ID: 1023200048

View in Genome Browser
Species Human (GRCh38)
Location 7:37687158-37687180
Sequence TTCCCACAGCTACCCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023200038_1023200048 28 Left 1023200038 7:37687107-37687129 CCACTGCCTGCCCAATTGATGAT 0: 1
1: 1
2: 2
3: 43
4: 311
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200042_1023200048 17 Left 1023200042 7:37687118-37687140 CCAATTGATGATGTCAGTCGGAG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200039_1023200048 22 Left 1023200039 7:37687113-37687135 CCTGCCCAATTGATGATGTCAGT 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data
1023200041_1023200048 18 Left 1023200041 7:37687117-37687139 CCCAATTGATGATGTCAGTCGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1023200048 7:37687158-37687180 TTCCCACAGCTACCCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023200048 Original CRISPR TTCCCACAGCTACCCAGGGC AGG Intronic
No off target data available for this crispr