ID: 1023200039

View in Genome Browser
Species Human (GRCh38)
Location 7:37687113-37687135
Sequence ACTGACATCATCAATTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023200039_1023200044 -4 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200044 7:37687132-37687154 CAGTCGGAGCACTGTTTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 88
1023200039_1023200046 17 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200046 7:37687153-37687175 GGAATTTCCCACAGCTACCCAGG No data
1023200039_1023200047 18 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200047 7:37687154-37687176 GAATTTCCCACAGCTACCCAGGG No data
1023200039_1023200049 23 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200049 7:37687159-37687181 TCCCACAGCTACCCAGGGCAGGG 0: 1
1: 0
2: 10
3: 47
4: 496
1023200039_1023200048 22 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200039_1023200051 24 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200051 7:37687160-37687182 CCCACAGCTACCCAGGGCAGGGG 0: 1
1: 2
2: 9
3: 67
4: 600
1023200039_1023200043 -5 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200043 7:37687131-37687153 TCAGTCGGAGCACTGTTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023200039 Original CRISPR ACTGACATCATCAATTGGGC AGG (reversed) Intronic
906639224 1:47431728-47431750 TCTTACATCAGCAAGTGGGCAGG - Intergenic
908311982 1:62893564-62893586 ACTGAAAACATCTATGGGGCAGG + Intergenic
908315180 1:62925469-62925491 ACGGACATCATCGAATGTGCAGG - Intergenic
909262200 1:73504824-73504846 ACTGACAACATGTAGTGGGCAGG + Intergenic
916335195 1:163663128-163663150 ACTGACAGCAGCTATTGGGTAGG - Intergenic
916440908 1:164823643-164823665 TCTGACATCATCTGGTGGGCTGG + Intronic
918658393 1:187057703-187057725 ACTGACAGCATCAAATTGGGTGG - Intergenic
921839928 1:219817485-219817507 ACTGAAATCAACATTTTGGCAGG - Intronic
922813289 1:228430394-228430416 AGTCACATCATCAATTGGGACGG + Intergenic
924489075 1:244517473-244517495 ATAAACATCATCAAATGGGCTGG + Intronic
1084373099 11:68757669-68757691 ACTGACATCATCACTTTGTTTGG - Exonic
1085641964 11:78198266-78198288 CCTGACAGCATCACTAGGGCAGG - Intronic
1086174861 11:83878931-83878953 AATGACAGCATCATTTGGACAGG - Intronic
1087673344 11:101130524-101130546 ACTGACTTCATGAATTTAGCGGG - Exonic
1088191251 11:107230836-107230858 ACTGACAGCATTAATTGGCCAGG + Intergenic
1088932675 11:114367786-114367808 ACTGATATCATCAATGATGCTGG - Intergenic
1089548683 11:119252495-119252517 ATTGACATCAACCATTGTGCAGG + Intronic
1091394891 12:148065-148087 ACTGAGAACATCTACTGGGCAGG - Intronic
1098357523 12:69625758-69625780 ACTGACAACATCAAGCGCGCTGG - Intergenic
1099693784 12:85993519-85993541 ACTGCCTTCATCAGTGGGGCTGG + Intronic
1102439522 12:112950576-112950598 CCTGACATCAGCAAGAGGGCAGG + Intronic
1108811374 13:54227782-54227804 ACTGTCCTCATCAATTGAGTTGG + Intergenic
1116233515 14:42248329-42248351 ATTGAGATAATCAATTGGTCAGG + Intergenic
1118648059 14:67859094-67859116 ACTGACATCCTCACTTGGTCTGG + Intronic
1118712492 14:68533630-68533652 ACTGAGATCATCAGTTGAGAGGG + Intronic
1128100965 15:64999549-64999571 ACTGATTTCATCAATTGTGAAGG + Intergenic
1128214591 15:65925516-65925538 ACTGATATGATCAAAGGGGCTGG + Intronic
1129955274 15:79630678-79630700 ACTGACATGATCAATCAGGTTGG + Intergenic
1133211174 16:4264131-4264153 ACTGCCTTCATCAATGGAGCAGG - Intronic
1133740038 16:8644507-8644529 ACTGCCATCATCAATGGGAAGGG - Intronic
1136104714 16:28021705-28021727 ACTGACCTCATCACTTTGGTGGG + Intronic
1140117359 16:72054353-72054375 CCTGAAATCAGCAACTGGGCAGG - Intronic
1153411084 18:4793786-4793808 ACTGACCACAGCAATTAGGCAGG + Intergenic
1154473000 18:14722913-14722935 ACAGTCAACAACAATTGGGCAGG - Intergenic
1155583765 18:27341687-27341709 ACTGTCATCATCCATTTGTCAGG + Intergenic
1159799221 18:72876490-72876512 ACTGGCATATTCCATTGGGCAGG - Intergenic
1162433695 19:10644212-10644234 CCTGACATCATCCCTTGGGTGGG - Exonic
1163820880 19:19495995-19496017 ACTGAGATCAACAATGGAGCGGG - Intronic
925743379 2:7025043-7025065 ACTCACATCATCTACAGGGCGGG + Intronic
926070791 2:9888621-9888643 ATTGACATCAGAAATTAGGCAGG - Intronic
928717525 2:34078989-34079011 ACTGATATAAGCAATTGGGTAGG - Intergenic
938344142 2:130554995-130555017 ATTGAAATCATCAATTGGTCAGG - Intergenic
938345691 2:130565727-130565749 ATTGAAATCATCAATTGGTCAGG + Intergenic
939025428 2:137007859-137007881 AATGACAACATCAATTGACCTGG - Intronic
939547955 2:143576908-143576930 GCTAAAATCATTAATTGGGCTGG - Intronic
941549093 2:166891927-166891949 AGTGACAACATAAATTTGGCAGG + Intronic
942397639 2:175568471-175568493 ACTGACAGCATAAATTGGATGGG - Intergenic
945587952 2:211690582-211690604 ACTTCCATCATCTATTGGTCTGG - Intronic
1170955601 20:20976829-20976851 TCTGACATTATCAAATGGTCAGG - Intergenic
1177683388 21:24404639-24404661 ACTGACTTTAACACTTGGGCAGG + Intergenic
950871052 3:16229347-16229369 ACTCAATTCCTCAATTGGGCTGG + Exonic
954409953 3:50366155-50366177 CCTGACATCCTCAGGTGGGCAGG - Exonic
955465497 3:59232862-59232884 ACTGCCAACATGAATTGGGAGGG - Intergenic
956486860 3:69732074-69732096 ACTTAAAACCTCAATTGGGCCGG - Intergenic
957015147 3:75054689-75054711 ACTGACATCATCCAATGCACGGG + Intergenic
959056987 3:101576778-101576800 ACTGACCTCACCAAGAGGGCGGG - Intronic
963604275 3:147400806-147400828 ACAGAGATTATCAATTGGGCTGG + Intronic
970675495 4:18444315-18444337 ACTCACATGAACACTTGGGCAGG - Intergenic
973759030 4:54100456-54100478 ACGGACATCACCAATGGGGGCGG - Exonic
981401870 4:144322489-144322511 ACTGGCAACAACAATTTGGCTGG - Intergenic
981680850 4:147396271-147396293 ACTGACAACACCAGGTGGGCTGG - Intergenic
984067896 4:175072414-175072436 ACTGAAATCATTATCTGGGCAGG - Intergenic
986205548 5:5621723-5621745 ACTGACATCAGCACTTGGATGGG - Intergenic
986543084 5:8867942-8867964 ACTGACATCTTCATTTGCTCTGG - Intergenic
998221366 5:140283532-140283554 ACTAAGATCATCAGTTGGGCTGG - Intronic
1001339342 5:170829144-170829166 AAAGACATCAGCAATTGGGCTGG - Intergenic
1002371775 5:178760620-178760642 AAAAACATCAACAATTGGGCTGG + Intergenic
1004494748 6:16153009-16153031 ACTGACCTTATCAGTAGGGCTGG - Intergenic
1006790796 6:36699698-36699720 ACTGACATCATGGCTGGGGCAGG + Intronic
1013491552 6:110651310-110651332 TCTGCCATCAGAAATTGGGCAGG - Intronic
1013699953 6:112754362-112754384 ACTTACATCATGAATTGAGAAGG - Intergenic
1015031762 6:128603845-128603867 ACTAACATCATCCTCTGGGCAGG + Intergenic
1016164423 6:140922742-140922764 ATTGACATCACCAAGAGGGCAGG - Intergenic
1016393661 6:143599955-143599977 ACTGACATGATCATTTGGCCAGG - Intronic
1016952542 6:149594232-149594254 ACTGACCTCACCAAGAGGGCGGG + Intergenic
1018799525 6:167211142-167211164 ACTGACATCATCTGTTTGTCTGG - Intergenic
1023200039 7:37687113-37687135 ACTGACATCATCAATTGGGCAGG - Intronic
1023346572 7:39277609-39277631 TTTGTCATCATCAATTGAGCGGG + Intronic
1028170066 7:87585607-87585629 GCTGCCATCATCCATGGGGCTGG - Exonic
1029110703 7:98211840-98211862 ACTGACTTCATCCCGTGGGCGGG - Intronic
1041224202 8:55682693-55682715 ACTTACACCATCAATTCTGCCGG - Intergenic
1043937552 8:86159053-86159075 ATTGACATGATTGATTGGGCAGG - Intergenic
1045504003 8:102765832-102765854 ACTGAGAACATAAATTTGGCTGG + Intergenic
1051501705 9:17785193-17785215 ACTGTCCTCATCAGTTGGGGAGG - Intronic
1052228388 9:26117456-26117478 ACTGAAATCTTCTATTAGGCTGG - Intergenic
1056428614 9:86504400-86504422 ACTGGCATCTTCACTTTGGCTGG + Intergenic
1058337405 9:103848342-103848364 ACTGACATCATTAGTTGTGGTGG + Intergenic
1186798434 X:13068681-13068703 CCTGACATCTTGAATTGGGTTGG + Intergenic
1191661605 X:63657356-63657378 ACTGAGATTTTCAGTTGGGCTGG + Intronic
1192434900 X:71137079-71137101 AATGGCATCATCCTTTGGGCAGG - Intronic