ID: 1023213971

View in Genome Browser
Species Human (GRCh38)
Location 7:37841019-37841041
Sequence ACACTCTCCCACCCCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023213962_1023213971 28 Left 1023213962 7:37840968-37840990 CCCATTAACTCGTCATTTACATT 0: 3240
1: 4686
2: 3070
3: 8538
4: 9290
Right 1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG No data
1023213965_1023213971 -5 Left 1023213965 7:37841001-37841023 CCTAATGCTATCCCTCCCACACT 0: 1
1: 44
2: 533
3: 4123
4: 17225
Right 1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG No data
1023213963_1023213971 27 Left 1023213963 7:37840969-37840991 CCATTAACTCGTCATTTACATTA 0: 3401
1: 4646
2: 2884
3: 2471
4: 9875
Right 1023213971 7:37841019-37841041 ACACTCTCCCACCCCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023213971 Original CRISPR ACACTCTCCCACCCCAGGAC AGG Intronic
No off target data available for this crispr