ID: 1023224854

View in Genome Browser
Species Human (GRCh38)
Location 7:37958694-37958716
Sequence GGTCCAGCAGAGCCCACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023224854_1023224858 1 Left 1023224854 7:37958694-37958716 CCCTCAGTGGGCTCTGCTGGACC No data
Right 1023224858 7:37958718-37958740 GTCAGCTAAACCATTCCCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023224854 Original CRISPR GGTCCAGCAGAGCCCACTGA GGG (reversed) Intronic