ID: 1023224854 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:37958694-37958716 |
| Sequence | GGTCCAGCAGAGCCCACTGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1023224854_1023224858 | 1 | Left | 1023224854 | 7:37958694-37958716 | CCCTCAGTGGGCTCTGCTGGACC | No data | ||
| Right | 1023224858 | 7:37958718-37958740 | GTCAGCTAAACCATTCCCTAAGG | 0: 1 1: 0 2: 0 3: 8 4: 73 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1023224854 | Original CRISPR | GGTCCAGCAGAGCCCACTGA GGG (reversed) | Intronic | ||