ID: 1023200042

View in Genome Browser
Species Human (GRCh38)
Location 7:37687118-37687140
Sequence CTCCGACTGACATCATCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023200042_1023200047 13 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200047 7:37687154-37687176 GAATTTCCCACAGCTACCCAGGG No data
1023200042_1023200044 -9 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200044 7:37687132-37687154 CAGTCGGAGCACTGTTTCCTGGG 0: 1
1: 0
2: 1
3: 9
4: 88
1023200042_1023200049 18 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200049 7:37687159-37687181 TCCCACAGCTACCCAGGGCAGGG 0: 1
1: 0
2: 10
3: 47
4: 496
1023200042_1023200051 19 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200051 7:37687160-37687182 CCCACAGCTACCCAGGGCAGGGG 0: 1
1: 2
2: 9
3: 67
4: 600
1023200042_1023200046 12 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200046 7:37687153-37687175 GGAATTTCCCACAGCTACCCAGG No data
1023200042_1023200048 17 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200042_1023200043 -10 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200043 7:37687131-37687153 TCAGTCGGAGCACTGTTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023200042 Original CRISPR CTCCGACTGACATCATCAAT TGG (reversed) Intronic
909141708 1:71875448-71875470 CTGCTACTGACAACATGAATCGG - Intronic
919727978 1:200896009-200896031 CTCTGACTGCCAGCATCAAAGGG - Intronic
920664430 1:207951083-207951105 CTCCCACTGACATGATCCAAAGG - Intergenic
923959714 1:239064235-239064257 TTCCCACTGACCTCACCAATGGG - Intergenic
1069025542 10:63536889-63536911 CTCCTACTGGCATCATGAAAAGG - Intronic
1075862554 10:125689505-125689527 CTCCTACTGACATTGTCAGTTGG - Intergenic
1087634302 11:100686383-100686405 CTCGTCCTGACATCATCTATAGG - Intergenic
1090146291 11:124326604-124326626 TTCCAACTGATATCATCAACTGG + Intergenic
1093411039 12:18867432-18867454 CTCCAGCTGACATGATCAACTGG + Intergenic
1093586835 12:20847667-20847689 CTCAGACTGAAATTTTCAATTGG - Intronic
1104583342 12:130027293-130027315 CTTCAAGTGACTTCATCAATGGG + Intergenic
1109780244 13:67101119-67101141 CTGCCACTGCCATCAGCAATGGG + Intronic
1112450125 13:99500680-99500702 CACCGTCTCACATCATCAGTGGG + Intergenic
1112972419 13:105276804-105276826 CTTCAACTTACACCATCAATTGG - Intergenic
1114857866 14:26472777-26472799 CTCCGACTGTATTCATCGATAGG - Intronic
1121212234 14:92215946-92215968 TTCCCACTGACACCATCAACTGG - Intergenic
1133694626 16:8250161-8250183 CTACGCCTGTCATCAGCAATTGG + Intergenic
1133740040 16:8644512-8644534 CACAAACTGCCATCATCAATGGG - Intronic
1150607744 17:66708622-66708644 CTCCAACTGCCATCTGCAATAGG - Intronic
1157678365 18:49584191-49584213 CTCCCACAGACCTCATCCATGGG - Intronic
1157876272 18:51276533-51276555 CTCTCACTGACTTCATCAAAGGG + Intergenic
1159790959 18:72778234-72778256 CTTCCACTGACTTCAGCAATAGG + Intronic
1162433702 19:10644217-10644239 CTCCCCCTGACATCATCCCTTGG - Exonic
936226337 2:110656956-110656978 CTCTGACTGGCATAATCATTTGG + Intronic
945385189 2:209189973-209189995 TTCCAACTGACATCATCATTTGG + Intergenic
1168901787 20:1371054-1371076 CTCTGACTGCCATCACAAATAGG + Intronic
1171056066 20:21908309-21908331 CTCCCACTGACACCAGGAATCGG + Intergenic
966008792 3:175050650-175050672 CCTCAACTAACATCATCAATAGG - Intronic
967595485 3:191323046-191323068 CTAAGACTGACATCTTCATTTGG - Intronic
972642254 4:40935667-40935689 CACAGACTGACATCAACACTTGG + Intronic
974694041 4:65341152-65341174 CTATGACTGACATAATCCATAGG - Intronic
980036647 4:127891637-127891659 CACCTACTGACAACATCAGTAGG + Exonic
985829179 5:2215392-2215414 CTCCTCCTGGCCTCATCAATGGG + Intergenic
1000592749 5:163178146-163178168 CTCAGACTTACAACCTCAATAGG + Intergenic
1007249687 6:40487366-40487388 CTCTCACTGACATCACCACTGGG + Intronic
1014645999 6:123973515-123973537 CTTCAACTGAAATCATCCATTGG - Intronic
1023200042 7:37687118-37687140 CTCCGACTGACATCATCAATTGG - Intronic
1026135101 7:67653175-67653197 CCCCTTCTGACATCATAAATAGG - Intergenic
1032889182 7:136175939-136175961 CTGCTACTCACATCATCTATTGG + Intergenic
1039254064 8:35699580-35699602 CTCTAACCGACATCACCAATTGG + Intronic
1043572168 8:81617386-81617408 GTACCAGTGACATCATCAATGGG + Intergenic
1045120714 8:99031088-99031110 CTTCACCTGACATCATCAGTGGG - Intronic
1051593451 9:18799597-18799619 GCCTGCCTGACATCATCAATGGG + Intronic
1052223114 9:26051785-26051807 CTTAGACTGACTTCATCATTTGG - Intergenic
1055022999 9:71690125-71690147 ATGCGACTGACATCAGCAAGAGG + Exonic
1057017525 9:91665772-91665794 ATCAGACAGACACCATCAATGGG - Intronic
1188071051 X:25718831-25718853 CTCCCAGTGACTTCATCATTAGG - Intergenic
1197772383 X:130097722-130097744 CTCCAAAGGACATGATCAATGGG - Intronic