ID: 1023185549

View in Genome Browser
Species Human (GRCh38)
Location 7:37529263-37529285
Sequence TACCTAGACCTGGCACATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023185549_1023185552 22 Left 1023185549 7:37529263-37529285 CCCATATGTGCCAGGTCTAGGTA No data
Right 1023185552 7:37529308-37529330 TTTACTCTTAGCCAACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023185549 Original CRISPR TACCTAGACCTGGCACATAT GGG (reversed) Intergenic
No off target data available for this crispr