGTAGATGG + Intergenic
932861641 2:75298966-75298988 GCATGGGACAAGAGGGAGGAGGG + Intergenic
933206646 2:79513917-79513939 GAAAGGAACAAGAGAGAAAAAGG + Intronic
933287717 2:80402250-80402272 AAATGGAAGTACAGGGAAGGTGG - Intronic
935110647 2:100091614-100091636 GAATGGAACTACAAAGAAGAGGG - Intronic
936124324 2:109773548-109773570 GAATGGAACTACAAAGAAGAGGG + Intergenic
936220365 2:110597916-110597938 GAATGGAACTACAAAGAAGAGGG - Intergenic
936444242 2:112584050-112584072 GCTTGGAACAGGAGGGAAGAGGG - Intergenic
937034528 2:118769815-118769837 GAAAGGAAGGAGAGGGAAGGAGG + Intergenic
938249383 2:129802427-129802449 GACTGGAAACAGAGGGGAGAGGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
940372918 2:152922662-152922684 GGATGGAATTAGAGGAGAGATGG - Intergenic
943040537 2:182799460-182799482 GAGTGAAACAAGAGAGAAGAAGG + Intergenic
943862260 2:192882352-192882374 GAATGGAACAGAAGGGAACATGG - Intergenic
945180547 2:207087014-207087036 AGATGGAAATAGAAGGAAGATGG + Intronic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945860837 2:215120260-215120282 GCAGAGTACTAGAGGGAAGAGGG + Intronic
946002237 2:216492288-216492310 AAATGGAATTTGAGGGGAGAAGG + Intergenic
946658643 2:221976324-221976346 CAATGGAAGTAGTGGGAAGTGGG - Intergenic
947263521 2:228251673-228251695 AAAAGGAGCTAAAGGGAAGAGGG + Intergenic
947318790 2:228894590-228894612 GAATGTAACAAGAGAGAAAATGG - Intronic
947669587 2:231927751-231927773 GAAGGCAACTGGAGTGAAGAGGG + Intergenic
947989985 2:234479197-234479219 CAATGTAACTAGAGGGGAAAAGG - Intergenic
948534317 2:238634837-238634859 GGATGTGACTAGAGGGAGGAGGG + Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169653619 20:7896846-7896868 GAATGGAACAGGAAGGCAGAGGG - Intronic
1170085916 20:12531385-12531407 GTTTTGAACTTGAGGGAAGAAGG + Intergenic
1170602224 20:17849562-17849584 GAAGGGAAGGAGAGGGAAAAGGG + Intergenic
1171029418 20:21663894-21663916 GTATGGAGCTGGAGGGAAGGAGG + Intergenic
1172432400 20:34903391-34903413 GAAGGGAACAAGAGTGAAGTGGG + Intronic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1173063531 20:39684983-39685005 GGATGGAATTAGAGGAATGATGG + Intergenic
1175206170 20:57313185-57313207 GAAAGAAAATAGAGGGAAGAGGG - Intergenic
1175693275 20:61081894-61081916 GCAGGTAACTTGAGGGAAGAGGG - Intergenic
1177146506 21:17412551-17412573 GAATGGAACCAGAGAAAACAGGG + Intergenic
1180092743 21:45541451-45541473 GAATGCATCCAGAGGGAAGGTGG - Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1183358151 22:37370318-37370340 GAAAGGAACCCGTGGGAAGAAGG - Exonic
1183857452 22:40645030-40645052 GAATGGAAGGAGAGTGAAGTGGG + Intergenic
1185144516 22:49123763-49123785 GGATGGAACTGGAGTGCAGATGG - Intergenic
951543484 3:23805607-23805629 GATTGGAACTAGATGGAATAGGG - Intergenic
951595289 3:24312118-24312140 GAATTGAAATAGTGGGAAGTAGG - Intronic
951662885 3:25089793-25089815 GAATGATACTAGAGTCAAGATGG + Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953970144 3:47340942-47340964 TAATGGAAATACAGGCAAGAGGG + Intronic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
955454795 3:59108098-59108120 GAATGGATCTGAAGGGAAAAGGG + Intergenic
956205452 3:66750334-66750356 TTATGGAACTAGTGGGAAGTTGG - Intergenic
957272131 3:78044428-78044450 GAACGGTACTAGAGAGAAGTTGG - Intergenic
957356209 3:79090463-79090485 GAAAGGAACAGGAGGGAAGCGGG - Intronic
957523774 3:81354155-81354177 GAATGGAGATGGAGGGATGATGG + Intergenic
958479433 3:94627963-94627985 GAAAGGAAAGAGAGGAAAGAAGG - Intergenic
959152593 3:102625222-102625244 GAATGGAACTAAAGGGTTTAAGG - Intergenic
959674851 3:109022990-109023012 AAAGGGAACTGGAAGGAAGAAGG + Intronic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
960811975 3:121634474-121634496 GCATGGCACTTGAAGGAAGAAGG + Intronic
961201541 3:125049489-125049511 GAACTGAACTAGAGGGAGGCCGG - Intronic
961416563 3:126763239-126763261 GAAAGGAAGGAGAGGGAAAAAGG - Intronic
961904098 3:130244472-130244494 AAAGGGAATAAGAGGGAAGAGGG + Intergenic
961940786 3:130635740-130635762 GAAGGGAGCTAGAGGCAAAATGG + Exonic
962559629 3:136592045-136592067 GAATGGAAGGAAAGGGAGGAAGG + Intronic
965551868 3:169974481-169974503 GAAAGGGAATAAAGGGAAGATGG + Intronic
965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG + Intergenic
966226097 3:177599704-177599726 GAATGGAGCAAGAGGAAGGAAGG + Intergenic
967056235 3:185831045-185831067 GATTGGAACAAGAGGATAGATGG + Intergenic
967712402 3:192724042-192724064 GAAGGGAAAGGGAGGGAAGAGGG + Intronic
968238823 3:197056243-197056265 TTATGGAGCTAGAGGGAAGATGG - Intronic
968937063 4:3617112-3617134 GAAAGGGACGGGAGGGAAGAAGG - Intergenic
968937118 4:3617268-3617290 GAATGGGATGAGAGGGAAGAAGG - Intergenic
969941349 4:10735016-10735038 GAATGTTCCTAGAGTGAAGACGG + Intergenic
972579682 4:40384240-40384262 TAATGGGGATAGAGGGAAGAGGG + Intergenic
973165209 4:47069045-47069067 AAATGGAAATGGAGGAAAGAAGG - Intronic
973582369 4:52357054-52357076 GAAGGAAAAGAGAGGGAAGACGG - Intergenic
974642147 4:64645060-64645082 GGGTGGAAATAAAGGGAAGATGG - Intergenic
974756885 4:66220934-66220956 GACAGGAACTACAGGCAAGAAGG + Intergenic
974781048 4:66553190-66553212 TCATGGACCTAGAGGGTAGAAGG + Intergenic
975457278 4:74607212-74607234 CAATGGAAGTATAGAGAAGAGGG - Intergenic
975622844 4:76310974-76310996 GTATGAAAGGAGAGGGAAGAGGG - Exonic
976400408 4:84600870-84600892 GAATGGAAATGGAGGGAGGCTGG + Intronic
976662766 4:87557275-87557297 TAATGGAACTTGAAAGAAGAAGG + Intergenic
978659126 4:111102040-111102062 GTATGGAATTAGAGGGTAAATGG + Intergenic
978992934 4:115108934-115108956 GAATGGAAATAAAGGAAGGAGGG + Intronic
979304312 4:119124864-119124886 GAAGGAAATTTGAGGGAAGAGGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
980110242 4:128629201-128629223 GATTCAAACTAGAAGGAAGATGG + Intergenic
981912528 4:149998201-149998223 GCATGGAAGTAGAGGGAAGCAGG - Intergenic
982022771 4:151220609-151220631 GAAACGAATTAGAGGGAAGTAGG - Intronic
982435439 4:155379396-155379418 GACGGGAATTAGAGGGAAGGTGG - Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983473733 4:168188898-168188920 GACTGAAACCAGAGGCAAGATGG + Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
984108215 4:175576725-175576747 GAATGGAGCTAGAGGGAGACTGG + Intergenic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
984858906 4:184219717-184219739 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
984859094 4:184220366-184220388 GAAGGGAAGAAAAGGGAAGAAGG + Intronic
985198990 4:187464530-187464552 GAAGGGAACAAGAGGGAAAATGG - Intergenic
985341575 4:188960293-188960315 GGATGGAAAGAAAGGGAAGATGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
987729668 5:21752786-21752808 GAAAGGAAGTAGAGGAAGGAAGG + Intronic
988296628 5:29371226-29371248 TAAAGGAAGTAGGGGGAAGAAGG + Intergenic
988430863 5:31117178-31117200 GAATGGATCTGAAGGGCAGAGGG - Intergenic
988459467 5:31420101-31420123 TATTGGAACTAGAGAGAATATGG - Intronic
988845995 5:35128933-35128955 GAAAGGAAAAAGAGGGAATACGG - Intronic
989261568 5:39424764-39424786 AAATGGAGCCAGAGGGAAGAAGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
992864152 5:80940877-80940899 AAAAAGAACTAGAGAGAAGACGG - Intergenic
993463861 5:88220209-88220231 GAAGGGAAGAAAAGGGAAGAGGG + Intronic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995549119 5:113263295-113263317 GAATGGAAGCCGAAGGAAGAAGG + Intronic
997203031 5:132024222-132024244 GAATGGAAATAAAAGGATGAGGG - Intergenic
997351458 5:133234223-133234245 AAATAGAACTAAAGGGAAAATGG + Intronic
998450604 5:142231736-142231758 GAACCTAACTAGAGGGCAGAAGG - Intergenic
999259331 5:150228293-150228315 GAAAGAAGCCAGAGGGAAGAGGG + Intronic
1000132051 5:158309846-158309868 GAAAGGAAATAGAGAGAGGAAGG - Intergenic
1000508532 5:162152453-162152475 GAATGGAAATTGAGAAAAGAAGG - Intronic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1003593022 6:7451649-7451671 GCCAGGGACTAGAGGGAAGAGGG + Intergenic
1004297111 6:14422877-14422899 GAATGAGAAAAGAGGGAAGAAGG - Intergenic
1005041868 6:21607429-21607451 GAATGGACTTGGAGGAAAGAAGG + Intergenic
1005112117 6:22293766-22293788 GAATGGAAGGGAAGGGAAGAAGG + Intronic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1006149598 6:31979597-31979619 GGATGGAACTGGAGGGAGGCAGG - Intronic
1007432399 6:41784254-41784276 GAAAGGCAAGAGAGGGAAGATGG - Intronic
1007470547 6:42087465-42087487 AAATGGAATGAGAAGGAAGAAGG - Intergenic
1007612170 6:43157225-43157247 GAACGGAACTGGAGGCTAGAAGG - Intronic
1007780664 6:44252379-44252401 GAAGAGAACAAGAGGCAAGAAGG - Intronic
1008405988 6:51119177-51119199 CAATGGAACCAAAGGGAAGTAGG - Intergenic
1008577037 6:52870706-52870728 GAAAGGGACTAGACTGAAGAAGG - Intronic
1009530554 6:64808056-64808078 GAAGGGAAAGAAAGGGAAGAAGG - Intronic
1009530569 6:64808105-64808127 GAAGGGAAGGAAAGGGAAGAAGG - Intronic
1010824297 6:80453862-80453884 GAATGAAAATGGAGGGGAGAAGG - Intergenic
1011137606 6:84116962-84116984 GAAGGGAAGAAAAGGGAAGAAGG - Intergenic
1012861520 6:104565830-104565852 GAGTGGAAGAAGAGGGAAGCAGG - Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014082803 6:117307104-117307126 AAATGCAACTAGAAGGAGGAAGG - Intronic
1014273727 6:119363621-119363643 CAATGAAACTAGAGGGAGAAAGG + Intergenic
1015364649 6:132384335-132384357 GAAAGAAAGGAGAGGGAAGAAGG - Intronic
1015678101 6:135772939-135772961 TAATGGAAATAGAGAGTAGAAGG - Intergenic
1015910910 6:138166799-138166821 GAAAGAAACTAGAGGTACGAAGG + Intronic
1016071138 6:139740459-139740481 GAAAGGAAGAAGAAGGAAGAAGG - Intergenic
1016102363 6:140118288-140118310 GAATTCTACTAGAGGTAAGAAGG + Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016625159 6:146158279-146158301 GAAGGAAACAAGAGGGAGGATGG + Intronic
1017643279 6:156514863-156514885 GAAGGGAACTAAAGGGAAAGAGG + Intergenic
1017667678 6:156736923-156736945 GAATGGAAATGGAGAGAACAAGG + Intergenic
1018516261 6:164582978-164583000 GAATGGAACTAAATGGACAAAGG - Intergenic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1020399742 7:7761910-7761932 GAATGGAAACTGAGGGAAAAGGG - Intronic
1020478176 7:8624035-8624057 TAATTGAGCTAGAGGGAAGGGGG + Intronic
1021046695 7:15931514-15931536 GAATGGAACAATAGAGAGGATGG - Intergenic
1021649863 7:22822634-22822656 GAAAGTGACTGGAGGGAAGAGGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023937009 7:44747548-44747570 GAAGGGAAGGGGAGGGAAGAAGG + Intergenic
1024941389 7:54766968-54766990 GAATGAAACAGGATGGAAGACGG - Intergenic
1026335381 7:69389985-69390007 AAATGGAAATATAGAGAAGATGG - Intergenic
1027173283 7:75887966-75887988 GAATGGAACAAGAGAGAAAATGG - Intronic
1028809637 7:95069428-95069450 AAATGGAAGGAGAGGGAAGGAGG + Intronic
1029288771 7:99485457-99485479 AAAAGGAACCAGAGGGAAGTAGG - Intronic
1029438956 7:100577019-100577041 GAAGGGAATTAGAGGGATGATGG + Intronic
1030509588 7:110468320-110468342 GATTGGGACTAGAGGGAGAAGGG - Intergenic
1031038780 7:116817061-116817083 GAGTTGAACTAGAGTCAAGAGGG + Intronic
1031214600 7:118873951-118873973 GAGTGGGGCTAGAGGGAAGGTGG - Intergenic
1032280071 7:130492795-130492817 GAATCGCACCAGAGGGAAGCCGG - Intronic
1032472596 7:132189389-132189411 GAATGGAGGTAGAGGGAAGGGGG + Intronic
1032650431 7:133872107-133872129 GAAAGGAACTGGAGGAAAGGTGG + Intronic
1032658993 7:133962519-133962541 GAAGGGAACCAGAGGGTCGAAGG - Intronic
1032879239 7:136071504-136071526 GAATGGAAGTTGAGGGAGAATGG + Intergenic
1033802027 7:144912800-144912822 GAATAGAACCAGGTGGAAGAAGG - Intergenic
1033926244 7:146464573-146464595 GAAGAGAAAAAGAGGGAAGAAGG - Intronic
1034083702 7:148304035-148304057 GAATGTATCTAGAGGGAGGGAGG - Intronic
1034625176 7:152487205-152487227 GAAAGGAAGGAAAGGGAAGAAGG - Intergenic
1035339586 7:158151658-158151680 AAAGGAAACAAGAGGGAAGAAGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1038389819 8:27185964-27185986 GAATGGAAATAGATTGTAGATGG - Intergenic
1038482098 8:27908953-27908975 AAAAGGAAATAGAGGGAAAAAGG - Intronic
1038675090 8:29616130-29616152 GAAAGGAAGGAGAGGGAAGGAGG + Intergenic
1038892889 8:31746970-31746992 TAATGGACCTAGAGAGTAGAAGG + Intronic
1039591374 8:38752693-38752715 GAATGAAAAGAGAGGGAAGGAGG - Intronic
1040817819 8:51527377-51527399 GATTGGAATTTGAGGGTAGAAGG - Intronic
1041765033 8:61410557-61410579 GAATAGAAGTAGAGCGAAGAAGG - Intronic
1041843079 8:62294339-62294361 GAAAGGAACTAGGCTGAAGATGG - Intronic
1043657321 8:82685323-82685345 GAAGGGAAATAGAAGGATGAAGG + Intergenic
1044119962 8:88382503-88382525 GGAGGGAAATGGAGGGAAGAGGG - Intergenic
1044265065 8:90172428-90172450 GAATGTCAATAGAGGAAAGAAGG - Intergenic
1046555435 8:115768240-115768262 GAATGGAAGGGAAGGGAAGAAGG - Intronic
1046911719 8:119635155-119635177 AAATGGAACTAGAAGTGAGAAGG - Intronic
1047640618 8:126817440-126817462 GACTGAAATTAGAGGGGAGATGG + Intergenic
1047683276 8:127277024-127277046 GCATTGGACTAGAGGGCAGAGGG - Intergenic
1047773688 8:128050842-128050864 GAATGGAACTTGAGGACAGGTGG - Intergenic
1049009329 8:139876753-139876775 GCCTGGAACCACAGGGAAGATGG - Intronic
1050194558 9:3067808-3067830 GAAAGGAAATATAAGGAAGATGG + Intergenic
1051992757 9:23172930-23172952 GAATGGAAAGACAGGGAAGAAGG + Intergenic
1052764611 9:32628484-32628506 GAATGGGATTGGAGGGGAGAGGG - Intergenic
1053190360 9:36060953-36060975 CAATGGAACTAGAAAGAACAAGG - Intronic
1053418825 9:37964000-37964022 CTCTTGAACTAGAGGGAAGAAGG - Intronic
1053537359 9:38938705-38938727 GAATGGAACTATAGCCAAAAAGG + Intergenic
1054454084 9:65420576-65420598 GAAAGGGACGGGAGGGAAGAAGG + Intergenic
1054628776 9:67425225-67425247 GAATGGAACTATAGCCAAAAAGG - Intergenic
1054876722 9:70105183-70105205 AAATTGAACTAGAAGGAACACGG - Intronic
1056128748 9:83563559-83563581 TAATGGAACCAGAGGAAGGATGG - Intergenic
1056826012 9:89876910-89876932 GAAAGGACATAGAGCGAAGAAGG + Intergenic
1058389056 9:104473505-104473527 GAATGGAAGTAGAAGGGAGGAGG - Intergenic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1060396891 9:123322611-123322633 GAATTGAGCTAATGGGAAGAAGG + Intergenic
1061125945 9:128675793-128675815 GAATGGAGCTACAGGGCAGCTGG - Intergenic
1061942652 9:133891684-133891706 GAATGGAAGGGGAGGGATGAAGG + Intronic
1061944339 9:133900330-133900352 GAATGGAACTAGTGACAGGAGGG - Intronic
1186590575 X:10925808-10925830 GAAAGGAACTAGGAGGAAAATGG + Intergenic
1189594245 X:42547601-42547623 GAATGGAGCAAGAGAGAAGGAGG + Intergenic
1189901229 X:45708483-45708505 GACTGGAACTGGAGGGGAGGGGG + Intergenic
1190098191 X:47499594-47499616 GGAGGGAAGAAGAGGGAAGATGG + Intergenic
1190203117 X:48381225-48381247 GAAGGGAAGGAAAGGGAAGAAGG - Intergenic
1190207421 X:48414184-48414206 GAAGGGAAGGAAAGGGAAGAAGG + Intergenic
1191904812 X:66076991-66077013 GAAGGGAAGGAAAGGGAAGAAGG - Intergenic
1192441761 X:71179786-71179808 GAATGGGGCTTGAGGGAAAAGGG - Intergenic
1194420780 X:93670565-93670587 AAAGGGAACTGGAGAGAAGAGGG - Intergenic
1195067491 X:101250702-101250724 GGATGGAACAACAGGGCAGAGGG + Intronic
1196198555 X:112860199-112860221 GTATTGAACTAGAGGGAGGGAGG - Intergenic
1196806897 X:119596223-119596245 GAATGAAAATAAAAGGAAGAGGG + Intronic
1197146739 X:123180261-123180283 AAATGGAACTATAGAGAAGTAGG + Intergenic
1197875167 X:131095265-131095287 GAATGGAACAGGAGGCAGGAGGG - Intergenic
1198670874 X:139079519-139079541 GAAAGAAGCTAGAGGGAGGATGG - Intronic
1198714312 X:139540137-139540159 GAATAGAACCAGAAGGGAGATGG - Intronic
1198855897 X:141015858-141015880 GAATGGAACCAGAAAGAAGCAGG - Intergenic
1198906796 X:141571509-141571531 GAATGGAACCAGAAAGAAGCAGG + Intergenic
1199227745 X:145397495-145397517 GAATAGAAATAGAGTGAAAAAGG + Intergenic
1199589888 X:149457546-149457568 GAATGGAGACAGAGGGGAGATGG + Intergenic
1201146263 Y:11067016-11067038 GGAGGGAAGGAGAGGGAAGAGGG + Intergenic