ID: 1023215116

View in Genome Browser
Species Human (GRCh38)
Location 7:37854020-37854042
Sequence CCCTTACCAATGCTGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023215113_1023215116 3 Left 1023215113 7:37853994-37854016 CCTGAATTACTTCTAAATAGAGT 0: 1
1: 0
2: 0
3: 9
4: 228
Right 1023215116 7:37854020-37854042 CCCTTACCAATGCTGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023215116 Original CRISPR CCCTTACCAATGCTGGAGTT AGG Intronic
No off target data available for this crispr