ID: 1023200041

View in Genome Browser
Species Human (GRCh38)
Location 7:37687117-37687139
Sequence TCCGACTGACATCATCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023200041_1023200048 18 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200041_1023200051 20 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200051 7:37687160-37687182 CCCACAGCTACCCAGGGCAGGGG 0: 1
1: 2
2: 9
3: 67
4: 600
1023200041_1023200047 14 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200047 7:37687154-37687176 GAATTTCCCACAGCTACCCAGGG No data
1023200041_1023200049 19 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200049 7:37687159-37687181 TCCCACAGCTACCCAGGGCAGGG 0: 1
1: 0
2: 10
3: 47
4: 496
1023200041_1023200044 -8 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200044 7:37687132-37687154 CAGTCGGAGCACTGTTTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 88
1023200041_1023200043 -9 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200043 7:37687131-37687153 TCAGTCGGAGCACTGTTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 72
1023200041_1023200046 13 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200046 7:37687153-37687175 GGAATTTCCCACAGCTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023200041 Original CRISPR TCCGACTGACATCATCAATT GGG (reversed) Intronic
903359989 1:22771066-22771088 TCCTGCTGACATCATCATTCTGG - Intronic
904319505 1:29687417-29687439 TCCTACTGACAACAGCAATAAGG - Intergenic
915265781 1:154716441-154716463 TCAGACTGACATCAACAGATGGG + Intronic
918225420 1:182477012-182477034 TCAGAGTGACATCAGCAATATGG + Intronic
1070390013 10:75961832-75961854 CCCGACTGACATCTTGAATTCGG - Intronic
1074649796 10:115507634-115507656 TCCGAATTACCTCATCAATTAGG - Intronic
1082895029 11:58180920-58180942 TCAGAATTATATCATCAATTAGG + Exonic
1086810850 11:91308419-91308441 TCCAACTAACATCATCAGTATGG - Intergenic
1089714313 11:120342195-120342217 TCCAACTGACTTCATCAAGCTGG - Intronic
1106831010 13:33583372-33583394 TCTGACTGACATACTCATTTAGG + Intergenic
1110659238 13:78039437-78039459 TCACCCTGACTTCATCAATTTGG - Intergenic
1120555186 14:85920855-85920877 TCCCAAAGACAACATCAATTTGG + Intergenic
1122091897 14:99346437-99346459 TCCGATTGACACCTTCCATTTGG - Intergenic
1123487493 15:20755272-20755294 TACGACTGACATCATCTTATGGG + Intergenic
1123543985 15:21324330-21324352 TACGACTGACATCATCTTATGGG + Intergenic
1202952327 15_KI270727v1_random:51608-51630 TACGACTGACATCATCTTATGGG + Intergenic
1139121429 16:64023305-64023327 TCCTACTGAGATCATCAAATAGG - Intergenic
1144136158 17:12297078-12297100 TCCGAGAGAGATCCTCAATTAGG + Intergenic
1146109700 17:30077467-30077489 TCCCACTGATATCCTGAATTTGG - Intronic
1162433701 19:10644216-10644238 TCCCCCTGACATCATCCCTTGGG - Exonic
1162773253 19:12963131-12963153 TCAGCCTGACATCTGCAATTGGG - Intergenic
1167753879 19:51398427-51398449 TCTGACGGAGATCATTAATTTGG + Intergenic
925775262 2:7329081-7329103 TCCAAATGAGATCATGAATTCGG + Intergenic
936839366 2:116751533-116751555 TCGGACAGACAGCATCTATTAGG + Intergenic
942537542 2:176981234-176981256 TCCCACTGAAATCAACAACTAGG - Intergenic
1170380282 20:15752020-15752042 TCGGACTGACATCTTTAACTTGG + Intronic
1174527558 20:51185801-51185823 TACTACTGACACCACCAATTAGG + Intergenic
1178870208 21:36367284-36367306 TCAAACTGCCATCATCATTTAGG - Intronic
1179972130 21:44842067-44842089 TCCCACTGAAATCCTCAATTTGG - Intergenic
1181798812 22:25330393-25330415 TTTTACTGTCATCATCAATTAGG - Intergenic
952822168 3:37494800-37494822 TCCTACAGAAATCATCAAATAGG - Intronic
960460091 3:117923159-117923181 TCCCATTGACATCAACAATTTGG - Intergenic
965259561 3:166463830-166463852 TCCCTCTAACATCAGCAATTTGG - Intergenic
965882338 3:173400758-173400780 TCCGAATGACATGATAAATCAGG - Intronic
974895564 4:67933947-67933969 TCTGGATGACATCATCAATCTGG + Intronic
977941223 4:102861368-102861390 CCTGACTGACATCAGCAAGTTGG - Intronic
983138564 4:164118574-164118596 TCTGACTGATATCATATATTTGG - Intronic
984849157 4:184138784-184138806 TCCAACTGTCAACATCACTTCGG - Intronic
986284605 5:6350043-6350065 CCAGACTGACATCATTAATCTGG + Intergenic
989728671 5:44620550-44620572 TACAACTGACATCATGTATTTGG + Intergenic
991538092 5:67695506-67695528 TCCCACTGACATCTTGATTTTGG - Intergenic
992034036 5:72753403-72753425 TCCAACTGCCAGCATCAACTTGG + Intergenic
993663761 5:90670057-90670079 TGAGATTGACATCATAAATTTGG - Intronic
997571726 5:134933673-134933695 TCCAACTGACAGCATTAATACGG - Intronic
999429594 5:151514727-151514749 TCCTACTGAAATCATCAGATGGG + Intronic
1000010133 5:157223290-157223312 TTCCACTGACATCTACAATTTGG + Intronic
1001271187 5:170312881-170312903 TCCCTGTGACATCATCACTTTGG + Intergenic
1008159636 6:48061474-48061496 TCCAAATCACATCATGAATTAGG + Intronic
1009351024 6:62678703-62678725 TTGGAGTGACATCATCAATTTGG - Intergenic
1011718540 6:90131783-90131805 GCCCACTGACCTCATCATTTGGG - Intronic
1023200041 7:37687117-37687139 TCCGACTGACATCATCAATTGGG - Intronic
1027132230 7:75599229-75599251 TCAGACTGTCAGCATCAATAAGG - Exonic
1032787137 7:135210034-135210056 TCTGACTTACTTGATCAATTTGG + Intronic
1047365404 8:124206612-124206634 TCCAACCTACTTCATCAATTGGG - Intergenic
1052228389 9:26117460-26117482 TCTGACTGAAATCTTCTATTAGG - Intergenic
1187352668 X:18535413-18535435 CCACACTGACATCATCAATTTGG - Intronic
1190904693 X:54715290-54715312 TCCCACAGACATCTTTAATTTGG - Intergenic
1194918534 X:99734595-99734617 TGCTACTGATATCAACAATTTGG + Intergenic
1195275743 X:103278379-103278401 GCCCACAGACTTCATCAATTGGG - Intergenic
1197878108 X:131133125-131133147 TCCTACTGACATCTTGATTTTGG + Intergenic