ID: 1023183462

View in Genome Browser
Species Human (GRCh38)
Location 7:37509854-37509876
Sequence GGTTTCCACTGAGACTTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023183458_1023183462 6 Left 1023183458 7:37509825-37509847 CCATTAATTTTACAATACTATTT No data
Right 1023183462 7:37509854-37509876 GGTTTCCACTGAGACTTAGCAGG No data
1023183456_1023183462 14 Left 1023183456 7:37509817-37509839 CCTGAATCCCATTAATTTTACAA No data
Right 1023183462 7:37509854-37509876 GGTTTCCACTGAGACTTAGCAGG No data
1023183457_1023183462 7 Left 1023183457 7:37509824-37509846 CCCATTAATTTTACAATACTATT No data
Right 1023183462 7:37509854-37509876 GGTTTCCACTGAGACTTAGCAGG No data
1023183455_1023183462 21 Left 1023183455 7:37509810-37509832 CCTAAAACCTGAATCCCATTAAT No data
Right 1023183462 7:37509854-37509876 GGTTTCCACTGAGACTTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023183462 Original CRISPR GGTTTCCACTGAGACTTAGC AGG Intergenic
No off target data available for this crispr