ID: 1023216234

View in Genome Browser
Species Human (GRCh38)
Location 7:37866059-37866081
Sequence CCAGACAAAAAAGAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023216234_1023216242 29 Left 1023216234 7:37866059-37866081 CCCACCAACTCTTTTTTGTCTGG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1023216242 7:37866111-37866133 TATTAGAAAGTGTACTGGCTTGG 0: 1
1: 2
2: 4
3: 29
4: 252
1023216234_1023216243 30 Left 1023216234 7:37866059-37866081 CCCACCAACTCTTTTTTGTCTGG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1023216243 7:37866112-37866134 ATTAGAAAGTGTACTGGCTTGGG No data
1023216234_1023216241 24 Left 1023216234 7:37866059-37866081 CCCACCAACTCTTTTTTGTCTGG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1023216241 7:37866106-37866128 CTGTGTATTAGAAAGTGTACTGG 0: 1
1: 1
2: 0
3: 17
4: 169
1023216234_1023216240 -4 Left 1023216234 7:37866059-37866081 CCCACCAACTCTTTTTTGTCTGG 0: 1
1: 0
2: 1
3: 23
4: 249
Right 1023216240 7:37866078-37866100 CTGGGGATATAATATAATAAAGG 0: 1
1: 0
2: 0
3: 25
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023216234 Original CRISPR CCAGACAAAAAAGAGTTGGT GGG (reversed) Intronic
900747459 1:4370827-4370849 CCAGAGAATAAAGTGTTGATTGG + Intergenic
901282401 1:8049086-8049108 ACAAACAAAAAAGAATTGGCAGG - Intergenic
902181105 1:14689229-14689251 CAAAACAAAACAGAGTTGATTGG + Intronic
903025520 1:20427434-20427456 TCAAACAGAAAAGAGTTGCTCGG + Intergenic
903769231 1:25753624-25753646 CCAGACAAAACACAAATGGTGGG - Intronic
904228211 1:29042765-29042787 CCAAAAAAAAAAAAGTTGGGGGG - Intronic
904737595 1:32646738-32646760 CCATAAAAAAAAGGGTTGGCCGG + Intronic
905466067 1:38154343-38154365 CCAGGCAAAAAGGAGAGGGTGGG - Intergenic
908649568 1:66317186-66317208 CCAACCCAAAAAGAGTTGCTTGG + Intronic
908908200 1:69040168-69040190 CCAGACAAATAAAAGCTGATGGG + Intergenic
909956526 1:81785942-81785964 ACAGAAAAAAAAAAATTGGTGGG + Intronic
910215708 1:84841995-84842017 ACAGAAAAAAAAAAGTTTGTAGG + Intronic
910435450 1:87201320-87201342 CCAGACAAATAAGAATAGTTTGG + Intergenic
911596567 1:99804804-99804826 GCAAACAAAAAACAGTTGTTGGG + Intergenic
911881117 1:103239151-103239173 CCAGACAACAAAGAATTACTTGG + Intergenic
911949519 1:104154547-104154569 CAAATCAAAAAAGAGTTGGCAGG - Intergenic
913308706 1:117462555-117462577 CCAGAGAACAAAGAGAAGGTTGG + Intronic
915447186 1:155980421-155980443 GGAGACAGAAAAGAGTTGGAGGG - Intronic
915608392 1:156969967-156969989 CCAGAGAAAAAAGGGGTGATGGG + Intronic
917236896 1:172903384-172903406 CCAGACTCAAAAATGTTGGTTGG + Intergenic
917955663 1:180094990-180095012 ACAGGCAAAAAAGAATTGGGTGG - Intronic
918396661 1:184120055-184120077 CCAGAGAAGAGAGACTTGGTGGG - Intergenic
918571199 1:185995350-185995372 CCAAACCAAAAATAGTGGGTGGG - Intronic
920823609 1:209403868-209403890 ACAGACATAAAACTGTTGGTAGG + Intergenic
921235833 1:213128595-213128617 TCAGACAAAAAAGAGGTAATAGG - Intronic
921418807 1:214922250-214922272 CAAGACAAAGAAGAGGAGGTGGG - Intergenic
921448419 1:215273684-215273706 GCAGTCAAAAAACAGTTGTTGGG - Intergenic
921523988 1:216194528-216194550 TCAGACAAACAAGAAATGGTAGG + Intronic
923218492 1:231871867-231871889 ACAGACCAGAAAGAGTTGTTGGG - Intronic
923660376 1:235952035-235952057 CCAGACTGAAGAGAGTGGGTTGG + Intergenic
924167842 1:241303694-241303716 CCAGAAAAAAGAGAGATGTTGGG - Intronic
924350755 1:243112471-243112493 CGAAAAAAAAAAGTGTTGGTGGG + Intergenic
1064843294 10:19620873-19620895 CCATTCAAAAAAGAATTAGTGGG + Intronic
1065856549 10:29835601-29835623 CAAAACAAAAAAGAGTTGGAGGG - Intergenic
1066225905 10:33383137-33383159 GCAGAGGAAAAAGAGTTGGCTGG - Intergenic
1068200456 10:53777031-53777053 CCTGAAAAATAAAAGTTGGTAGG + Intergenic
1068782873 10:60940749-60940771 CCAGACAAAAAAAATGTGCTTGG + Intronic
1072939343 10:99745857-99745879 ACAAACAAAAAAAAGTAGGTTGG + Intronic
1073007568 10:100336471-100336493 CCAGACAAAAGAATCTTGGTTGG + Intergenic
1073213486 10:101823237-101823259 CCAGAAAAAAAACAGTAGGTTGG - Intergenic
1073364736 10:102929263-102929285 CAAGAAAAAAAAGAGTGGCTAGG + Intronic
1074679599 10:115890983-115891005 ACAGCCAAACAAGAGTTGCTTGG - Intronic
1075154058 10:119959342-119959364 CCAGAAGGAAAAGACTTGGTTGG - Intergenic
1075587943 10:123670917-123670939 CCACACAACAAAGAGTTCATAGG - Intronic
1078001778 11:7502522-7502544 CCAGGGAAAAAAGAGGTAGTAGG + Intronic
1079117791 11:17651717-17651739 CCAGACAACAAAGAGTTAAAGGG + Intergenic
1079193318 11:18301058-18301080 ACAGACAGAAAGGAGTTGTTAGG - Intronic
1082555244 11:54556806-54556828 GGAGACAACATAGAGTTGGTTGG - Intergenic
1083625589 11:64070456-64070478 CCAAACAAATAGGAGCTGGTGGG + Intronic
1085852273 11:80136029-80136051 CCAGATAAACAAAAGTTGGGGGG - Intergenic
1086606641 11:88703674-88703696 CCACACAATTAGGAGTTGGTAGG - Intronic
1086966932 11:93038064-93038086 CCACACAGAAAAGAGTTTGCTGG + Intergenic
1089801161 11:121028978-121029000 CTAGAAAATAAAGAATTGGTAGG - Intronic
1090599757 11:128358098-128358120 CCTGAAAAAAAGGAGTTGATAGG - Intergenic
1091138699 11:133217172-133217194 CCAGAAAAAAGAGAGATGGGGGG - Intronic
1091813813 12:3421254-3421276 CCAGATAAAAATGACTTGGGAGG - Intronic
1093585492 12:20830444-20830466 CCAGAGAAAAATGAGCAGGTAGG + Intronic
1095054964 12:37587496-37587518 CCATACAAAAATTAGTTGGGTGG - Intergenic
1098283826 12:68887978-68888000 CCAGACAACAAAGAATTGACAGG - Intronic
1099653666 12:85461609-85461631 CCCTACAAAAAAGAGTTATTTGG - Intergenic
1100773642 12:97950969-97950991 CCAGGCAAAAAAAAAATGGTAGG + Intergenic
1102866837 12:116381468-116381490 CCAGAGAAAAGAAAGTTGGCTGG + Intergenic
1105513505 13:21071232-21071254 CCAGGCCAAAAAGAGTTCTTGGG + Intergenic
1106329418 13:28725783-28725805 CAAGCCAAAAAAGAGATGTTCGG - Intergenic
1106764954 13:32904301-32904323 CCAGGCAAAATAGAGCTGGAAGG + Intergenic
1108161082 13:47640273-47640295 CCTGAAAATAAATAGTTGGTTGG + Intergenic
1108678675 13:52760788-52760810 ACAGAAAGAAAAGAGTTGGTGGG - Intergenic
1108755010 13:53489557-53489579 CCAGGCAAAAAAGATCTTGTAGG - Intergenic
1108805914 13:54156358-54156380 TCAGAAAAAAAAGATTTAGTGGG + Intergenic
1109337639 13:61012906-61012928 CCAGACAAAAATGAGTTAAGGGG - Intergenic
1109453922 13:62557888-62557910 GCAGACAACAAAGAGATGCTTGG + Intergenic
1109648023 13:65285706-65285728 CTAAAAAAAAAAGAGTTGGGTGG + Intergenic
1111416561 13:87954397-87954419 CCACAGAAACAAGAGATGGTAGG + Intergenic
1112233801 13:97616294-97616316 GAAGACAAAAATGAGTTGGTAGG - Intergenic
1113190149 13:107735782-107735804 CTACACCAAGAAGAGTTGGTGGG - Intronic
1115377425 14:32693288-32693310 CCAGACCACAGAGAGTTGGCAGG - Intronic
1115771187 14:36665044-36665066 CCAGACAAAAGGCAGTCGGTGGG - Intronic
1116316641 14:43404835-43404857 AAAGAGAAAAAAAAGTTGGTAGG + Intergenic
1116604061 14:46967342-46967364 CCAGACAACAAGTATTTGGTTGG - Intronic
1116992990 14:51294821-51294843 TGGGACAAAAAAGAGTTGGTAGG - Intergenic
1118421569 14:65611108-65611130 CCATGAAAAAAAGAGGTGGTTGG - Intronic
1119905366 14:78297309-78297331 CTAGAGAAAAAAAAGTTGGATGG + Intronic
1121689985 14:95871149-95871171 CAAGACAAAAACGAATGGGTGGG + Intergenic
1123981645 15:25610182-25610204 CCAGAGAGAACAGAATTGGTTGG - Intergenic
1124206601 15:27725998-27726020 CCAGATAATAAATAGTTGGCTGG + Intergenic
1125293478 15:38175854-38175876 GCAGACAATAAAAAGTTGCTTGG - Intergenic
1125692010 15:41603473-41603495 CTAGAAAAGACAGAGTTGGTGGG + Intergenic
1125833697 15:42733270-42733292 CCAAAAAAAAAAAAGGTGGTGGG - Intronic
1127123029 15:55787362-55787384 CCAGGTATCAAAGAGTTGGTGGG - Intergenic
1127430707 15:58904690-58904712 ACAGACAAAAAAAAATTGGCCGG - Intronic
1129760739 15:78128041-78128063 CCAGGCACAAAAGAGATGTTTGG - Intronic
1132402060 15:101517193-101517215 AAAGACAAAAAAGTGTTGGCAGG - Intronic
1134533241 16:15001751-15001773 GCAGAATAAAAAGAGTTGATGGG - Intronic
1135116437 16:19727595-19727617 CCCAAAAAAAAAGATTTGGTTGG + Intronic
1135317388 16:21461198-21461220 ACAGACAAAAAACAGGTGCTGGG + Intergenic
1135318098 16:21468307-21468329 CCAAAAAAAAAAGAGTGGGGGGG + Intergenic
1135370286 16:21893010-21893032 ACAGACAAAAAACAGGTGCTGGG + Intergenic
1135370991 16:21900102-21900124 CCAAAAAAAAAAGAGTTGGGGGG + Intergenic
1135441503 16:22477691-22477713 ACAGACAAAAAACAGGTGCTGGG - Intergenic
1135719930 16:24807640-24807662 ACAGAGAAAAAAGAGTGGGTGGG - Intronic
1136557404 16:31015719-31015741 AAAAAAAAAAAAGAGTTGGTAGG + Intergenic
1136633908 16:31507383-31507405 CCAGAAAAAAAAGATATAGTTGG - Intronic
1137866431 16:51901635-51901657 TCAGAAAAAAAAGAGTAGGGGGG + Intergenic
1139057481 16:63202969-63202991 CCAGACAGAAAAGAGCAAGTTGG - Intergenic
1139126552 16:64085192-64085214 CCAGAGATAAAAGAGTGGGAAGG - Intergenic
1139646114 16:68331907-68331929 CCAGAAAAAACAAAGATGGTGGG - Intronic
1140966909 16:79975768-79975790 CCACACAAATAATAGATGGTAGG + Intergenic
1141856609 16:86685651-86685673 TGAGAAAAACAAGAGTTGGTAGG + Intergenic
1142422864 16:89983316-89983338 CCAGACAAAAAGGCCTTGGGTGG - Intergenic
1142687304 17:1585005-1585027 GCAGATAACAAAGGGTTGGTGGG + Intronic
1145375634 17:22345061-22345083 ACATACAAAAATGAGTTGGGCGG - Intergenic
1146252613 17:31362606-31362628 ACAGAAAAAAAAGAACTGGTGGG - Intronic
1147747702 17:42705483-42705505 CCAGACAAAAAGGAGCTGCGAGG - Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1148843281 17:50512914-50512936 ACATACAAAAAATAGTTGGGCGG + Intronic
1149340861 17:55684927-55684949 CCAGTGAAATAAGAGTTTGTGGG - Intergenic
1150169737 17:62980759-62980781 CCAGAAAAATAGGAGGTGGTAGG - Intergenic
1150549697 17:66197951-66197973 CCAGAGAAAGAATAGTTGGCTGG + Intergenic
1153596101 18:6726963-6726985 CCAGACAAGAAATAATAGGTAGG + Intergenic
1155059942 18:22219586-22219608 CCAGAAAATGAAGAGTTGGCAGG - Intergenic
1155146656 18:23089426-23089448 AAAAAAAAAAAAGAGTTGGTGGG + Intergenic
1156138958 18:34081770-34081792 CCAGACAAAGGAGAATTGGAAGG + Intronic
1157553329 18:48596396-48596418 CCAGACAAGAAAGAGAAAGTGGG + Intronic
1157749412 18:50164962-50164984 CCAGAAAGAAGAGCGTTGGTGGG - Intronic
1158541723 18:58362346-58362368 ACAAACAAAAAATAGTTGCTGGG + Intronic
1161208057 19:3052340-3052362 CTCAAAAAAAAAGAGTTGGTGGG - Intergenic
1161296104 19:3520959-3520981 CCAGACACAAAAGACCTGGGAGG - Intronic
1162642521 19:12022850-12022872 CCAGAAAAGAAAGATCTGGTGGG - Intronic
1164791691 19:30991030-30991052 TTAGACAAACAAGAGGTGGTAGG + Intergenic
1165106514 19:33472928-33472950 ACAGAAAGAAAAGAGCTGGTTGG + Intronic
1165287003 19:34850950-34850972 CTAGAGAAAAATGAGTAGGTTGG + Intergenic
1166309196 19:41952875-41952897 ACAAACAAACAAGAGTTGCTGGG - Intergenic
925240409 2:2320927-2320949 CCAGACAACAAACAGCTGGATGG + Intronic
925819592 2:7786989-7787011 CCAGTAACAAAAGAGTAGGTAGG + Intergenic
927021843 2:19025335-19025357 ACAAACAAAAAAGAGTAGGGTGG - Intergenic
927145501 2:20162849-20162871 TCAGGCAAAGAAGAGTAGGTGGG - Intergenic
927977740 2:27352223-27352245 TCACACATAAAAGAGTTGGATGG - Intronic
929184841 2:39082878-39082900 CCAAACAACAAAGATATGGTTGG + Intronic
929659442 2:43769338-43769360 TCCTACAAAGAAGAGTTGGTGGG + Intergenic
929977099 2:46645647-46645669 CCAGGCAAAGATGAGTTTGTTGG - Intergenic
930412564 2:51044435-51044457 TCAGACAACCAAGAGTTGCTAGG - Intergenic
930605362 2:53487633-53487655 CCAGAGATAAAAGAGACGGTGGG + Intergenic
933667473 2:84975241-84975263 CCAAAAAAAAAAGTGGTGGTTGG + Intronic
935411527 2:102769349-102769371 CCAAACAAAAAAGAGCTGGAGGG + Intronic
935914659 2:107936051-107936073 CCAAAAAAAAAAAAGTTGGGGGG + Intergenic
935926585 2:108076273-108076295 CCAGTCAAAAAGGAAGTGGTAGG - Intergenic
936008537 2:108910303-108910325 CCAGTCAGCAAAGAGGTGGTGGG + Intronic
936391082 2:112074333-112074355 CCAGACATAAAATTCTTGGTTGG + Intronic
936916373 2:117642985-117643007 TCTGACAAAAAGGAATTGGTTGG - Intergenic
937001000 2:118467541-118467563 CAAGAGAAAAAAGAGTTGAAAGG + Intergenic
937091109 2:119206815-119206837 CCAGGCCAAGAAGAGTAGGTTGG - Intergenic
937486399 2:122319451-122319473 CCAGACAACAAAGAGTTCCAAGG + Intergenic
939740877 2:145903679-145903701 CCAGAAAAAAAAGAGTTTAATGG - Intergenic
940357942 2:152766051-152766073 CCAGCCAAAAATGAGGTGGTGGG - Intergenic
940394212 2:153168969-153168991 CTAGAGAAAAAACAGCTGGTAGG - Intergenic
940951827 2:159683777-159683799 AAAGAGAAAAAAGAGTTAGTAGG - Intergenic
946546097 2:220745670-220745692 ACAGACAGAAAAGAGGAGGTGGG - Intergenic
948249036 2:236510788-236510810 TCAAAAAAAAAAAAGTTGGTGGG - Intergenic
1169287116 20:4318698-4318720 TCAGACAAATAACAGTTGCTAGG - Intergenic
1170479493 20:16751901-16751923 CCAGAAAAAAAAAAGTCTGTAGG + Exonic
1170931143 20:20770370-20770392 CAAGACAAAAAAGAGGGGGGAGG - Intergenic
1171257432 20:23700796-23700818 CAAGACTAAAATGAGTTTGTGGG - Intergenic
1171264850 20:23762955-23762977 CAAGACTAAAATGAGTTTGTAGG - Intergenic
1178268370 21:31166518-31166540 CCAGAGAAGAAAGGGATGGTAGG - Intronic
1179160776 21:38895638-38895660 CAAGGGAAAAAAGAGTTGGAAGG + Intergenic
1179269151 21:39836251-39836273 CCTGAAAAGAAAGAGTTGTTGGG + Intergenic
1184592167 22:45492239-45492261 CCAGAAACAAAAAAGCTGGTAGG - Intergenic
949249185 3:1962262-1962284 CCAGGCAAAAAGCAGTAGGTAGG + Intergenic
950362099 3:12456736-12456758 CCAGGCAATACAGAGGTGGTGGG + Intergenic
951170836 3:19539990-19540012 CCAGAAAAAAAACAGCTGGTGGG + Intergenic
951457759 3:22911728-22911750 TCAGAAAAAAAATCGTTGGTTGG - Intergenic
951692498 3:25411437-25411459 CCATACAAAAAATAGTATGTGGG + Intronic
952848977 3:37712311-37712333 CCAGACACCAAAGGGTGGGTGGG - Intronic
955016901 3:55079239-55079261 CCCGACAACAAAGAATTGTTTGG + Intergenic
956066235 3:65400180-65400202 CCAGGCAGAAAAGTGCTGGTTGG - Intronic
957478659 3:80760980-80761002 CCAGAGAAAAAAGGGATAGTAGG + Intergenic
957590968 3:82197241-82197263 GCAGACAGAAATGAGATGGTAGG + Intergenic
957698304 3:83673704-83673726 CCAGACAATTAAATGTTGGTAGG - Intergenic
959158574 3:102696301-102696323 ACAGACAATTAAGAGTTGGTGGG + Intergenic
962027859 3:131567606-131567628 CCTGACAATGAAGAGTTGATAGG - Intronic
963649056 3:147954248-147954270 CAAGTAAAAAAAGAGTTGCTGGG - Intergenic
964580916 3:158236803-158236825 CCAAACAACAAAGAGGAGGTTGG + Intronic
967689749 3:192460065-192460087 ACTTACAAAGAAGAGTTGGTGGG + Intronic
969010723 4:4059962-4059984 ACAAACAAAAAAAGGTTGGTTGG - Intergenic
970232939 4:13929324-13929346 CCATAAAAAAAAGAAATGGTTGG - Intergenic
972478910 4:39479581-39479603 CAAAACAAAAGAAAGTTGGTAGG - Intergenic
972674270 4:41244254-41244276 CCAGACAAAGAAGTGTGGGAAGG - Intergenic
975292755 4:72696190-72696212 CCAGACAGAAAACTGTGGGTAGG - Intergenic
975891790 4:79038038-79038060 CCAGATAAAATACAGTTTGTAGG - Intergenic
976128774 4:81861394-81861416 CCAGAAAAAATAGAGTAGGAGGG + Intronic
977443705 4:97101750-97101772 CCAGAAAAAAAAGATCTGGAGGG + Intergenic
979130113 4:117033539-117033561 CCATACAAAAAATAGTTCATGGG + Intergenic
986525403 5:8668850-8668872 CCAGACAGAAAAGAATTGCTTGG - Intergenic
986579247 5:9247130-9247152 CCAAACAACAAAGAGTTGCGTGG - Intronic
987950096 5:24663440-24663462 CCAGACAAAATAGAGACAGTAGG - Intergenic
990019402 5:51106814-51106836 ACAGGCAAACAAAAGTTGGTAGG + Intergenic
990276606 5:54203799-54203821 CAAGAACAAAAAGGGTTGGTTGG + Intronic
990312725 5:54555105-54555127 CCAGACAAAGAAGACTTGGAAGG - Intergenic
991619785 5:68533620-68533642 CCAGGCAATAAAGGGTTGGTTGG + Intergenic
992018660 5:72600696-72600718 CCAAACGAAAAAGCGTTGGAGGG - Intergenic
994638787 5:102378619-102378641 CCAGACACAAATGAGTATGTAGG - Intronic
995410815 5:111855237-111855259 CCAAACCAATAAGCGTTGGTAGG - Intronic
995722413 5:115150897-115150919 CCAGGCAAAAACGACTTGATGGG - Intronic
995955241 5:117769473-117769495 CCAGGCAAAAATGAGTTGCTAGG - Intergenic
996532072 5:124536592-124536614 GCAGACAAAAGAGAGTTGTTGGG + Intergenic
996532247 5:124538362-124538384 ACAGACAAAAGAGAGTTGTTGGG + Intergenic
996664623 5:126044348-126044370 CCAGAGAAAGCAGAGTTGCTTGG - Intergenic
998900209 5:146845142-146845164 CCAGCCATACAAGAATTGGTGGG - Intronic
1000455466 5:161443133-161443155 GCTGACAACAAAGATTTGGTGGG - Intronic
1002786647 6:405596-405618 CCAGAAATAAAAGAGGTGCTAGG - Intronic
1002977889 6:2103480-2103502 CCAGAAAAAAAATAGAGGGTAGG + Intronic
1003072065 6:2952731-2952753 CCAGAAAGAAAGGAGTGGGTAGG + Intronic
1007280430 6:40708387-40708409 CCAGAAGAAAAAGAGGTGGAGGG + Intergenic
1010053633 6:71537946-71537968 CCAGCCAAAAAGCAATTGGTTGG + Intergenic
1011710030 6:90043713-90043735 CCAGACAGAGAAGAGTAGGCAGG - Intronic
1012224992 6:96693924-96693946 CCAGGCAAAAAAGACTTGCTAGG - Intergenic
1013908741 6:115248524-115248546 CCAGACAAACAAAAGCTGGGAGG + Intergenic
1017645367 6:156535101-156535123 CCAGCCAAAAAAAATTTGTTTGG - Intergenic
1019748368 7:2713239-2713261 CCAGAAAAAAAAAAGTTCTTTGG + Exonic
1020339754 7:7097119-7097141 CCAAAGAAAAAAGAGAAGGTTGG + Intergenic
1020499943 7:8905055-8905077 TCAGACAAAAAACAGTTTCTTGG + Intergenic
1020574199 7:9904418-9904440 CCAAACAAATAAGACTTGGGGGG - Intergenic
1023216234 7:37866059-37866081 CCAGACAAAAAAGAGTTGGTGGG - Intronic
1024035658 7:45505797-45505819 CCACATAGAAAAGAGTTGGGGGG - Intergenic
1024143900 7:46491550-46491572 CCAGACAATAAGGACTTTGTGGG + Intergenic
1025298363 7:57795078-57795100 CCATACAAAAATTAGTTGGGTGG - Intergenic
1026175512 7:67993272-67993294 CCAGGCAAAAAATAGGTGGCAGG - Intergenic
1026700152 7:72634171-72634193 CCAGAAAAAAAAAAGGAGGTGGG - Intronic
1027201241 7:76065099-76065121 CCCGAGAAAAAAGAGCTGGGAGG + Intronic
1027737048 7:81945653-81945675 CCAGAGGAAAAAAAGATGGTAGG + Intergenic
1027753793 7:82185455-82185477 TCAGACAAAAAAGAGAGGGGGGG + Intronic
1027811116 7:82900699-82900721 CCAGAAAAAAAATAAATGGTGGG + Intronic
1028668571 7:93374644-93374666 ACAGAAAACAGAGAGTTGGTTGG - Intergenic
1030144521 7:106340183-106340205 CCAAACAAAATGGAGTTGCTTGG + Intergenic
1030591082 7:111482665-111482687 GCAGAGAAGAAAGAGATGGTAGG - Intronic
1030740538 7:113103790-113103812 TCAGACAATAAAGAGTGGGGGGG + Intergenic
1030787300 7:113678119-113678141 ACAGACATCAAAGAGTAGGTGGG - Intergenic
1031544369 7:123033773-123033795 CTAGACAGAAAAGAGTAGGAGGG + Intergenic
1031820988 7:126501350-126501372 TCAAACAAAAAATAGTTGGAAGG + Intronic
1033198048 7:139343935-139343957 AAAAAAAAAAAAGAGTTGGTGGG + Intronic
1034473709 7:151270529-151270551 CAAGACAGAAGAGAGTGGGTGGG + Intronic
1036287764 8:7459738-7459760 ACAGACACCAAAGAGATGGTGGG + Intronic
1036333712 8:7851790-7851812 ACAGACACCAAAGAGATGGTGGG - Intronic
1037270846 8:17128754-17128776 CCAGACAAAAAAGAGTTGCATGG + Intergenic
1042161321 8:65898840-65898862 CCAGACATAAAACAATGGGTGGG - Intergenic
1042207364 8:66343008-66343030 CTGGGCCAAAAAGAGTTGGTTGG - Intergenic
1042219398 8:66458802-66458824 ACAGAAAAAAAAGAGATGGTAGG - Intronic
1044819396 8:96145443-96145465 TCAGACAAAGAAGAGCTGGTGGG - Exonic
1045911509 8:107416014-107416036 GCAGAGAAAAGAGAGTTTGTGGG - Intronic
1046229801 8:111338906-111338928 CCAGAGAAAAGAGAGTTGCTTGG + Intergenic
1050397887 9:5218989-5219011 CCAGAGAACAAAGAGAGGGTTGG - Intergenic
1051201613 9:14633087-14633109 CCACACAAAAACGTGTAGGTGGG + Intronic
1052820127 9:33131839-33131861 CCTGAAAAAAAAGAGGTGGAAGG - Intronic
1054149938 9:61593905-61593927 CCATACAAAAATTAGTTGGGTGG - Intergenic
1054469705 9:65525008-65525030 CCATACAAAAATTAGTTGGGTGG - Intergenic
1055222620 9:73955311-73955333 CAACACAACAAAAAGTTGGTTGG + Intergenic
1056177230 9:84046899-84046921 GAAGATAAAAAAGAGTTGCTTGG - Intergenic
1056463178 9:86827824-86827846 CCAGACAAAAAGTACATGGTGGG - Intergenic
1059155776 9:111987166-111987188 CCAGGCAAAGATGAGGTGGTAGG + Intergenic
1060347018 9:122826111-122826133 CAAAACAAAAAAAAGGTGGTGGG + Intronic
1203714767 Un_KI270742v1:133631-133653 CCAGAAAAGAAAGATCTGGTGGG + Intergenic
1186803034 X:13112651-13112673 ACTGGCAAAAAAAAGTTGGTGGG + Intergenic
1186940825 X:14505768-14505790 CCAGATAAAGCAGAGTTGCTGGG + Intergenic
1189849965 X:45168402-45168424 CCACATAAAACAGAGTTGGTGGG + Intronic
1192274121 X:69612647-69612669 CCAGACAAACAAAAGTAGGAAGG + Intergenic
1193115206 X:77769260-77769282 ACAAACAAAAAACAGTTTGTGGG - Intronic
1194461304 X:94172605-94172627 AAATACAAAAAAGTGTTGGTTGG - Intergenic
1196666921 X:118326774-118326796 CCAGACTAAAAAGAGGAGGAAGG - Intergenic
1196948361 X:120850722-120850744 CCAGACAAAAATGGCTTGCTAGG + Intergenic
1198053023 X:132967011-132967033 CAAGACAAAAAAGAATGGGTGGG - Intergenic
1198504579 X:137289089-137289111 CTAAACAAAAAAGGGTGGGTGGG - Intergenic
1199645164 X:149902177-149902199 CCACAAAAAAAAAATTTGGTTGG + Intergenic
1200781226 Y:7217830-7217852 CAAGAAAAAAAAAAGTGGGTAGG + Intergenic
1201548006 Y:15187701-15187723 CCAGACAAAGAAAAGTTAGGGGG - Intergenic