ID: 1023185271

View in Genome Browser
Species Human (GRCh38)
Location 7:37526571-37526593
Sequence CAGTGTGACCAAAAGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023185271_1023185273 22 Left 1023185271 7:37526571-37526593 CCAGATTCCTTTTGGTCACACTG No data
Right 1023185273 7:37526616-37526638 AACCCCAAATCACGAGATTGTGG No data
1023185271_1023185278 25 Left 1023185271 7:37526571-37526593 CCAGATTCCTTTTGGTCACACTG No data
Right 1023185278 7:37526619-37526641 CCCAAATCACGAGATTGTGGGGG No data
1023185271_1023185274 23 Left 1023185271 7:37526571-37526593 CCAGATTCCTTTTGGTCACACTG No data
Right 1023185274 7:37526617-37526639 ACCCCAAATCACGAGATTGTGGG No data
1023185271_1023185276 24 Left 1023185271 7:37526571-37526593 CCAGATTCCTTTTGGTCACACTG No data
Right 1023185276 7:37526618-37526640 CCCCAAATCACGAGATTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023185271 Original CRISPR CAGTGTGACCAAAAGGAATC TGG (reversed) Intergenic
No off target data available for this crispr