ID: 1023215604

View in Genome Browser
Species Human (GRCh38)
Location 7:37859307-37859329
Sequence AAGAATAAGCATTAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 8, 3: 65, 4: 498}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023215604 Original CRISPR AAGAATAAGCATTAGAAGGA TGG (reversed) Intronic
902088744 1:13884935-13884957 AAGAAAAAGAAGAAGAAGGAAGG - Intergenic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
904130027 1:28268672-28268694 AAAAAGAAGCAAAAGAAGGAAGG + Intronic
904273474 1:29365359-29365381 AAGAAAAAGAAAAAGAAGGAAGG - Intergenic
904945446 1:34195819-34195841 CACAATAAGCATTACCAGGAAGG + Intronic
905391599 1:37639295-37639317 AAGAATCTGAATTAGAAGGAAGG - Intergenic
906176283 1:43775986-43776008 AAGAAAAAGGAATAGAAGGCAGG - Intronic
906462337 1:46044480-46044502 AAGAATAATAAAAAGAAGGAAGG - Intronic
906516994 1:46445473-46445495 AAGAAAATGCTTTAGAAGCAGGG - Intergenic
906733150 1:48100498-48100520 ATGAATAAGGATTAGAAGTGAGG + Intergenic
906977419 1:50590605-50590627 AAGAAAAAGAAATAAAAGGAAGG - Intronic
907020791 1:51065243-51065265 AAGTGTTAGCATTAGAAGGCTGG - Intergenic
907229311 1:52980816-52980838 AAGAATAAGCATAAGAAAGATGG - Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
907611638 1:55877029-55877051 AAGAATAAACATGTGTAGGAAGG - Intergenic
907764901 1:57399503-57399525 AAGTATATGCTTTAGAAGGTAGG + Intronic
907812544 1:57885947-57885969 AAGAATAAGATTAAGCAGGAGGG - Intronic
908443189 1:64175951-64175973 AAAAATAAGGATTTGAAGGATGG + Intronic
909267871 1:73584932-73584954 AAAAACAAGCATTAGAGGGTTGG - Intergenic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
911074840 1:93863098-93863120 AAGAATATGCATTTTGAGGATGG - Intergenic
912033366 1:105278226-105278248 AAGAATAATCATTAGAGAAAAGG - Intergenic
912248597 1:107987898-107987920 AATATTAACCATTACAAGGAGGG + Intergenic
912769344 1:112448777-112448799 AAGAAACAGCATTAGAAAGGTGG - Intronic
913192260 1:116423126-116423148 AAGAACAAGCATGACAGGGAAGG + Intergenic
913742782 1:121867113-121867135 AAGAATAGCCGTTTGAAGGAAGG + Intergenic
914439376 1:147690533-147690555 CAGAATCAGCTTTAGAAAGATGG - Intergenic
914682639 1:149950016-149950038 TAGGCTAAGCATTGGAAGGAAGG - Intronic
915983579 1:160440313-160440335 AAGAAAAAGCAAGAGAAGGAAGG - Intergenic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916569165 1:166009747-166009769 AAGAATCAGCTTTAGGGGGAAGG - Intergenic
917642950 1:177000756-177000778 AAGAATCTGCATTACAATGATGG + Intronic
919577186 1:199325098-199325120 AAGCAAAAGCATTACAAAGAAGG + Intergenic
919645074 1:200087268-200087290 GAGAATAAGCTTTAAGAGGAAGG - Intronic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
920237979 1:204522020-204522042 AAGGATAAGAATTAGAGGGCAGG + Intronic
921093899 1:211870338-211870360 AACAATAAAGATCAGAAGGAAGG + Intergenic
921390811 1:214611660-214611682 TACAATAAGAATTAGAAGGCTGG - Intronic
922204411 1:223433998-223434020 AAGAATGACCGTTTGAAGGAAGG + Intergenic
922233070 1:223702882-223702904 AAGAAAAACCAGGAGAAGGAGGG + Intronic
923538813 1:234873540-234873562 AGGAAGAAGAATTAGAATGAAGG - Intergenic
923600134 1:235395525-235395547 AAGAAGAAGAAGTAGAATGATGG - Intronic
924045340 1:240024001-240024023 AAAATTAAGAATGAGAAGGATGG + Intronic
924398738 1:243653856-243653878 AACAGTAAGCATAAGAAGAATGG - Intronic
1063579311 10:7291435-7291457 AAGAAAACGTTTTAGAAGGAAGG - Intronic
1064914622 10:20442356-20442378 AAGAATAAAAATTAAAAGCAGGG - Intergenic
1065203974 10:23340958-23340980 ATTAATAAGCATTTGTAGGATGG - Intronic
1065615369 10:27516123-27516145 AAGAATAAGCATTAAAAATAAGG - Intronic
1066798384 10:39152993-39153015 AAGAGTAAAAACTAGAAGGAAGG + Intergenic
1067787387 10:49260480-49260502 AGGAACTAGAATTAGAAGGAAGG - Intergenic
1068519896 10:58066551-58066573 AACAATAAGTCTTAGGAGGAGGG - Intergenic
1068878080 10:62018931-62018953 AAGAATACACATTAGAAAGATGG - Intronic
1068929898 10:62578861-62578883 AAGAATATGCAGGAGCAGGATGG + Intronic
1069124385 10:64611340-64611362 AAGAATAAGCATGAGAGGGATGG + Intergenic
1072785607 10:98278300-98278322 AAGTATAAAGATGAGAAGGAAGG + Intergenic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073375525 10:103030862-103030884 TAGTATAAGGATTAGAAGCAGGG + Intronic
1073723673 10:106204703-106204725 AATAATAAGGGTGAGAAGGATGG + Intergenic
1074278327 10:112025814-112025836 AAGAATAAGCAAGAAAGGGATGG - Intergenic
1074715817 10:116217631-116217653 AATAATAAGCAATAGAAACAGGG + Intronic
1074758800 10:116648495-116648517 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
1075234814 10:120717753-120717775 AACACTAAGCATTAGAAAGCTGG + Intergenic
1075391185 10:122093428-122093450 AAGAATAAGCTTTTAGAGGATGG + Intronic
1075576266 10:123579937-123579959 AAGATTAAACATGAGAAGCAGGG - Intergenic
1076467275 10:130691918-130691940 GATAATCAGCATTAGAGGGAAGG - Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078634899 11:13040300-13040322 AAGAAAAAGAATGAGAGGGATGG - Intergenic
1078936963 11:15960600-15960622 GAGAACAAGCATTACAAGAAAGG - Intergenic
1079567320 11:21898952-21898974 AAGAATATGCATTTTAAAGAAGG - Intergenic
1080624973 11:34020684-34020706 AAGCATAAGTCTTAAAAGGATGG + Intergenic
1081681136 11:45004157-45004179 AACATTAAGCATTAGAAAGCTGG - Intergenic
1082233048 11:49792567-49792589 AATAATAATCATAAGATGGAGGG - Intergenic
1082301983 11:50517660-50517682 CAGGATAAAAATTAGAAGGAAGG - Intergenic
1082574190 11:54782604-54782626 CAGAATAAAAACTAGAAGGAAGG + Intergenic
1082595114 11:55068904-55068926 AGGAATAAAAACTAGAAGGAAGG - Intergenic
1082892379 11:58153873-58153895 AAGAATTAGGATTTGAGGGAAGG + Intronic
1084450928 11:69237258-69237280 AACGATAAGCATAAGAAGGTTGG + Intergenic
1085578119 11:77625587-77625609 AAGAAAAAGCAATAGAATGGAGG + Intronic
1086005781 11:82033662-82033684 AAAAATATTCAGTAGAAGGATGG - Intergenic
1086737935 11:90329940-90329962 AAGAAGAAGGAGGAGAAGGAGGG - Intergenic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1086987003 11:93261614-93261636 AAGAAGCAGGATTATAAGGAGGG - Intergenic
1087186111 11:95197660-95197682 AAGAATAATATTTATAAGGAAGG - Intronic
1087288673 11:96296342-96296364 AAGAATAAAAATAAGAAGGGAGG + Intronic
1087802590 11:102519919-102519941 AAAAAAAAGGATTTGAAGGATGG + Intergenic
1088559104 11:111094805-111094827 AAGAATAAGAATCAGAATGATGG - Intergenic
1089037368 11:115408641-115408663 ATGAATAAGTACTAGGAGGAGGG - Intronic
1089657673 11:119963395-119963417 AAGAATAGGCATTTGAAGTAGGG - Intergenic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1090462721 11:126906329-126906351 AAAAATAAGCATTAAAAGGTAGG + Intronic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092513134 12:9179195-9179217 AAGAATAATTATCAGAAGGAAGG - Intronic
1093060669 12:14599482-14599504 AACAATAAATATTTGAAGGAAGG + Intergenic
1093441579 12:19203609-19203631 GAGAGAAAGCATTTGAAGGAAGG - Intronic
1093833688 12:23799312-23799334 ATTAATGGGCATTAGAAGGAAGG - Intronic
1094863814 12:34503932-34503954 AAGATTAAAAACTAGAAGGAAGG - Intergenic
1095365459 12:41399330-41399352 AAGAATAAGCAATAGAATATAGG - Intronic
1095444534 12:42270885-42270907 AAGAATAAGCATTTCAGGGTTGG - Intronic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1096217693 12:49807496-49807518 AACAATAAGCATTAGAGGCCAGG - Intronic
1096765832 12:53888506-53888528 AAATATAAGCATCAGGAGGATGG - Intergenic
1097370704 12:58776542-58776564 GTAAATAAACATTAGAAGGAAGG + Intronic
1097566254 12:61272550-61272572 AAGAGGAAGCATCAGAAGTAAGG - Intergenic
1098331481 12:69358440-69358462 AAGAATTACATTTAGAAGGATGG - Intergenic
1098549711 12:71749830-71749852 ATGAATAAGAATCACAAGGAGGG + Intergenic
1098579103 12:72077853-72077875 CAGAATGAGCACTAGCAGGAAGG - Intronic
1098799369 12:74934535-74934557 AAGAATGAACACAAGAAGGAAGG + Intergenic
1099538948 12:83881312-83881334 AAGCATAAGCAATACAAAGAAGG - Intergenic
1100433790 12:94553299-94553321 AATAATAAGCATTCCAAGGCCGG - Intergenic
1100719023 12:97337270-97337292 AAGCAGCAGAATTAGAAGGAGGG - Intergenic
1100917269 12:99438592-99438614 AAGAATTAGCAGTAGATAGATGG - Intronic
1101385034 12:104249317-104249339 AAGTGACAGCATTAGAAGGAGGG - Intronic
1101741930 12:107507464-107507486 CAGAATAACCATCAGAGGGAGGG - Intronic
1101752389 12:107592988-107593010 ATGAATATGCATTATAAAGAAGG + Intronic
1102277619 12:111595753-111595775 AAAAATAAGAATTAGACTGATGG + Intronic
1102806348 12:115784087-115784109 GAAATCAAGCATTAGAAGGATGG - Intergenic
1103070209 12:117935122-117935144 AAGAAGAAGAATAAGAAGGCAGG - Intronic
1104864891 12:131947457-131947479 ATAAATGAGCATTAGAAGGCTGG - Intergenic
1106257392 13:28033784-28033806 AACAGTAACCATTAAAAGGATGG + Intronic
1106826266 13:33524323-33524345 AAGAAAAATCATCAGAAGAAAGG - Intergenic
1107406154 13:40115767-40115789 AAGAATAAACACGAGAAGGGTGG - Intergenic
1107628699 13:42319470-42319492 AAGAACATGTATTTGAAGGAAGG + Exonic
1107679342 13:42832172-42832194 AAGACTCAGCTTTAGAATGATGG - Intergenic
1108144531 13:47463165-47463187 CAGAAAAGGCATAAGAAGGATGG + Intergenic
1108888552 13:55223516-55223538 TATAATAAGCTTTAAAAGGAAGG - Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110302569 13:73946203-73946225 AAGAAGATGCCTTATAAGGAAGG + Intronic
1110542794 13:76724750-76724772 AAGAAGGAGAAATAGAAGGAAGG + Intergenic
1110744428 13:79036360-79036382 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1110752788 13:79135494-79135516 AAGAGTTAACATCAGAAGGAAGG + Intergenic
1111525516 13:89463222-89463244 AAGTATAACCATTGGAAGGGAGG + Intergenic
1111857256 13:93654121-93654143 ATCATTCAGCATTAGAAGGAGGG - Intronic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112487373 13:99832374-99832396 AAGAAAAAGAAGTAGAGGGAAGG - Intronic
1112643175 13:101300331-101300353 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1113173207 13:107529999-107530021 AAGAGTAAGAATAAGAAGCAAGG + Intronic
1113415300 13:110124206-110124228 TAGAATAAGACTTAAAAGGATGG + Intergenic
1114986257 14:28232252-28232274 AGGAATAGTCATTAGAAGCATGG - Intergenic
1115467110 14:33727623-33727645 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1116218056 14:42045678-42045700 AAGAATAAGCAGCAGGAGCATGG - Intergenic
1116376797 14:44212528-44212550 AGGACTAAACAGTAGAAGGATGG + Intergenic
1116698446 14:48204954-48204976 AAGAGTAAGCTTTAGAATGACGG + Intergenic
1117302317 14:54441559-54441581 AAGAATAAACGCAAGAAGGAAGG - Intergenic
1117671330 14:58109575-58109597 AAGAAAAAGAAATTGAAGGAAGG - Intronic
1118187438 14:63550259-63550281 AAGAATATATATTAGAATGAAGG - Intergenic
1118269098 14:64325357-64325379 ATGAATTTGCATTAGAAAGAAGG + Intronic
1119904306 14:78287470-78287492 TAGAATCAGCATTTCAAGGAAGG + Intronic
1120079281 14:80197414-80197436 AGGAATAAATATTAGAATGATGG + Intergenic
1120242976 14:81971611-81971633 AAGAAGAAGAAAAAGAAGGAAGG - Intergenic
1120284325 14:82478643-82478665 AAGATTAAGCGTTTCAAGGAAGG + Intergenic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120634371 14:86932919-86932941 TAGTAGAATCATTAGAAGGAAGG + Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1121197564 14:92087681-92087703 GAAAATAAGCAGTAGAAGAAAGG + Intronic
1122516478 14:102312440-102312462 AATAATAAGCAGTAGAAGACAGG - Intergenic
1122570170 14:102692748-102692770 AAGAAAAAGAAAAAGAAGGAAGG - Intronic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1124116994 15:26853637-26853659 AAGAAAGAGCATCAGAAGGCTGG - Intronic
1124411667 15:29442436-29442458 AAGAATAAAAATTAGAATCAGGG - Intronic
1124781702 15:32642255-32642277 TAGAAGAATGATTAGAAGGAGGG + Intronic
1125025152 15:35022299-35022321 AAGAAAAAGAATTTGAAGTAGGG + Intergenic
1125383610 15:39113735-39113757 GAGAAGAAGCCTGAGAAGGAAGG + Intergenic
1125751039 15:42028950-42028972 AAGTATAAACATTACAAGAAAGG + Intronic
1126811123 15:52405257-52405279 CAGAATAAGCTTTAGTGGGATGG - Intronic
1127097788 15:55530560-55530582 AAGAATAACAAGTAGAAGAATGG - Intergenic
1127216497 15:56828711-56828733 AAGAATAAGAATTAGAAAGAAGG + Intronic
1127943582 15:63726635-63726657 AAGAAGAAACATAAGATGGAAGG + Intronic
1127984213 15:64056716-64056738 GGGAAAAAGCAATAGAAGGAAGG + Intronic
1128403210 15:67307474-67307496 TAGAAGAAGCACTAGAAGTAAGG + Intronic
1128619765 15:69138780-69138802 AAGAAAAAATATTTGAAGGAAGG - Intergenic
1129955488 15:79632863-79632885 AAGAACAGGCATGAGAAAGATGG + Intergenic
1131027186 15:89153441-89153463 AAGAAAAAGCATTAGAAATAAGG - Intronic
1131282143 15:91030630-91030652 AAAAATAAGCACTGTAAGGAAGG - Intergenic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131447202 15:92510306-92510328 AAGATTGAGCATTAGAGGGTTGG - Intergenic
1131700388 15:94929198-94929220 AAGAAAAACCATTAGAAAGCAGG - Intergenic
1131769683 15:95722897-95722919 AAAAGTAAGCACTAGAAGGCTGG - Intergenic
1131897119 15:97045699-97045721 AAGAAAGAGAATTAAAAGGAAGG + Intergenic
1133332141 16:4981473-4981495 GAGACTGAGCAGTAGAAGGAAGG + Intronic
1135492859 16:22924955-22924977 CAGAATAACCATGAGAAGGGAGG + Intergenic
1136003014 16:27310471-27310493 ATGTATCAGCATTATAAGGAAGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1138914742 16:61450085-61450107 GAGAAAAAGCAATAGAAGGGAGG - Intergenic
1139263827 16:65621492-65621514 AAGAATCAGACTAAGAAGGAAGG + Intergenic
1140290871 16:73655319-73655341 AAATATAAGGATTAGAAAGAAGG + Intergenic
1142682854 17:1560665-1560687 AGGAAAAAGAATCAGAAGGATGG + Intronic
1144741624 17:17586176-17586198 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1144996088 17:19270006-19270028 AAGAATAGGGATTAAGAGGATGG + Intronic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1146416616 17:32639868-32639890 AGAAATAAGAATTTGAAGGAGGG - Intronic
1146601377 17:34219841-34219863 AAGTATAAGCTTTGGAATGAGGG - Intergenic
1146812087 17:35911918-35911940 AAGAATAAGCATAAAAATGGAGG - Intergenic
1147116939 17:38307692-38307714 AAGAATCAACATTAGGAGGCTGG + Intronic
1150073475 17:62172421-62172443 AAAAGTAAGCATTAGAATTATGG + Intergenic
1150200579 17:63352879-63352901 AAATATAAGCTTTAGGAGGATGG - Intronic
1150989975 17:70246028-70246050 AAGAAAAAGTATTAGTAGGAAGG - Intergenic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1153359879 18:4182231-4182253 AAGAACAAGCAGAAGCAGGAAGG + Intronic
1153633099 18:7090489-7090511 AAGAATTTGCTTTTGAAGGAGGG - Intronic
1153885269 18:9458828-9458850 AAGAAGAAAGGTTAGAAGGAAGG + Intergenic
1156040129 18:32811065-32811087 AAGAATAAGAATTAAGGGGATGG + Intergenic
1156192747 18:34738568-34738590 AAGAGAAAGGAGTAGAAGGAGGG - Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156634058 18:39006441-39006463 AAGAATAAGTATCAGAGGGCCGG - Intergenic
1156740303 18:40318565-40318587 AGGAATAAGTATTTGAAGTAAGG + Intergenic
1156753741 18:40494699-40494721 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1156843997 18:41642158-41642180 AAAAATAAGCATAAGAAAGCTGG + Intergenic
1156887395 18:42151205-42151227 AAAAATATGGATTAAAAGGATGG - Intergenic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157355518 18:46930222-46930244 AAGAACAAGCATTTCAAAGAAGG - Intronic
1157409222 18:47449602-47449624 AATAACATGCATTAGAATGATGG + Intergenic
1157587398 18:48813248-48813270 GTGAATAGGCATTCGAAGGAAGG - Intronic
1158640315 18:59197999-59198021 CAGAACAAGCATTGGAAGCAGGG + Intergenic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1164491522 19:28719419-28719441 AAGGATAAGCATTTGAAGGAAGG + Intergenic
1166624436 19:44337186-44337208 AAGAAGAAACACAAGAAGGAAGG - Intronic
1166846502 19:45731652-45731674 AAAATTAAGCCTTAGGAGGAAGG + Intergenic
1167181100 19:47904000-47904022 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167181768 19:47909359-47909381 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167182418 19:47914749-47914771 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183085 19:47920101-47920123 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167183753 19:47925451-47925473 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167184383 19:47930501-47930523 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185055 19:47935852-47935874 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167185707 19:47941241-47941263 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167186374 19:47946599-47946621 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187025 19:47951987-47952009 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167187675 19:47957370-47957392 AAGGATAAGAAATAGAAGGAGGG + Intergenic
1167542166 19:50096262-50096284 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167542601 19:50099327-50099349 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543038 19:50102392-50102414 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167543474 19:50105455-50105477 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544147 19:50110799-50110821 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167544822 19:50116152-50116174 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167545497 19:50121504-50121526 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546174 19:50126832-50126854 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167546851 19:50132167-50132189 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1167547509 19:50137540-50137562 AAGGATAAGAAATAGAAGGAGGG - Intergenic
1168419082 19:56189228-56189250 AAGAATAAAAATTAGAAGTAAGG - Intergenic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
925691971 2:6534543-6534565 AAAAATGAGCATTAGAGGGCAGG + Intergenic
925943260 2:8839341-8839363 AAGAATAGAGATGAGAAGGAGGG + Intergenic
926255699 2:11195006-11195028 TAGAATCAAGATTAGAAGGATGG - Exonic
926650218 2:15335658-15335680 ATGGATAACCATTAGAAGAATGG - Intronic
926828785 2:16937170-16937192 AAGAAGAAGAAAAAGAAGGAAGG + Intergenic
927038556 2:19205274-19205296 AAAAATGAGTACTAGAAGGAAGG + Intergenic
929072652 2:38049243-38049265 AAGAAAAGGGAGTAGAAGGAAGG + Intronic
929283741 2:40112668-40112690 AAAAATAAGGATGGGAAGGATGG + Intronic
929458051 2:42080152-42080174 AAGAAAAAGCAATGGAAAGAAGG - Intergenic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
930391173 2:50763495-50763517 AATAATAATAATTTGAAGGAGGG - Intronic
930434324 2:51321137-51321159 AATAATAAGCATTAAAAAGGAGG - Intergenic
931605863 2:64051504-64051526 AATAATTAGCATTACAGGGAGGG - Intergenic
931681787 2:64756007-64756029 AAATAGAAGAATTAGAAGGAAGG + Intergenic
931769147 2:65482574-65482596 AAAAAAAAAAATTAGAAGGAAGG - Intergenic
931821945 2:65961154-65961176 AAGAACAAACATCAGTAGGAAGG + Intergenic
933318642 2:80745095-80745117 AAGAAATATCATTAGAAAGATGG + Intergenic
933483579 2:82889112-82889134 AAAAATGAGGATTAGAAGGTTGG - Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933803170 2:85979078-85979100 AAGAATGAGAAAGAGAAGGAAGG - Intergenic
935305733 2:101734715-101734737 AAGAAGAAGCAACAGAAGGCAGG - Intronic
935717553 2:105952508-105952530 AAGAAAAAGCACCAGAAAGAGGG + Intergenic
935902970 2:107812259-107812281 AAGAGGATGCATTGGAAGGAAGG - Intergenic
935902982 2:107812356-107812378 AAGAGGACGCATTGGAAGGAAGG - Intergenic
936993270 2:118388035-118388057 AATAATAAACATTTGAAGGCAGG + Intergenic
937106543 2:119320867-119320889 AAGACTAAGAATTAAAAGAAGGG - Intronic
937422959 2:121773603-121773625 AAAAATACACATTGGAAGGAGGG + Intergenic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
938688611 2:133765532-133765554 AAGAACAAGAATTAGAAAGAAGG + Intergenic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939283419 2:140095686-140095708 AAGAAGCTGCATAAGAAGGAAGG - Intergenic
940078797 2:149776506-149776528 AAGAATAATGATTAGAGGTAGGG + Intergenic
941331119 2:164178544-164178566 AAGCAAAAGTATTAGAAAGAAGG - Intergenic
941405769 2:165085385-165085407 AAGAGTAAACAATAGGAGGAAGG - Intergenic
941999571 2:171632463-171632485 CAGAATGAGAATCAGAAGGAAGG + Intergenic
942389810 2:175480202-175480224 AAGTATAAGCAATAGAAACAAGG + Intergenic
944332054 2:198481203-198481225 AATAACAAGCAAAAGAAGGAGGG - Intronic
946210893 2:218146434-218146456 ATGAATAAGTATTGGAAGAAAGG + Intergenic
946787205 2:223259844-223259866 AGGATTAAGCATTACAAGAATGG - Intergenic
948320674 2:237066213-237066235 AAAAATAAGCTTTAGAACTAAGG + Intergenic
1169648607 20:7842214-7842236 ACCAATGAGCATTAGAAGAATGG + Intergenic
1170397590 20:15944288-15944310 AAAAATAAGCAAAAGAAGGAAGG + Intronic
1170879483 20:20283370-20283392 AACAGTAAGCATAAGAAGAATGG - Intronic
1173775124 20:45698979-45699001 AAGAAGAAGGAGGAGAAGGAGGG + Intronic
1173936256 20:46867867-46867889 AACAATAAGCATAAGAAGGCAGG - Intergenic
1173958348 20:47052218-47052240 AAGAAAAAGCTTTAGAACCAGGG + Intronic
1173987993 20:47277591-47277613 GAGAATAAGCTTTCCAAGGAAGG + Intronic
1174711291 20:52708017-52708039 AAGAAAAAGCATTACATGTAGGG + Intergenic
1177193206 21:17874608-17874630 AAGAAGAATCATTAGAATGTAGG + Intergenic
1177365966 21:20137203-20137225 AATAATAAGCATTATAAATATGG - Intergenic
1178558903 21:33619372-33619394 TAGAGTAGGCATTTGAAGGAAGG - Intronic
1178694972 21:34785062-34785084 AAGAATAAGCTTTTGATGAAAGG + Intergenic
1179004013 21:37493916-37493938 AAAAAGAAGAATTAAAAGGAAGG - Intronic
1179141380 21:38728417-38728439 AAGAATGAGAATAAGAATGAGGG - Intergenic
1180034803 21:45240642-45240664 AAGAATATACATTGGAAGAAAGG + Intergenic
1181563028 22:23716799-23716821 AAAATTAAACATTAGAAAGAAGG + Intergenic
1181716985 22:24738158-24738180 AAGAAAAAGAAAAAGAAGGAAGG + Intronic
1181941113 22:26477989-26478011 AAGAAAAAGAAATGGAAGGATGG + Intronic
1182259064 22:29059810-29059832 AAAAATAAGGGTGAGAAGGAAGG - Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1184944438 22:47793094-47793116 AAAAATAAGCATAAAAAGGAAGG + Intergenic
1185195059 22:49464175-49464197 ATGAATAAACAGTAGAAGGCAGG - Intronic
950338550 3:12220860-12220882 AAGATCAAGCCTTAGAAGGAGGG - Intergenic
950443035 3:13020928-13020950 AAGAAGGAGAAATAGAAGGAAGG + Intronic
950602360 3:14045910-14045932 AAGAGTCAGGATTATAAGGAGGG + Intronic
951523402 3:23630449-23630471 AAGAAAAAGAAGTGGAAGGAAGG + Intergenic
952042703 3:29279713-29279735 AAGAATAACAATCAGAAGGAAGG - Intergenic
952322341 3:32289815-32289837 AAGAATAAGAAATACAAGGATGG + Intronic
952574302 3:34756131-34756153 AAGAATGAACATTAGGAGAATGG - Intergenic
953101347 3:39831545-39831567 AAAAATAAGTATTAAAAAGAAGG - Intronic
953628050 3:44587058-44587080 AAAAAAAAGAATTAGAAGAAAGG - Intronic
954502554 3:51032486-51032508 CACAATAAGCATAAGAAGGCTGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955731873 3:61995763-61995785 AAGAAAAAGAAAAAGAAGGAGGG - Intronic
957202406 3:77153800-77153822 AAGAATCATTATTAGATGGAGGG - Intronic
957333472 3:78796063-78796085 AATAATAATCATAAGATGGAGGG - Intronic
957506970 3:81134578-81134600 AAGAATAAGCTTTAGCAGCTTGG - Intergenic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
960812595 3:121638710-121638732 AAGAGTAAGCATAAGAAAGATGG + Intronic
960900102 3:122545677-122545699 AAGAATAAGCATAGGAAAAATGG + Intronic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963607544 3:147423973-147423995 AAGAAAAAGCTGGAGAAGGATGG + Intronic
964112822 3:153105019-153105041 AAGAATAAGAATGAGAATTAAGG + Intergenic
964704657 3:159605174-159605196 AGGGCGAAGCATTAGAAGGAGGG + Intronic
965302589 3:167020858-167020880 GAGAATAATCATTACAAAGATGG + Intergenic
965496173 3:169401654-169401676 AAGAATAAGCTGAAGAAGAAAGG + Intronic
965669721 3:171134656-171134678 AAGAATACTCAGTAAAAGGAGGG + Intronic
965756211 3:172029912-172029934 AAGAGGAAGCAAGAGAAGGAAGG - Intergenic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
967746838 3:193065727-193065749 AAGAATCAGCAAAGGAAGGAAGG + Intergenic
968162133 3:196435256-196435278 AAGAATATGAATATGAAGGATGG + Intergenic
968399055 4:272496-272518 AAGAAAAAGCTGTAAAAGGAAGG - Exonic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969920801 4:10537780-10537802 AAGAACAAACAAGAGAAGGAAGG - Intronic
970111921 4:12647204-12647226 AAGAATAATGATTAAAAGGCTGG + Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970999435 4:22305188-22305210 AAAAAGAAGAATAAGAAGGATGG + Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971877889 4:32327936-32327958 AGGAAAAAGCATCACAAGGATGG + Intergenic
971991498 4:33902455-33902477 AAAAATAATCATTAGAAGGAAGG + Intergenic
972400087 4:38693354-38693376 AAAAAAAAGCATGAGAAGTAAGG + Intronic
972419780 4:38876465-38876487 GAGAATAAGCATAGGAAGGCAGG - Intronic
972953111 4:44354076-44354098 AAAACTAAGCATTAGAAGTATGG - Intronic
973898685 4:55443944-55443966 AAGAATGAGCATTAAAAAGAAGG + Intronic
974001536 4:56516324-56516346 AATAATAACCATAAGAAAGATGG + Intronic
974148310 4:57973218-57973240 AATAATGAACATTAAAAGGAAGG - Intergenic
974226922 4:59058549-59058571 AAGAATAAGATGTAGAGGGATGG - Intergenic
974413520 4:61573397-61573419 AAGTTTAAGCATTTGAAAGATGG - Intronic
974818162 4:67032899-67032921 AGGAAGAACCATTAGAATGATGG + Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
976883773 4:89961959-89961981 AAGAACAAGAATTAGAGGTAGGG + Intergenic
976980125 4:91217173-91217195 AAGAGTAAGCAGTAGCAAGAGGG + Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977409151 4:96639190-96639212 GAGAATTAGCCTTAGAAAGAAGG - Intergenic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
978184591 4:105842038-105842060 AAGAAAAAGCAATAGAATGTGGG - Intronic
978614130 4:110576790-110576812 AAGAACAATCATTAGTAAGATGG + Intergenic
978667588 4:111204146-111204168 AAGAGAAAGAAATAGAAGGAAGG + Intergenic
979237210 4:118414854-118414876 AAGAATAAACACTAAAAAGATGG - Intergenic
979661480 4:123260719-123260741 AGGAATAAGGATTCTAAGGAAGG + Intronic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980858354 4:138468146-138468168 AAGAATATGGAATAGAAGGGTGG + Intergenic
981874809 4:149529367-149529389 AAGAATACGTTTTAAAAGGAAGG + Intergenic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
982942087 4:161571542-161571564 AAAATAGAGCATTAGAAGGAGGG + Intronic
982989303 4:162250535-162250557 AACAATAAACATGAGAAGGCTGG + Intergenic
983906348 4:173186537-173186559 AAGAAGAAGGAACAGAAGGAAGG - Intronic
984349009 4:178568279-178568301 AAAATTAAGAATTTGAAGGAAGG + Intergenic
984776854 4:183489038-183489060 AAATATAAGCATAAGAAGGTTGG - Intergenic
985192346 4:187389571-187389593 AAGAGTAACCAGCAGAAGGAGGG + Intergenic
985262741 4:188129889-188129911 CAGAATCTGCATTAGAATGAGGG + Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986175167 5:5346250-5346272 AAGAATCAGCATCAGAACCAGGG - Intergenic
986372787 5:7097615-7097637 AGGAATAAGCTTCAGAGGGAAGG - Intergenic
986856706 5:11877002-11877024 AAGAATAGACATAAGAAGCATGG - Intronic
987001539 5:13664848-13664870 AAGAAGGAGGATGAGAAGGAGGG + Intergenic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987265282 5:16246949-16246971 AAGAAAAAGGAATGGAAGGAAGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
989089316 5:37713240-37713262 AAGAATGAGGATCAAAAGGAGGG + Intronic
989129216 5:38088524-38088546 AAGTATAATCACAAGAAGGAAGG + Intergenic
989706106 5:44332834-44332856 AAGAAAAAGAAACAGAAGGAGGG + Intronic
989796344 5:45478825-45478847 AAGAATAAGCTGAAGAAGGCAGG + Intronic
989833456 5:45951232-45951254 CAGGATAAAAATTAGAAGGAAGG + Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
990429559 5:55720998-55721020 AAGAGTAAGCAAAAGCAGGAGGG + Intronic
992558865 5:77930355-77930377 AAGAATAGGTATTGGAAGGGTGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993101762 5:83549083-83549105 AAGTAAAAACATTAGAAAGATGG + Intronic
993162289 5:84307840-84307862 AAGAATATGAATTAGAAGGAGGG + Intronic
993199800 5:84800755-84800777 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
993573698 5:89575121-89575143 ATGAATAAGCATTATACAGAAGG + Intergenic
993811125 5:92477409-92477431 AAGAATAAGGATTAAAAGTCAGG + Intergenic
995117955 5:108502639-108502661 AACAGAAAGCAATAGAAGGAAGG - Intergenic
996150654 5:120030374-120030396 ATGAGTAAGCAATAGAATGATGG - Intergenic
996287746 5:121814583-121814605 AAGAAAACCCAGTAGAAGGATGG + Intergenic
996700086 5:126442259-126442281 AAGAAAAAGCATTTTAGGGAGGG - Intronic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
998361190 5:141589191-141589213 AAGAATAAGCATGAGAAAGAAGG + Intronic
998674293 5:144389748-144389770 AAGAAGAATCATAAGAAGTATGG + Intronic
999000004 5:147910127-147910149 AAGAATAAGAACAAGAAGCAGGG - Intergenic
999509797 5:152237766-152237788 AAAAATAAGTCATAGAAGGAAGG + Intergenic
999809962 5:155118252-155118274 AAGAAAAAGCAGAGGAAGGAGGG + Intergenic
1000594136 5:163194476-163194498 AAGAAGAAGCATTAGGAGTAAGG - Intergenic
1000658360 5:163909381-163909403 AATAATAAGCAATAAAATGATGG - Intergenic
1000840850 5:166216332-166216354 GAGAAAAAGCATAAGAAGAAAGG + Intergenic
1002893183 6:1355720-1355742 CAAAATCCGCATTAGAAGGAAGG + Intergenic
1003180555 6:3787918-3787940 AAGAATAAATATAAGAAGCAGGG + Intergenic
1003230587 6:4249305-4249327 AACAAACAGCATTAGAAGGTAGG - Intergenic
1006050122 6:31335850-31335872 AAGAATCAGGGTTATAAGGAGGG + Intronic
1006265220 6:32915751-32915773 GAGAATTGGCATTAGAGGGAGGG + Intergenic
1007675470 6:43590427-43590449 AAGAATTTGCATAAGAATGAGGG + Intronic
1008055381 6:46940407-46940429 AAGAAGGAGAATTGGAAGGATGG - Intronic
1008202387 6:48607058-48607080 AATGATAAGCATTGGAAGAAAGG - Intergenic
1008328678 6:50218904-50218926 AAGAATAAGAAAGAGAAGAAAGG - Intergenic
1008371945 6:50742513-50742535 AAGAAAAAGGATTGGATGGATGG + Intronic
1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG + Intronic
1008939772 6:57034006-57034028 AATAATGAGAATTAGAATGATGG - Intergenic
1009061874 6:58406409-58406431 CAGGATAAGAACTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009681135 6:66894908-66894930 AAGAGTAAGCATAAGAAGAGAGG - Intergenic
1011383759 6:86771245-86771267 AACAATAAGCATTAGGGAGAGGG + Intergenic
1012578588 6:100834133-100834155 ATGAATAAGTAATAAAAGGAGGG + Intronic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013214880 6:108018270-108018292 AAGGATAAGAAATGGAAGGACGG + Intergenic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1014442393 6:121488847-121488869 GTAAGTAAGCATTAGAAGGAAGG - Intergenic
1014639842 6:123895529-123895551 AAGAATCAGCACTAGATGGATGG - Intronic
1014986584 6:128018788-128018810 CAGAAGCAGCATTAGATGGAGGG + Intronic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015068689 6:129062308-129062330 CATAATAAGCTTTAGAAAGAAGG - Intronic
1015868445 6:137751804-137751826 AAGAATAAGCAGCAGCAGAAGGG + Intergenic
1017674076 6:156795753-156795775 AATAATAAGGAAGAGAAGGAAGG - Intronic
1018803821 6:167243209-167243231 AAGAAAAAGCATTAGATTTATGG - Intergenic
1019062810 6:169268588-169268610 AAAAATAAGCCATAGCAGGAGGG + Intergenic
1019843017 7:3468345-3468367 CAGAAGAAGCCTTAGAAGCAAGG + Intronic
1020231613 7:6323485-6323507 AAAAATAAGCATTATTAGGCCGG + Intergenic
1020362501 7:7343633-7343655 AAGAATAAGCATAACAAAGCTGG - Intergenic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021042422 7:15878769-15878791 AAGAATACGCTTTAGAAAGATGG + Intergenic
1021187105 7:17576848-17576870 AAAAATAAACATCAGAAGGTAGG + Intergenic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021494873 7:21263400-21263422 AGGAATAAACATTGGAAGGAGGG + Intergenic
1022333064 7:29398293-29398315 AAGAACTAGCCTTAAAAGGATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022749235 7:33205929-33205951 AACAATAATCATTATAAAGATGG - Intronic
1023215604 7:37859307-37859329 AAGAATAAGCATTAGAAGGATGG - Intronic
1023351205 7:39321763-39321785 GAGAAGATGCATTGGAAGGAAGG + Intronic
1023431642 7:40098634-40098656 AAAAATAAGGCTTAGAAAGAGGG + Intergenic
1023505365 7:40894212-40894234 AAAAATAAGCATTGGGAGAAAGG + Intergenic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023883768 7:44336165-44336187 GAGAATGATCAATAGAAGGAAGG + Intergenic
1024097085 7:45990797-45990819 CATAATAAGCATTAACAGGAGGG + Intergenic
1024471184 7:49769961-49769983 AGGAAGCAGCAATAGAAGGAGGG - Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026148683 7:67770199-67770221 AAGAAGAAACATAAGAAGGATGG - Intergenic
1026168443 7:67931904-67931926 AAGAAAAAGCCTTAGAAGCCCGG + Intergenic
1026269684 7:68825366-68825388 TAGAATGAACATTATAAGGATGG - Intergenic
1026645195 7:72161379-72161401 AAGAATAAGGTGGAGAAGGATGG + Intronic
1026844623 7:73691437-73691459 AAGGATCAGCACTAGGAGGAGGG - Intronic
1027486300 7:78765837-78765859 AAGAAAAAGCATGAGAAGCCTGG + Intronic
1027914668 7:84300558-84300580 AATAATAAGCATGAGAATGCTGG + Intronic
1027960256 7:84937223-84937245 AAGAAGAAGCAATAGGAAGAAGG + Intergenic
1028069560 7:86434570-86434592 CAGAATAACTCTTAGAAGGATGG + Intergenic
1028548749 7:92032900-92032922 AAGAACAAGAATTTAAAGGATGG - Intronic
1028616455 7:92773352-92773374 AAGAAATGGCATGAGAAGGAAGG + Intronic
1028864711 7:95694565-95694587 AAAAGTATGCATTAGAGGGAGGG + Intergenic
1028925772 7:96355598-96355620 AAGAAGCAACATTATAAGGAAGG - Intergenic
1029024607 7:97402988-97403010 GAGGATAAGCATTAGGTGGATGG + Intergenic
1029321157 7:99761475-99761497 AAGAAGAAGGAGGAGAAGGAGGG - Intronic
1030475128 7:110022359-110022381 AAGAAGAAGAAATAGAAGGTTGG - Intergenic
1030568257 7:111188023-111188045 AAGGAGAAGCTTTAGTAGGAAGG + Intronic
1031216957 7:118906450-118906472 AATAATAAACATTAGTTGGAGGG - Intergenic
1032485929 7:132287580-132287602 AAGTATAAGCATGTGCAGGATGG - Intronic
1032987036 7:137349002-137349024 AAGAAAAAAAATGAGAAGGAGGG + Intergenic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033178126 7:139146296-139146318 CAAAATAAGCATTACAAGGTTGG + Intronic
1033574564 7:142668132-142668154 AAGAAGCAGAGTTAGAAGGAAGG + Intergenic
1033662489 7:143411962-143411984 AAGGATGAGTCTTAGAAGGATGG - Intergenic
1033936696 7:146594077-146594099 TAGAAGAAACATTAGAAGTAAGG - Intronic
1035938023 8:3864407-3864429 GAGAAAAAGCATGAGAAGAAAGG + Intronic
1036088038 8:5635080-5635102 AAAGATAGACATTAGAAGGATGG + Intergenic
1036127177 8:6073990-6074012 AAGAGTAAGCAGTAAAATGAAGG + Intergenic
1036395217 8:8364511-8364533 AAGAATAAGCCATAAAATGATGG - Intronic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038210671 8:25516712-25516734 TAGATTAAGCATTATAAGGGGGG - Intergenic
1038905660 8:31899349-31899371 GAGAATAGGGAATAGAAGGATGG - Intronic
1039673506 8:39632616-39632638 AAGAAAAATCATTATAAGAAAGG - Intronic
1039708028 8:40027034-40027056 CACAATAAGCACAAGAAGGACGG + Intergenic
1040102037 8:43513993-43514015 AAGAAGGAGCATCAGAAGGCAGG + Intergenic
1040599006 8:48866033-48866055 AAGAATATGTAAGAGAAGGAAGG + Intergenic
1041854922 8:62440675-62440697 AAGAAGAAGAAAAAGAAGGAAGG - Intronic
1042391225 8:68237740-68237762 AAGATTAAGCAACAGAAGAAGGG + Intergenic
1042941692 8:74114692-74114714 AAAAATATTCATTAGAAAGATGG - Intergenic
1042953742 8:74226549-74226571 AAGAATAAGCATGGGGAAGATGG + Intergenic
1043035238 8:75189237-75189259 AGAAATAAGCCTTAGAACGAAGG - Intergenic
1043280749 8:78462857-78462879 AAGAGGAAGCATGAGTAGGATGG - Intergenic
1044658593 8:94573463-94573485 GAGAATACACATTATAAGGAAGG + Intergenic
1044856290 8:96479228-96479250 AAGAATAAGGAATGCAAGGATGG - Intergenic
1045074426 8:98547517-98547539 AATAAGAAGCACTAGAAAGAAGG - Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1045642363 8:104265397-104265419 AACAGTAAGCATAAGAAGGATGG - Intergenic
1046141317 8:110096676-110096698 AAGAAGAAGAATCAGAAGGAGGG + Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1047013870 8:120701763-120701785 GGGAAGAAGCATTTGAAGGATGG + Intronic
1047486755 8:125338068-125338090 AGGGATGAGAATTAGAAGGAGGG - Intronic
1047704635 8:127485322-127485344 AAGAATAAAAATTAAAAGAAGGG + Intergenic
1048296090 8:133215062-133215084 AAGAAGAAAAATTAGAAAGATGG - Intronic
1048408422 8:134146438-134146460 AAGAATAAGTGTTATAATGAAGG - Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048667313 8:136677214-136677236 TAAAATAAGAATTAGAAAGAAGG + Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048865237 8:138755888-138755910 AAGAATAAGCCTCAGAGGGATGG - Intronic
1049837997 8:144751878-144751900 AACAGTAAGTATAAGAAGGATGG + Intronic
1050157105 9:2679321-2679343 AGGAATAAGGATTGCAAGGAGGG - Intergenic
1050180028 9:2912210-2912232 AAGAATAAGGATGAGAATAAGGG + Intergenic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053309086 9:37004200-37004222 AAGAATAAGAATTGGATGGGAGG + Intronic
1053486893 9:38465354-38465376 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1055842844 9:80526664-80526686 AGAAATAAGCTTTAGAAGGTGGG + Intergenic
1055922354 9:81474446-81474468 AAAAATGAGCATTATAAGGAAGG - Intergenic
1056042644 9:82684503-82684525 AAAAAAAAGGATTAGAAAGAAGG + Intergenic
1057119784 9:92560742-92560764 AAGAATAAGGAATAAATGGAAGG - Intronic
1058232330 9:102443168-102443190 AAGAAAAAGAATTAGAAATATGG - Intergenic
1059066361 9:111089738-111089760 AACAGTAAACATTAGAAGGCTGG + Intergenic
1059153139 9:111967043-111967065 AAGAGTAAGGCTCAGAAGGAAGG + Intergenic
1059392850 9:114009827-114009849 AAGAAAAAGCATTTGGGGGAGGG - Intronic
1059483421 9:114609717-114609739 AAGAAAAAGAAAAAGAAGGAAGG + Intergenic
1059759368 9:117323705-117323727 AATAATTAGTATTAGAAGGAGGG - Intronic
1060030392 9:120209919-120209941 AAGAACAAGGATTAGAGGTAAGG + Intergenic
1060332373 9:122684701-122684723 AAGAAAAAGAATAAGAAAGAAGG + Intergenic
1060366976 9:123026791-123026813 AAAAATAACCATCAGAAAGAAGG - Intronic
1060393313 9:123297439-123297461 AAGAATAAGCAATCTAAGGCCGG + Intergenic
1060486387 9:124050014-124050036 AAGTATAAGAATTAGAAAGGAGG - Intergenic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1060859928 9:126946008-126946030 AAGAATAAACCATAGAGGGACGG + Intronic
1203488805 Un_GL000224v1:84258-84280 AAGAAAAATCTTTAGAAGAAAGG - Intergenic
1203501426 Un_KI270741v1:26153-26175 AAGAAAAATCTTTAGAAGAAAGG - Intergenic
1185531872 X:826851-826873 AAGAATAAGAATTTGAATGCAGG + Intergenic
1187025797 X:15434169-15434191 AAGAAGAAGGAGGAGAAGGAAGG + Intronic
1187109461 X:16281725-16281747 AAGAAAAAGGGATAGAAGGAAGG - Intergenic
1187501767 X:19844782-19844804 AAGAATATGCATTAGAGGCCGGG + Intronic
1187632425 X:21189052-21189074 AAAAATAAGTTTTGGAAGGATGG + Intergenic
1188095683 X:26018570-26018592 AGGATTAAACATTGGAAGGAGGG + Intergenic
1188663967 X:32795352-32795374 AAGAACATGCATTAGGGGGAAGG + Intronic
1189559859 X:42181345-42181367 CAGAATATGAATTAGAAGCAAGG + Intergenic
1189675137 X:43453636-43453658 AAGAATGAGCATGAGAGTGAAGG + Intergenic
1189842713 X:45098297-45098319 AAGATGAAGCATTAAATGGAAGG + Intronic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191269320 X:58442761-58442783 AAGGATAAACACTAGAAGGTAGG - Intergenic
1191752513 X:64558315-64558337 AAGAATATGCATTAGAGAAAAGG + Intergenic
1191840368 X:65509461-65509483 CAGAACAAGGAGTAGAAGGAAGG - Intergenic
1193903102 X:87207508-87207530 AATAAAAAGTATTAGAAGAAAGG + Intergenic
1195791873 X:108597091-108597113 AACAAAAAGAAGTAGAAGGAAGG + Intronic
1195864216 X:109411895-109411917 AATAATAAGACTTAGAAGAAAGG + Intronic
1197292798 X:124680639-124680661 AAGAATAAGCAGCATAATGATGG + Intronic
1198110229 X:133496477-133496499 AAGAAAAAGAAATAAAAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198682644 X:139199309-139199331 AAGATTAAGCAATTGAAGGAGGG - Intronic
1200872834 Y:8121898-8121920 CAGAATAAGCATTAAAATGCAGG + Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1202582058 Y:26392497-26392519 AAGGATAAGAATTAGAAAAATGG + Intergenic