ID: 1023187462

View in Genome Browser
Species Human (GRCh38)
Location 7:37547254-37547276
Sequence CAGGCTCAGGATCCTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023187462_1023187472 13 Left 1023187462 7:37547254-37547276 CCTCTCAGAGGATCCTGAGCCTG No data
Right 1023187472 7:37547290-37547312 CCACATGATTTCATTGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023187462 Original CRISPR CAGGCTCAGGATCCTCTGAG AGG (reversed) Intergenic
No off target data available for this crispr