ID: 1023200038

View in Genome Browser
Species Human (GRCh38)
Location 7:37687107-37687129
Sequence ATCATCAATTGGGCAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 311}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023200038_1023200044 2 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200044 7:37687132-37687154 CAGTCGGAGCACTGTTTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 88
1023200038_1023200043 1 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200043 7:37687131-37687153 TCAGTCGGAGCACTGTTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 72
1023200038_1023200051 30 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200051 7:37687160-37687182 CCCACAGCTACCCAGGGCAGGGG 0: 1
1: 2
2: 9
3: 67
4: 600
1023200038_1023200046 23 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200046 7:37687153-37687175 GGAATTTCCCACAGCTACCCAGG No data
1023200038_1023200047 24 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200047 7:37687154-37687176 GAATTTCCCACAGCTACCCAGGG No data
1023200038_1023200048 28 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200038_1023200049 29 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200049 7:37687159-37687181 TCCCACAGCTACCCAGGGCAGGG 0: 1
1: 0
2: 10
3: 47
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023200038 Original CRISPR ATCATCAATTGGGCAGGCAG TGG (reversed) Intronic
901198653 1:7454299-7454321 ATCAAGAGATGGGCAGGCAGGGG + Intronic
901850280 1:12010798-12010820 ATCATGAGCTGGGCAGGCCGAGG - Intronic
902608510 1:17582858-17582880 AGCATCCAGTGGGCAGGGAGGGG - Intronic
904057699 1:27682887-27682909 ATGATCGATTGAGCAAGCAGGGG - Intergenic
906265354 1:44424725-44424747 ATCAGCAATAAGACAGGCAGAGG - Intronic
907431298 1:54413546-54413568 AGCATCAATGGGGCAGGAAGGGG + Intergenic
910811556 1:91242568-91242590 GTGATCAATTGAGCAAGCAGGGG + Intergenic
912445340 1:109731820-109731842 ATGATCGATTGAGCAAGCAGGGG + Intronic
912980045 1:114363143-114363165 ATGATCGATTGAGCAAGCAGGGG + Intergenic
912980755 1:114369324-114369346 GTGATCAATTGAGCAAGCAGGGG + Intergenic
913062019 1:115217112-115217134 CTCATCATTTGGGCATGCACAGG - Intergenic
913457521 1:119048811-119048833 ATCATCACTTTGGGAGGCCGAGG + Intronic
916750591 1:167720105-167720127 ATGATCAATTGAGCAAGCAGAGG + Intergenic
917168748 1:172145020-172145042 TTCCTCAACTGGGCAGGAAGTGG + Intronic
922680305 1:227589628-227589650 GTGATCAATTGAGCAAGCAGGGG + Intronic
922689825 1:227679515-227679537 ATGATCAATTGAGCAAGCAGGGG - Intergenic
922691753 1:227698276-227698298 ACCATCAATTGAGAAGGGAGTGG - Intergenic
922864761 1:228850458-228850480 GTGATCAATTGAGCAAGCAGGGG + Intergenic
922941769 1:229473134-229473156 CCCATCTATTGGGGAGGCAGTGG + Intronic
923476988 1:234343565-234343587 CTCAGCTATTGGGGAGGCAGAGG + Intergenic
923628115 1:235630761-235630783 ATAATCAATTGGGTGGCCAGAGG + Intronic
924710889 1:246529219-246529241 ATCACCCATTGGGCTGTCAGAGG - Intergenic
924859415 1:247905608-247905630 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1065704315 10:28457896-28457918 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1065931389 10:30482224-30482246 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1066258290 10:33703381-33703403 CTCATCACTTTGGGAGGCAGAGG - Intergenic
1067378419 10:45749740-45749762 AGCATGAACTGGGCAGGCAGAGG + Intronic
1067886116 10:50090417-50090439 AGCATGAACTGGGCAGGCAGAGG + Intronic
1069095876 10:64259047-64259069 ATCATAAATTGTACATGCAGGGG - Intergenic
1069456429 10:68557739-68557761 TTCATCACTTAGGGAGGCAGAGG - Intergenic
1069487502 10:68833533-68833555 ATGATCAATTGAACAAGCAGGGG + Intronic
1070017109 10:72544170-72544192 ATGATCAATTGAGCAAGCAGCGG - Intronic
1070052636 10:72904167-72904189 ATGATCGATTGAGCAAGCAGGGG - Intronic
1071708050 10:88020793-88020815 ATCCACATTTAGGCAGGCAGTGG + Intergenic
1072197387 10:93128216-93128238 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1074482702 10:113840041-113840063 ATCAGCACTTGGGGAGGCTGAGG + Intronic
1074607451 10:114987818-114987840 CTCAGCAATTGGGGAGGCTGAGG - Intergenic
1076611092 10:131726327-131726349 ATCAACAATTGGGAAGAAAGGGG - Intergenic
1076814141 10:132906377-132906399 AGCAGGAAATGGGCAGGCAGAGG - Intronic
1078548049 11:12260552-12260574 ATCATCCACTTTGCAGGCAGTGG - Intronic
1081646725 11:44795383-44795405 ACCATGACTGGGGCAGGCAGTGG - Intronic
1083081792 11:60101556-60101578 ATGATCGATTGAGCAAGCAGCGG + Intergenic
1083089529 11:60185708-60185730 TTGATCAATTGAGCAAGCAGGGG - Intergenic
1083090360 11:60192993-60193015 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1083197644 11:61098645-61098667 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1083230698 11:61316669-61316691 CTCAACACTTGGGAAGGCAGAGG + Intronic
1084346978 11:68559587-68559609 ATCAGGAATTGGGGAAGCAGGGG - Intronic
1086421278 11:86639977-86639999 ATCTTCTATTGGGCAGAGAGTGG + Intronic
1086759751 11:90613088-90613110 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1086973807 11:93110595-93110617 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1087394776 11:97583805-97583827 CTGATCAATTGAGCAAGCAGGGG + Intergenic
1087684130 11:101244575-101244597 ATGATCAATTGAGCAAGCAGGGG - Intergenic
1089950200 11:122518638-122518660 ATGATCGATTGAGCAAGCAGCGG - Intergenic
1092946877 12:13464653-13464675 ATAATCACTGAGGCAGGCAGAGG - Intergenic
1093276182 12:17130739-17130761 ATCATGAATTATTCAGGCAGTGG - Intergenic
1093594481 12:20944572-20944594 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1094617445 12:32048621-32048643 ACCAGCAATTTGGGAGGCAGAGG + Intergenic
1095291726 12:40486015-40486037 ATCATCAACTGGGGTGACAGGGG + Exonic
1096587621 12:52633150-52633172 CTCTTGAATTGGGGAGGCAGGGG + Intergenic
1098558223 12:71843032-71843054 ATCATCACTTTGGGAGGCTGAGG + Intronic
1098690501 12:73481688-73481710 ATGATCGATTGAGCAAGCAGTGG - Intergenic
1099240561 12:80133702-80133724 ATCAGCACTTTGGTAGGCAGAGG + Intergenic
1099688905 12:85925643-85925665 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1101028055 12:100633281-100633303 ATGATCGATTGAGCAAGCAGTGG + Intergenic
1102319319 12:111917739-111917761 ATCATTAATTTTACAGGCAGTGG - Intergenic
1102630944 12:114279210-114279232 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1102749093 12:115276712-115276734 ATCATCATTTGCACAGACAGTGG - Intergenic
1104285083 12:127417820-127417842 AACATCAAATAGGCAGGAAGAGG - Intergenic
1105963075 13:25359931-25359953 ATGATCAATTGAGCAAGCAAGGG - Intergenic
1109802336 13:67397518-67397540 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1109993290 13:70087355-70087377 ATAATCACTGGGGCAGGCTGAGG + Intronic
1110692254 13:78444312-78444334 ATCATGAATCCGGGAGGCAGAGG + Intergenic
1112057833 13:95707137-95707159 ATCATCAATTGCGCATGCAAGGG - Intronic
1113279721 13:108776261-108776283 AGCATGAATTGGGAAGTCAGGGG + Intronic
1114218210 14:20673667-20673689 CGCAACATTTGGGCAGGCAGGGG - Intergenic
1114752869 14:25225274-25225296 ATCCACAAATGGGAAGGCAGTGG + Intergenic
1115002916 14:28442971-28442993 ATCATCATTTCGGTGGGCAGTGG - Intergenic
1115805171 14:37042995-37043017 ATAATCAATTGGAAAGGAAGTGG - Intronic
1115955722 14:38777120-38777142 ATCATTAATTGGGAAGGCATTGG - Intergenic
1116470857 14:45283854-45283876 ATAATAAATGGGGGAGGCAGAGG - Intergenic
1116876199 14:50114583-50114605 ATCAACACTTTGGAAGGCAGAGG + Intronic
1117648241 14:57875232-57875254 ATCATCAGCTGGGCATGCAAAGG + Intronic
1117895194 14:60477174-60477196 ATCATCTAGAGGGTAGGCAGAGG - Intronic
1120308749 14:82803580-82803602 ATGATCGATTGAGCAAGCAGGGG + Intergenic
1121866692 14:97368486-97368508 ATCATGATTTGGGCAGGGCGTGG + Intergenic
1125902087 15:43357764-43357786 CTCATCTATTGGGGAGGCTGGGG + Intergenic
1125981147 15:44002586-44002608 ATGATCAATTGAGCAAGCAGGGG + Intronic
1126485509 15:49175892-49175914 ATGATCGATTGAGCAAGCAGGGG - Intronic
1128013051 15:64316857-64316879 ATGATCGATTGAGCAAGCAGGGG - Intronic
1128203004 15:65825922-65825944 GTGATCAATTGAGCAAGCAGGGG - Intronic
1130657360 15:85801078-85801100 GTCATCGATTGAGCAAGCAGGGG - Intergenic
1131122583 15:89831783-89831805 ATCCTCAATGTGGCAGGCACAGG + Exonic
1131371709 15:91887335-91887357 TGCAGGAATTGGGCAGGCAGGGG - Intronic
1131402515 15:92136749-92136771 ATCATCTATTTGGCAGGTTGAGG - Intronic
1132782240 16:1633817-1633839 ATCAGCACTTTGGGAGGCAGAGG + Intronic
1133422429 16:5657980-5658002 ATCATCATTTTGGGAGGCCGAGG - Intergenic
1133632408 16:7633716-7633738 CTCTCCAATTGGGTAGGCAGAGG + Intronic
1137004491 16:35260995-35261017 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1138047197 16:53737783-53737805 ATCTTTAATTGGGTAGGCTGGGG - Intronic
1139100147 16:63756220-63756242 ATGATCGATTGAGCAAGCAGAGG + Intergenic
1142910703 17:3088604-3088626 ATGATCAATTGAGCAAGCAGGGG + Intergenic
1143414818 17:6738616-6738638 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1143618664 17:8068724-8068746 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1143985699 17:10911943-10911965 ATGGGCAATTTGGCAGGCAGGGG + Intergenic
1144300296 17:13917255-13917277 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1147450117 17:40499262-40499284 GTGATCAATTGAGCAAGCAGGGG - Intronic
1147810635 17:43167411-43167433 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1148574153 17:48696595-48696617 ATCAGCACTTTGGGAGGCAGAGG + Intergenic
1148594000 17:48838163-48838185 GTGATCAATTGAGCAAGCAGGGG + Intronic
1148829330 17:50420181-50420203 ATGATCGATTGAGCAAGCAGGGG + Intergenic
1149293853 17:55242954-55242976 CTCAGCAATTTGGCAGGCAAAGG + Intergenic
1151197711 17:72443788-72443810 CTCAGCAATTTGGGAGGCAGAGG + Intergenic
1153830841 18:8921168-8921190 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1154014782 18:10606581-10606603 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1154190706 18:12228997-12229019 ATGATCGATTGAGCAAGCAGGGG + Intergenic
1155748193 18:29387707-29387729 CTCATCACTTTGGGAGGCAGAGG + Intergenic
1156289707 18:35735605-35735627 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1156386869 18:36613118-36613140 ACCTACAACTGGGCAGGCAGGGG - Intronic
1157170315 18:45398406-45398428 AGCAGGGATTGGGCAGGCAGAGG + Intronic
1158807006 18:60985769-60985791 ATGATCCATTGAGCAAGCAGGGG - Intergenic
1158829937 18:61265508-61265530 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1163454030 19:17395415-17395437 AGCAGCAATTAGCCAGGCAGAGG - Intergenic
1163942753 19:20510112-20510134 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1163943861 19:20518277-20518299 ATGATCAATTGAACAAGCAGGGG + Intergenic
1163968215 19:20768679-20768701 ATGATCGATTGAGCAAGCAGGGG - Intronic
1164121380 19:22268556-22268578 ATGATCAATTGAGCAAGCAGGGG + Intergenic
1164121926 19:22273329-22273351 ATGATCAACTGAGCAAGCAGGGG + Intergenic
1164178389 19:22798074-22798096 ATGATCAGTTGAGCAAGCAGGGG + Intergenic
1164216438 19:23154706-23154728 ATGATCAATTGAGCAAGCAGGGG + Intergenic
1164217681 19:23163997-23164019 ATGATCCATTGAGCAAGCAGGGG + Intergenic
1167089689 19:47335247-47335269 AGCACCACTTGGGCAGACAGTGG + Intronic
1167386210 19:49165756-49165778 AGCCTCAAGTGGGAAGGCAGAGG - Intronic
1167457151 19:49602406-49602428 ATCATGAATTGGGCCGGACGCGG + Intronic
925195024 2:1915810-1915832 ATCCTCAATTTGCCAGGCATTGG + Intronic
925466650 2:4111972-4111994 ATTTTCAACTTGGCAGGCAGGGG + Intergenic
927548739 2:23978076-23978098 CTCAGCAATTTGGGAGGCAGAGG - Intronic
927772384 2:25874827-25874849 ATCAGCACTTTGGCAGGCTGAGG + Intronic
928270438 2:29850354-29850376 ATCATGATGTGGGGAGGCAGGGG + Intronic
929816031 2:45232351-45232373 ATCATCAATAGGGGAAGGAGAGG + Intergenic
930532864 2:52612535-52612557 ATGAGCAATTGAGCAAGCAGGGG - Intergenic
931125746 2:59274345-59274367 AACCTCAGTTGTGCAGGCAGAGG - Intergenic
931807084 2:65817822-65817844 CTCATCCATTGGGAAGCCAGAGG + Intergenic
932290070 2:70569603-70569625 CTCATCAGTTGAGCTGGCAGGGG - Intergenic
933138437 2:78763510-78763532 ATGATCGATTGAGCAAGCAGGGG - Intergenic
933307418 2:80619269-80619291 ATCATGAATTCTGAAGGCAGGGG + Intronic
934123146 2:88859628-88859650 AGCATCAATCGGGCAGACACAGG + Intergenic
935213013 2:100954412-100954434 CTCAGCAATTTGGGAGGCAGAGG + Intronic
935241915 2:101186296-101186318 ATGATCAATTGAGCAAGCAGGGG + Intronic
935611966 2:105035311-105035333 ATGATCGATTGAGCAAGCAGGGG + Intergenic
935722915 2:105995686-105995708 GTCATCAATTAGCCAGGCACTGG + Intergenic
935970252 2:108524160-108524182 GTGATCAATTGAGCAAGCAGGGG - Intergenic
936382999 2:112004305-112004327 AGCATCAATTGCTGAGGCAGGGG + Intronic
936386420 2:112033671-112033693 ATCAGCACTTTGGAAGGCAGAGG + Intergenic
936419930 2:112353717-112353739 GTGATCAATTGAGCAAGCAGGGG + Intergenic
938127193 2:128683068-128683090 TTGATCAATTGAGCAAGCAGGGG - Intergenic
938163074 2:129004037-129004059 AACATCACTGGTGCAGGCAGAGG - Intergenic
938703293 2:133898398-133898420 ATGATCGATTGAGCAAGCAGGGG - Intergenic
938893492 2:135728298-135728320 ATTATCTGTTGGGCAGGCAGTGG - Intergenic
939156993 2:138537328-138537350 ATGATCGATTGAGCAAGCAGGGG + Intronic
940034994 2:149303734-149303756 ATTTTCAATTAGGCAGGCAGGGG - Intergenic
942098777 2:172557728-172557750 ATCATCACTTTGGGAGGCCGAGG - Intronic
946263648 2:218519736-218519758 AGCATGAACTGGGGAGGCAGAGG + Intronic
948373722 2:237506538-237506560 ATGATCGATTGAGCAAGCAGGGG + Intronic
948682986 2:239648899-239648921 AGCATCCATGGGGCTGGCAGGGG + Intergenic
1170762902 20:19266408-19266430 ATCACCAATGAGTCAGGCAGAGG - Intronic
1171215376 20:23348753-23348775 ATGATCAATTGAGCAAGCAGTGG - Intergenic
1171380674 20:24731763-24731785 ATCATCCTGTGTGCAGGCAGGGG + Intergenic
1172820111 20:37725155-37725177 CTCAACAATTTGGGAGGCAGAGG - Intronic
1175608447 20:60330459-60330481 AGCACCAGGTGGGCAGGCAGAGG - Intergenic
1175861938 20:62155148-62155170 ATGAGCACTTGGGGAGGCAGAGG + Intronic
1177011749 21:15738936-15738958 ATGATCAAATGAGCAAGCAGGGG - Intronic
1177519353 21:22197795-22197817 GTGATCGATTGGGCAAGCAGGGG - Intergenic
1177743811 21:25186356-25186378 ATGATCAATGGTGCATGCAGTGG - Intergenic
1178447527 21:32659628-32659650 ATGATCAATTGAGCAAGCAGGGG - Intronic
1179467707 21:41588776-41588798 GTGATCAATTGAGCAAGCAGCGG - Intergenic
1179530236 21:42013263-42013285 GTCAGGCATTGGGCAGGCAGAGG - Intergenic
1180012919 21:45063174-45063196 ACCATCAATTGTGGAGGCTGAGG + Intergenic
1181467980 22:23120538-23120560 ATCACCTCCTGGGCAGGCAGTGG - Intronic
1181598320 22:23933085-23933107 CTCAACACTTTGGCAGGCAGAGG + Intergenic
1181755231 22:25019452-25019474 ATCATCAATTTGAAAGGTAGAGG - Intronic
1182843704 22:33413546-33413568 TGCTTGAATTGGGCAGGCAGAGG - Intronic
1185386426 22:50533499-50533521 ATGATCGATTGAGCAAGCAGGGG + Intergenic
951778699 3:26339418-26339440 ATCTGCAATTGGGAAGGGAGTGG + Intergenic
951855847 3:27196243-27196265 GTGATCAATTGAGCAGGCAGGGG - Intronic
952931126 3:38361770-38361792 ATCAAACCTTGGGCAGGCAGTGG - Intronic
953462655 3:43094072-43094094 ACAAGCAATTGGGCAGTCAGTGG + Intronic
953733796 3:45473632-45473654 ATCAGCACTTTGGCAGGCTGAGG - Intronic
954239615 3:49283410-49283432 ATCATCAATTTGGGAGGCCAAGG - Intronic
954260337 3:49434109-49434131 CTCAGCAATTAGGGAGGCAGAGG - Intergenic
955189328 3:56745616-56745638 ATCTTCAACATGGCAGGCAGTGG + Intronic
955228919 3:57082122-57082144 ATCATCAATTGGGGAAGCCAGGG + Intergenic
955316907 3:57946716-57946738 ATCAGCACTTTGGCAGGCTGAGG + Intergenic
956293964 3:67692000-67692022 ATAATCACCTGGGGAGGCAGAGG + Intergenic
956416979 3:69042286-69042308 CTCAGCACTTGGGGAGGCAGAGG - Intronic
958510951 3:95048260-95048282 ATCATCAGTTGTGCAGGCAGGGG - Intergenic
958600716 3:96293311-96293333 GTCATAAATTGGTCAGGTAGGGG + Intergenic
959001169 3:100965836-100965858 AACATGAATTGAGCAGGCTGAGG - Intronic
959920900 3:111867036-111867058 ATCATTATTTGGGCACGCAGTGG + Intronic
960283305 3:115799826-115799848 GTGATCAATTGAGCAAGCAGGGG + Intergenic
960687788 3:120311719-120311741 ATGATCGATTGAGCAAGCAGGGG - Intergenic
962097088 3:132303394-132303416 GTGATCAATTGAGCAAGCAGGGG + Intergenic
962097831 3:132310217-132310239 ATGATCGATTGAGCAAGCAGGGG - Intergenic
962276710 3:134020139-134020161 ATGATCCATTGAGCAAGCAGGGG - Intronic
962704944 3:138033980-138034002 AGCATCAAGAGGGCAGGCATTGG - Intergenic
963604276 3:147400812-147400834 ATTATCAATTGGGCTGGCTAAGG + Intronic
963727479 3:148938359-148938381 GGCATCATTTGGGAAGGCAGTGG - Intergenic
964077864 3:152713542-152713564 GTCATCGATTGAGCAAGCAGGGG + Intergenic
964523082 3:157587722-157587744 GTGATCAATTGAGCAAGCAGCGG + Intronic
964924493 3:161938920-161938942 GTGATCAATTGAGCAAGCAGGGG - Intergenic
965267776 3:166568705-166568727 ATCCTCAATTCAGCAGGAAGGGG - Intergenic
965566037 3:170118659-170118681 ACCAGCAATTTGGCAGGCCGAGG - Intronic
966417688 3:179706295-179706317 AGAATCAATTGGGTAGGGAGAGG + Intronic
966775625 3:183540692-183540714 ATCATCAATGGGGCCGGGTGTGG - Intronic
967972480 3:195009642-195009664 ATGATCGATTGAGCAAGCAGGGG + Intergenic
968112161 3:196057344-196057366 GTGATCAATTGGGCAAGCAGGGG - Intronic
969863088 4:10052977-10052999 ATCATCACTTTGGGAGGCTGAGG + Intronic
970370203 4:15398371-15398393 GACATCAATGGGGCAGGGAGGGG - Intronic
970737620 4:19193304-19193326 ATGATCGATTGAGCAAGCAGGGG + Intergenic
971576543 4:28281636-28281658 ATGATCGATTGAGCAAGCAGGGG - Intergenic
971752045 4:30662825-30662847 ATGATCAATAGAGCAAGCAGGGG + Intergenic
972216674 4:36905991-36906013 ATGATCGATTGAGCAAGCAGCGG - Intergenic
972784269 4:42312397-42312419 GTGATCAATTGAGCAAGCAGGGG + Intergenic
972910472 4:43810327-43810349 CTCAACAATTTGGGAGGCAGAGG + Intergenic
972933216 4:44100860-44100882 ATGATCAATTGAGCAAGCAGGGG + Intergenic
973191161 4:47387690-47387712 GTCATGACTTGGGCAGGCATGGG + Intronic
974003725 4:56535491-56535513 ATGATCGATTGAGCAAGCAGGGG - Intronic
974992531 4:69112234-69112256 ATGATCGATTGAGCAAGCAGTGG - Intronic
975647876 4:76563670-76563692 ACTATCAAGTGGGCAGGCAGTGG + Intronic
976191241 4:82489150-82489172 TTCAACACTTGGGGAGGCAGAGG - Intronic
976714424 4:88108270-88108292 ATCAGCAATTTGGGAGGCCGAGG + Intronic
977610361 4:99024214-99024236 ATGATCAATTGAGCAAGCAGGGG - Intronic
977740897 4:100480719-100480741 AACATTAATTGGGCAGGCAAAGG + Intronic
979924678 4:126546462-126546484 GTGATCAATTGAGCAAGCAGGGG - Intergenic
980117243 4:128691289-128691311 GTGATCAATTGAGCAAGCAGGGG - Intergenic
980319056 4:131243866-131243888 ATCAGCCATTAGGCAGGCAACGG + Intergenic
980772886 4:137400317-137400339 ATCCTAAATTGGGGAGGCAAAGG + Intergenic
981092768 4:140749113-140749135 ATCAGCAATTTGGGAGGCTGAGG + Intronic
981292357 4:143090724-143090746 ATGATCAATTGAGCAAGCAGCGG - Intergenic
981476175 4:145189286-145189308 CCCACCAATTTGGCAGGCAGAGG - Intergenic
982002163 4:151031084-151031106 CTCAGCAATTTGGGAGGCAGAGG + Intergenic
982870186 4:160569771-160569793 AACATCAATTGGGTTGGCAAAGG + Intergenic
983264368 4:165492619-165492641 GTGATCAATTGAGCAAGCAGGGG + Intronic
983637176 4:169909665-169909687 ATGATCAATTGAGCAAGCACGGG + Intergenic
983877969 4:172899012-172899034 ATGATCAATTGGGCAAGCAGTGG - Intronic
983897622 4:173098955-173098977 ATGATCAATTGAGCAAGCAGGGG - Intergenic
984644208 4:182202760-182202782 ATCCACAGCTGGGCAGGCAGAGG + Intronic
986691086 5:10314471-10314493 ATGTTCAATTGGGGAGGGAGAGG + Intergenic
987187562 5:15440736-15440758 ATCATCAGCTGGGCAGGAAGAGG - Intergenic
987877251 5:23693671-23693693 TTCTTCTTTTGGGCAGGCAGTGG + Intergenic
988205816 5:28132481-28132503 ATTATCCATGGGGAAGGCAGGGG - Intergenic
988276916 5:29092296-29092318 GTGATCAATTGAGCAAGCAGGGG - Intergenic
988556077 5:32237276-32237298 ATCATCAATAAGGCAGCCAAGGG + Intronic
988733846 5:34001255-34001277 CTCATGAATTGGGCAGTCTGTGG + Intronic
989095572 5:37778237-37778259 GTGATCAATTGAGCAAGCAGCGG + Intergenic
990549622 5:56861282-56861304 ATCATTATTTGAACAGGCAGTGG + Intronic
990639292 5:57763789-57763811 ATGATTAATTGGGGAGGGAGAGG - Intergenic
992261117 5:74971234-74971256 ATGATCGATTGAGCAAGCAGGGG - Intergenic
993682476 5:90896866-90896888 AGCATTAATTGGGCAAGAAGGGG + Intronic
994831948 5:104794792-104794814 GTGATCAATTGAGCAAGCAGGGG - Intergenic
995474301 5:112532436-112532458 GTGATCAATTGAGCAAGCAGGGG - Intergenic
995867286 5:116704985-116705007 ATGATCAATTGAGCAAGCAGGGG - Intergenic
995867738 5:116709449-116709471 ATGATCAATTGAGCAAGCAGGGG - Intergenic
995982356 5:118119609-118119631 ATAATCAATTGGTCAGTCAGTGG + Intergenic
997439828 5:133901284-133901306 TTCATGACCTGGGCAGGCAGAGG - Intergenic
998246474 5:140511073-140511095 CTCAGCACTTTGGCAGGCAGAGG - Intronic
999397688 5:151240528-151240550 GTGATCAATTGAGCAAGCAGGGG + Intronic
999505994 5:152196912-152196934 AGCATCAAATGGGCAAGCAGAGG + Intergenic
999647688 5:153735382-153735404 ATGATCAACTGAGCAAGCAGGGG + Intronic
1000108883 5:158088125-158088147 TTCATCAAATAGGCAGGTAGTGG + Intergenic
1000236484 5:159366444-159366466 ATGATCAATTAAGCAAGCAGTGG - Intergenic
1000237267 5:159373673-159373695 ATGATCAATTGAGCAAGCAGTGG - Intergenic
1002999479 6:2317821-2317843 ATGATCGATTGAGCAAGCAGGGG + Intergenic
1003272604 6:4620673-4620695 GTCATCAATTGAGCAAGCAGGGG + Intergenic
1004213876 6:13682700-13682722 ATCAGTAATTTGGGAGGCAGAGG - Intronic
1005717684 6:28567121-28567143 ATGATCGATTGAGCAAGCAGAGG + Intergenic
1006344759 6:33472045-33472067 ATCATCAAATGTTCAGTCAGTGG - Intergenic
1006570397 6:34998638-34998660 ATGATCGATTGAGCAAGCAGGGG - Intronic
1007203423 6:40130388-40130410 CTCATCAATATGGCAGTCAGTGG - Intergenic
1007426529 6:41749622-41749644 AAGATCAATTGAGTAGGCAGGGG - Intronic
1008123938 6:47647946-47647968 GTGATCAATTGAGCAAGCAGAGG - Intergenic
1008379967 6:50830233-50830255 AACATCATTTGGGCTGGCAGGGG + Intronic
1009773920 6:68180408-68180430 ATGATCGATTGAGCAAGCAGCGG + Intergenic
1011227108 6:85119744-85119766 ATCCTCCTTTTGGCAGGCAGGGG - Intergenic
1013260186 6:108433841-108433863 CTCAGCAATTTGGGAGGCAGAGG - Intronic
1013296879 6:108765565-108765587 ATCATCCACTCGGCAGGTAGGGG - Intergenic
1013427374 6:110025522-110025544 ATGATCAATTGAGCAAGCAGGGG + Intergenic
1013784780 6:113767619-113767641 TTCAGCACTTGGGCAGGCTGAGG + Intergenic
1015976928 6:138799836-138799858 ATCATCCAGTCGGCATGCAGTGG - Intronic
1016686507 6:146888293-146888315 TTCTGCTATTGGGCAGGCAGAGG - Intergenic
1018773108 6:166989467-166989489 ATGATCGATTGAGCAAGCAGTGG + Intergenic
1019757834 7:2786785-2786807 ATCTTGAATGGGGCAGGGAGAGG - Intronic
1020502662 7:8942800-8942822 CCCATCAATTTGGGAGGCAGAGG + Intergenic
1021505011 7:21373124-21373146 GTGATCAATTGAGCAAGCAGTGG + Intergenic
1021806209 7:24358497-24358519 AGCAACAATTGGGCAGGGCGTGG + Intergenic
1023150361 7:37196112-37196134 AACATCAAGAAGGCAGGCAGAGG + Intronic
1023200038 7:37687107-37687129 ATCATCAATTGGGCAGGCAGTGG - Intronic
1023734083 7:43219579-43219601 ATGATCGATTGAGCAAGCAGTGG + Intronic
1024718996 7:52113543-52113565 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1025802882 7:64804339-64804361 GTGATCAATTGAGCAAGCAGGGG - Intronic
1027733134 7:81901451-81901473 ATGATCAATTGAGCAAGCAGGGG - Intergenic
1030626876 7:111854364-111854386 GTGATCGATTGAGCAGGCAGGGG - Intronic
1033326891 7:140387218-140387240 ATCAGCAATTTGGGAGGCCGAGG + Intronic
1034824575 7:154250105-154250127 GTGATCAATTGAGCAAGCAGGGG - Intronic
1035110979 7:156481408-156481430 ATCAACCATTGGCCAGGCTGCGG - Intergenic
1035343781 7:158184566-158184588 ATCTTCAATGTGACAGGCAGTGG + Intronic
1038715714 8:29988859-29988881 ATCATCAAATGAGAAGGCAATGG - Intergenic
1039120275 8:34138234-34138256 ATCTTTCTTTGGGCAGGCAGAGG - Intergenic
1039876533 8:41591115-41591137 GTGATCGATTGGGCAAGCAGGGG + Intronic
1039945256 8:42123311-42123333 ATGATCGATTGAGCAAGCAGTGG + Intergenic
1040916600 8:52571639-52571661 ATGATCGATTGAGCAAGCAGGGG + Intergenic
1040986156 8:53296396-53296418 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1041030505 8:53731547-53731569 ATGATCAATTGAGCAAGCATGGG - Intronic
1041113323 8:54508030-54508052 ATTATCAGTTGGCTAGGCAGTGG + Intergenic
1041352446 8:56961585-56961607 ATCATCACTTTGGGAGGCCGAGG + Exonic
1041448715 8:57983971-57983993 GTGATCAATTGAGCAAGCAGAGG - Intergenic
1041492828 8:58453476-58453498 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1042979394 8:74508424-74508446 ATGATCAATTGAGCAAGCAGGGG + Intergenic
1045166986 8:99617575-99617597 CTCAGCAATTTGGGAGGCAGAGG - Intronic
1047114390 8:121824221-121824243 ATCATCAATTTGGCCGGGTGCGG - Intergenic
1047617592 8:126575703-126575725 ATCAGCAATTTGGGAGGCCGAGG - Intergenic
1049634522 8:143680192-143680214 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1050123650 9:2334380-2334402 ATCATCCACTGGGCTGGCTGTGG + Intergenic
1051149224 9:14062351-14062373 AACATCAACTGGACCGGCAGAGG + Intergenic
1051242711 9:15076874-15076896 ACAATCAATTGGGGAAGCAGGGG + Intergenic
1055443776 9:76362822-76362844 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1056620126 9:88205630-88205652 CTGATCAATTGAGCAAGCAGGGG + Intergenic
1057706999 9:97401925-97401947 TTCATAAATGGGGCAGGGAGGGG + Intergenic
1058442752 9:105024925-105024947 ATCAGTGATTGGGGAGGCAGAGG + Intergenic
1060944855 9:127564040-127564062 CTCAGCAATTTGGCAGGCTGAGG + Intronic
1061783646 9:133010126-133010148 CTCACCAATGGGGCAGACAGGGG - Intergenic
1062132481 9:134906818-134906840 CTCAGCAATTTGGGAGGCAGAGG + Intronic
1185909138 X:3966118-3966140 GTGATCAATTGAGCAAGCAGAGG - Intergenic
1186028588 X:5341881-5341903 ACCATCAATTGGGCACGCGGAGG - Intergenic
1186558391 X:10584971-10584993 ATGATCAATTGAGCAAGCAGGGG + Intronic
1186681225 X:11876122-11876144 ATCCTCAAGTGGGGAGGCCGAGG - Intergenic
1187499440 X:19827229-19827251 ATCAACAATTGGGCAGGCAGAGG + Intronic
1187631932 X:21182852-21182874 TTCAGAAAGTGGGCAGGCAGTGG - Intergenic
1187915916 X:24151592-24151614 ATACTCAATGGGGTAGGCAGCGG + Intronic
1188598053 X:31925619-31925641 ATCAGCAATTTGGGAGGCCGAGG + Intronic
1189009337 X:37030700-37030722 GTGATCAATTGAGCAAGCAGAGG - Intergenic
1190269836 X:48853975-48853997 ATGATCAATTGAGCAAGCAGGGG - Intergenic
1190270760 X:48861599-48861621 ATGATCAATTGAGCAAGCAGGGG - Intergenic
1190426521 X:50338434-50338456 ATGATCGATTGAGCAAGCAGTGG + Intronic
1190476443 X:50832692-50832714 CCCATCAATTTGGGAGGCAGAGG - Intergenic
1190571333 X:51785298-51785320 ATCATAAATAGGGGAGGCAAAGG - Intergenic
1190770848 X:53512940-53512962 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1190771749 X:53520579-53520601 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1191638900 X:63409299-63409321 GTGATCAATTGAGCAAGCAGGGG - Intergenic
1194365458 X:93008318-93008340 GTGATCAATTGAGCAAGCAGTGG + Intergenic
1194384855 X:93239449-93239471 ATGATCGATTGAGCAAGCAGGGG - Intergenic
1195426303 X:104735681-104735703 ATGATTAAATTGGCAGGCAGTGG + Intronic
1196460460 X:115923955-115923977 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1197253049 X:124234719-124234741 AACAATAATTTGGCAGGCAGGGG - Intronic
1198469294 X:136931016-136931038 ATGATAAATTGGGCAAGCATGGG + Intergenic
1199338802 X:146651237-146651259 GTGATCAATTGAGCAAGCAGGGG + Intergenic
1200984182 Y:9288730-9288752 ATGATCAATTGAGCAAGCATCGG + Intergenic
1201260406 Y:12153533-12153555 ATGATCAATTGAGCAAGCAGAGG + Intergenic
1201559616 Y:15302142-15302164 ATGGACAATTTGGCAGGCAGGGG - Intergenic