ID: 1023195722

View in Genome Browser
Species Human (GRCh38)
Location 7:37636561-37636583
Sequence ACTTATAAGTGGAAGCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023195722_1023195724 -4 Left 1023195722 7:37636561-37636583 CCATTCAGCTTCCACTTATAAGT No data
Right 1023195724 7:37636580-37636602 AAGTGAGAACTTGCAGTGTTTGG No data
1023195722_1023195725 25 Left 1023195722 7:37636561-37636583 CCATTCAGCTTCCACTTATAAGT No data
Right 1023195725 7:37636609-37636631 GTTCCTGCATTAGTTTGCTGAGG 0: 526
1: 1602
2: 3743
3: 4394
4: 4212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023195722 Original CRISPR ACTTATAAGTGGAAGCTGAA TGG (reversed) Intergenic
No off target data available for this crispr