ID: 1023216262

View in Genome Browser
Species Human (GRCh38)
Location 7:37866397-37866419
Sequence CTTTCTACACACATGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023216262 Original CRISPR CTTTCTACACACATGGAAGC CGG (reversed) Intronic
901171829 1:7264476-7264498 CCTTTTGCACACATGAAAGCAGG - Intronic
902179567 1:14677718-14677740 CTCTCTTCACAGATGGGAGCAGG - Intronic
902787567 1:18742929-18742951 CATTCTGCAGACAAGGAAGCAGG + Intronic
903175109 1:21575965-21575987 CTGTCTACCCACCTGGGAGCAGG + Intronic
904564632 1:31421273-31421295 CTTTTTCCACAGATGGCAGCAGG - Intronic
904568492 1:31442959-31442981 CCTTTTACAGACAAGGAAGCTGG - Intergenic
905771293 1:40639615-40639637 CATTCTACAAACAAGGCAGCAGG + Intronic
911473866 1:98352297-98352319 GATTCCACACCCATGGAAGCAGG - Intergenic
911818715 1:102388287-102388309 CTTTCTGCTCACATGGAATTTGG + Intergenic
913527539 1:119708627-119708649 TTCACTACACACAAGGAAGCAGG + Intronic
916459112 1:165004127-165004149 CTTTTTGCACAAATGGAAGAGGG + Intergenic
917969132 1:180196159-180196181 CTTTCTGCAGACAAGGAAGCTGG + Intronic
918146392 1:181759647-181759669 CTTGCTGCACACAATGAAGCAGG - Intronic
922691235 1:227693225-227693247 CTTCCTACACAGACTGAAGCAGG - Intergenic
922739925 1:228009036-228009058 CTTTGGCCACACAGGGAAGCGGG + Intronic
924458672 1:244238822-244238844 CTTTCTTCACTAATGGAAGAAGG - Intergenic
1065785671 10:29211749-29211771 CTTTTTACATATATGGAAGAGGG + Intergenic
1065866703 10:29920839-29920861 TTTTCCTCCCACATGGAAGCTGG + Intergenic
1068648993 10:59500780-59500802 CCTTCTGCATACAGGGAAGCTGG - Intergenic
1071458209 10:85867518-85867540 ATTTCCACCCACATGGAGGCTGG + Intronic
1071558028 10:86621135-86621157 TTTTCTACACACAGGGCAGCAGG + Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1078987841 11:16612558-16612580 CTTTTTAAACACATTGAGGCGGG + Intronic
1080421391 11:32114045-32114067 CTTTTAATTCACATGGAAGCTGG + Intergenic
1080775934 11:35386792-35386814 CATTTTACAAACATGGAAACTGG + Intronic
1082299975 11:50493671-50493693 CATTCTTCACACATAGACGCTGG - Intergenic
1087534937 11:99431314-99431336 CTTTCTACCAACATAGAAGGAGG + Intronic
1087945221 11:104151312-104151334 CTTTACACACGCATGCAAGCTGG + Intronic
1088125176 11:106415709-106415731 CTTTCTACACCTCTGAAAGCAGG - Intergenic
1088933811 11:114378701-114378723 CTTTCTACAGACTAGGAAACAGG - Intergenic
1088969286 11:114758062-114758084 CTTTCTACACCTGTGGAGGCTGG - Intergenic
1091902179 12:4153287-4153309 CTTTCTACTCATCTGGAAACTGG + Intergenic
1092528119 12:9322812-9322834 CTTGCTTCTCCCATGGAAGCAGG + Intergenic
1092539150 12:9408949-9408971 CTTGCTTCTCCCATGGAAGCAGG - Intergenic
1092833958 12:12470575-12470597 TTTTCTACAGACAGGGAAGCAGG - Intergenic
1098234478 12:68405718-68405740 ATTTCTTCACACAAGGAAGGAGG + Intergenic
1099037987 12:77613988-77614010 CTTTCAACACATATGGATGTGGG + Intergenic
1100618301 12:96248597-96248619 CATTTTCCACACATGGAACCTGG - Intronic
1100930078 12:99598453-99598475 CATTCTACAGATATGGAAACAGG + Intronic
1101983774 12:109429934-109429956 CCATCTACAAACAAGGAAGCTGG - Intronic
1103163649 12:118752038-118752060 CTTTCTATAGACAAGGAAACTGG + Intergenic
1106172370 13:27299020-27299042 CTTTCTGAACACCAGGAAGCTGG - Intergenic
1106665580 13:31847167-31847189 CTTTCAACCCACATGGAGGCAGG - Intergenic
1109835267 13:67849066-67849088 CATCTTACACACATGGTAGCAGG + Intergenic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1112910411 13:104476005-104476027 CCTTCTACATACCTGGATGCTGG + Intergenic
1113044638 13:106142236-106142258 CTTTCTACAAACCAGGAAGCAGG + Intergenic
1113593488 13:111516250-111516272 TTTTCCACACACATGTAAACAGG + Intergenic
1114584535 14:23798279-23798301 CTGTCTCCTCACATGGAAGAAGG - Intergenic
1120227122 14:81803348-81803370 ATTTGTAGACAGATGGAAGCTGG - Intergenic
1120830798 14:88995864-88995886 CTGTTTACATACCTGGAAGCTGG - Intergenic
1121508277 14:94492986-94493008 TGTTCTACACACATGTAAGTTGG + Intronic
1124839541 15:33229014-33229036 CTTTGTACTCACATGGCAGAAGG + Intergenic
1125910542 15:43434643-43434665 CTGTCTACAAACCAGGAAGCAGG + Intronic
1126490475 15:49230833-49230855 AATTCTACAAACATGGAAGTGGG + Intronic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1134410258 16:13998061-13998083 CATTCTAGACACAGGGAAACAGG + Intergenic
1139160673 16:64504358-64504380 CATTCTACACAGATTGAATCAGG - Intergenic
1139934749 16:70561369-70561391 CATTTTACACACGTGGAAGCAGG + Intronic
1147195672 17:38765113-38765135 CGTTCTACACAGCTGGAGGCGGG + Intergenic
1149975503 17:61261876-61261898 ATTTAAAGACACATGGAAGCTGG + Intronic
1153512549 18:5871234-5871256 CTTTCTGAACACAAAGAAGCCGG - Intergenic
1155606357 18:27610628-27610650 CTATGCACACAAATGGAAGCAGG + Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1158735145 18:60070990-60071012 CTTTCTACAATCCTTGAAGCTGG + Intergenic
1159156063 18:64584280-64584302 ATTTCAACAAACATGAAAGCTGG - Intergenic
1160662338 19:306894-306916 CATTCTCCACAAATGGGAGCAGG - Intronic
1164566595 19:29330236-29330258 CTTTCCATAAACATGGAAGGGGG - Intergenic
1165138608 19:33686131-33686153 CTCTCTATACCCAGGGAAGCTGG - Intronic
1165462005 19:35949473-35949495 CTTATTACAAATATGGAAGCAGG + Intergenic
1166973550 19:46588687-46588709 CCTTCTACACATATGAAAGCTGG + Intronic
1167877103 19:52423336-52423358 ATTTCTTTACACATGAAAGCTGG - Intergenic
1167952715 19:53040152-53040174 CCTTCTACTGTCATGGAAGCAGG + Intergenic
925528141 2:4827241-4827263 CTTTCTAAAGAAATGGAAGTAGG + Intergenic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
929835572 2:45394070-45394092 CTTTCTTCCAAAATGGAAGCAGG + Intronic
933534241 2:83552294-83552316 CTTTGCAGAAACATGGAAGCTGG - Intergenic
934544127 2:95200516-95200538 CTTTCTTCACACACGGACACAGG - Intergenic
937702094 2:124874696-124874718 CTTTTTAAACATATGGAAACAGG + Intronic
938961334 2:136344324-136344346 GTTTCCACACTCATGGAAGTTGG + Intergenic
939862279 2:147434625-147434647 CTGTCTACAAACCAGGAAGCAGG - Intergenic
940479879 2:154214666-154214688 CCTTCTTCACACATGGCGGCAGG - Intronic
940885050 2:158982427-158982449 CATTCTACAGACATAGAAACAGG - Intronic
941983690 2:171488786-171488808 CTTTCTACAGAAATTGAAACAGG - Intergenic
942180600 2:173376973-173376995 ATTTCTGCAAACATGGAAGTTGG + Intergenic
945137574 2:206644659-206644681 CTTTCAAAAGACATGGGAGCTGG - Intergenic
945470472 2:210223402-210223424 CCTTCCACACACCTAGAAGCTGG + Intronic
948942008 2:241201420-241201442 CTTTCTGCATCCATGGAGGCTGG - Intronic
949024101 2:241757181-241757203 CCTTTTACACACATGTAAACAGG + Intronic
1169966578 20:11224488-11224510 CTTTCTACCCATATGGAAAAAGG - Intergenic
1170137035 20:13086231-13086253 CTTTCTACAAACATTGATTCAGG - Intronic
1170192141 20:13654863-13654885 CTAACAACACTCATGGAAGCTGG + Intergenic
1170860295 20:20096681-20096703 CTTTCTGCACATATGGTAGATGG + Intronic
1172239018 20:33399662-33399684 TTTTCCACAGACATGGAAGCAGG + Intronic
1173945017 20:46943601-46943623 CATGCTACACACAGGCAAGCTGG - Intronic
1173950866 20:46992451-46992473 CATTTTACAGACATGGAAGTTGG + Intronic
1177671301 21:24232770-24232792 CTTTCTAAACGTTTGGAAGCTGG + Intergenic
1179035036 21:37752385-37752407 ATTTCTATACACATGGCGGCTGG + Intronic
1180209168 21:46284101-46284123 CTTTATTCACACCTGGAATCCGG + Exonic
1181129320 22:20721129-20721151 CTTTCAGCACACAGGGGAGCAGG - Intronic
1183122538 22:35741246-35741268 CTTTCTGTACTCTTGGAAGCTGG - Intronic
1183397481 22:37580269-37580291 CTTTTTACAGGCAAGGAAGCTGG - Intronic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
955001992 3:54935973-54935995 CCTGCTAAACACATGGAATCTGG + Intronic
955456915 3:59132328-59132350 CTTTCTAAACACTTTGAATCTGG + Intergenic
955474109 3:59317770-59317792 CTTTCTACAGAAATCTAAGCTGG - Intergenic
957472119 3:80671232-80671254 CTTTATCCCCACATGTAAGCTGG - Intergenic
959190853 3:103109059-103109081 CTTTCTACACACAAGTAAACCGG - Intergenic
960166101 3:114403229-114403251 CTTTCTTCACAGAAGGGAGCTGG + Intronic
962428796 3:135300505-135300527 ATTTATACACACATTAAAGCTGG - Intergenic
962687485 3:137861582-137861604 CTTTCTAATCACATACAAGCTGG - Intergenic
962781694 3:138724676-138724698 CTTTCAAGACCCATGGAATCTGG - Intronic
966283356 3:178262383-178262405 CTTTCAACAAACATGTAACCAGG - Intergenic
969218334 4:5741396-5741418 TTTTCTTCACACATGGAAATGGG + Intronic
970689695 4:18608354-18608376 GTTCCTTCACACATGGAAACTGG - Intergenic
971336813 4:25730714-25730736 CTTTTAACACCCATGAAAGCCGG - Intergenic
975766866 4:77677666-77677688 CATTTTACAGACATGGAAACTGG - Intergenic
976051432 4:81015678-81015700 CATCTTACACAGATGGAAGCAGG + Intergenic
978032093 4:103947679-103947701 CCTTCTATCCTCATGGAAGCAGG - Intergenic
978119172 4:105057691-105057713 CTTTCTACAGACATGGAAACTGG + Intergenic
981089626 4:140719444-140719466 TTTTCTACAGAGAAGGAAGCTGG + Intronic
984449783 4:179884918-179884940 CTTTCTTTACACATGGAAGCAGG + Intergenic
985369001 4:189265425-189265447 GACTCTACATACATGGAAGCAGG - Intergenic
990994469 5:61717668-61717690 GGTTCTAGACACATGGTAGCTGG - Intronic
994109859 5:95989401-95989423 CTTTCTACTCACTGGGGAGCTGG - Intergenic
996556400 5:124783260-124783282 TTTTCTCCACACTTGGAATCTGG + Intergenic
996783361 5:127212705-127212727 CTTTCTTCATAGATGGTAGCTGG + Intergenic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
1002195828 5:177500783-177500805 CTCCCTCCACACATGGAATCTGG - Intergenic
1002352703 5:178594320-178594342 GTTTCCCCACACATGGATGCTGG - Intergenic
1002370120 5:178745339-178745361 CTTTCTTCATAGATGGTAGCTGG - Intergenic
1005256498 6:24008874-24008896 CATCCTACACACAAGAAAGCTGG + Intergenic
1005352681 6:24951836-24951858 CTTTCTACACACTGGGATGAGGG + Intronic
1005380484 6:25229311-25229333 CTGTCTACAAACCAGGAAGCAGG + Intergenic
1006454409 6:34123712-34123734 CATTTTACACACAAGGAAACGGG + Intronic
1009665089 6:66667590-66667612 CTTTCAAAATTCATGGAAGCTGG - Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1011527819 6:88284958-88284980 GTATCTACACACCTAGAAGCGGG + Intergenic
1011578445 6:88829629-88829651 CTTTGCACACACATAGGAGCTGG - Intronic
1011707707 6:90019478-90019500 CATTTTACAAACATGGAAGCAGG - Intronic
1012071063 6:94617149-94617171 CATTCTACATAAATGGAACCAGG + Intergenic
1012527448 6:100195459-100195481 CTTTGTACAGACATGGATGAAGG + Intergenic
1016922779 6:149312657-149312679 GTTTCAAAACACATGGAGGCAGG - Intronic
1017819475 6:158038946-158038968 CTTCCTGCACACATGGGACCAGG + Intronic
1023216262 7:37866397-37866419 CTTTCTACACACATGGAAGCCGG - Intronic
1023219585 7:37905619-37905641 CTTCCTACACTCCTGGCAGCTGG - Intronic
1023576768 7:41636215-41636237 CATTTTACACACAAGGAAACTGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1030131888 7:106208689-106208711 CATTTTATACACATGGAAACAGG - Intergenic
1035475198 7:159138681-159138703 CCTTCCAGACACGTGGAAGCTGG - Intronic
1035729700 8:1845414-1845436 CTTCCCACACACATGTAAGATGG + Intronic
1035875914 8:3189469-3189491 CTTTCCACACAAAATGAAGCAGG + Intronic
1045289055 8:100816238-100816260 ATTTCCACAGACATAGAAGCTGG - Intergenic
1046204505 8:110975290-110975312 CTTTCTAAACAGATTCAAGCAGG - Intergenic
1052771914 9:32697771-32697793 ATTTCTGCACACTTGGCAGCAGG + Intergenic
1055372423 9:75614294-75614316 CTTTCCACAGACATGAAAGGTGG + Intergenic
1056885960 9:90444097-90444119 CTGTGGTCACACATGGAAGCTGG - Intergenic
1057201321 9:93141900-93141922 CTTTCTACAGACGGGGAAACTGG + Intergenic
1061619304 9:131801095-131801117 CTTTCTAAAAGCATAGAAGCTGG - Intergenic
1061713005 9:132500316-132500338 CATTCTACAGATGTGGAAGCTGG - Intronic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1187162058 X:16774037-16774059 CTTTCCTCAGACCTGGAAGCAGG + Intergenic
1187208329 X:17204182-17204204 CTTTTTACAGATATGGAAACAGG + Intergenic
1187327378 X:18303748-18303770 CTTCCTAGACTTATGGAAGCAGG + Intronic
1192185911 X:68946755-68946777 CTTTCTCCCAACATGGAGGCAGG - Intergenic
1194755472 X:97733876-97733898 ACTTCTACAGACAGGGAAGCAGG + Intergenic
1196782163 X:119393285-119393307 CTTCTTACACAGATGGCAGCAGG + Intergenic
1199286332 X:146058682-146058704 CCTTGTACACACATGGTAACAGG - Intergenic
1201409656 Y:13686654-13686676 CTCTCTATAGTCATGGAAGCAGG + Intergenic