ID: 1023225050

View in Genome Browser
Species Human (GRCh38)
Location 7:37960456-37960478
Sequence TAAAGGGCACCTCGTCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023225050_1023225055 28 Left 1023225050 7:37960456-37960478 CCTCTTTGACGAGGTGCCCTTTA 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1023225055 7:37960507-37960529 TTGTCAGGAGAAGATCCAATAGG No data
1023225050_1023225054 13 Left 1023225050 7:37960456-37960478 CCTCTTTGACGAGGTGCCCTTTA 0: 1
1: 0
2: 0
3: 16
4: 145
Right 1023225054 7:37960492-37960514 ATGTCAGAAAGAAGCTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023225050 Original CRISPR TAAAGGGCACCTCGTCAAAG AGG (reversed) Intronic
900530956 1:3152973-3152995 TAAAGGGCCCCTAGTCAGGGAGG + Intronic
901872618 1:12146922-12146944 CAAAGGGCACCTTCTCAAAGAGG - Intergenic
902620800 1:17649771-17649793 TAAATGCCACCTCCTCCAAGAGG - Intronic
904052946 1:27651241-27651263 TAAATGTCACCTCTGCAAAGAGG - Intergenic
905831958 1:41076627-41076649 TAAATGTCATCTCCTCAAAGAGG - Intronic
906100330 1:43256218-43256240 TAAAGGGCACTTCTTCAGAAAGG + Intronic
906456246 1:45999712-45999734 TAAATGTCACCTCCTCAGAGAGG + Intronic
906683569 1:47748069-47748091 TAAACGTCACCTTCTCAAAGAGG - Intergenic
907561829 1:55398115-55398137 CAAATGCCACCTCATCAAAGAGG - Intergenic
909586250 1:77291913-77291935 TAAAGGCCACCTCCTGCAAGAGG - Intronic
911143465 1:94530605-94530627 TAAAGGGCATCTAGTCAACTTGG + Intronic
911551175 1:99282821-99282843 TAAATGGCACCTACTCAAATAGG + Intronic
915424002 1:155808597-155808619 TAAATGCCATCTCCTCAAAGAGG + Intronic
918525803 1:185463574-185463596 TAAATGTCACCTCTTCAGAGAGG + Intergenic
920832754 1:209480267-209480289 TAAATGGCACTTCCTCATAGTGG - Intergenic
923319947 1:232821298-232821320 TAAATGTCACCTCTTCAGAGAGG + Intergenic
1063852386 10:10207666-10207688 TAAATGCCACTTCCTCAAAGTGG + Intergenic
1072292411 10:93976331-93976353 TAAATGGCATCTCCACAAAGAGG - Intergenic
1072685955 10:97537077-97537099 TAAAGAGCACCTCCTCAGACAGG - Intronic
1077922227 11:6650287-6650309 GAAAGGGCACCTCCTCCAGGAGG - Intronic
1080687604 11:34528229-34528251 CAAAGGTCACCTCTTCAGAGAGG - Intergenic
1086299392 11:85409359-85409381 TCAAGGTCACCTTGCCAAAGTGG - Intronic
1087404135 11:97708625-97708647 TAATAGGCACCCCCTCAAAGAGG - Intergenic
1091327949 11:134705975-134705997 GAAAGGGCTCCTCTTCACAGAGG - Intergenic
1091597178 12:1885982-1886004 TAAAGGGATCCTCGTCCAGGCGG - Exonic
1093427181 12:19041271-19041293 TAAAGGGTACCTCTTCAAGATGG - Intergenic
1093545347 12:20338579-20338601 TACAGGTTACCTCCTCAAAGGGG + Intergenic
1095254262 12:40015560-40015582 CAGAGGGCACCTCATCAAAAGGG + Intronic
1099796513 12:87407889-87407911 TAAATGGTAACTCCTCAAAGTGG + Intergenic
1101710151 12:107257367-107257389 AAAAGGGCACCTCATCTGAGTGG + Intergenic
1102577500 12:113865321-113865343 GAAATGCCACCTCCTCAAAGAGG + Intronic
1102817915 12:115883130-115883152 TAAATGGCACTTTGTCAAGGGGG + Intergenic
1103253946 12:119524103-119524125 TAAAAGTCACCTCCTCAGAGAGG - Intronic
1107646589 13:42500349-42500371 CAAATGGCACCTCCTCAAGGAGG + Intergenic
1107906329 13:45064633-45064655 TAAATGTCACTTCATCAAAGAGG + Intergenic
1108151542 13:47541014-47541036 TAAAAGGCACATGGTCACAGAGG - Intergenic
1114418553 14:22560222-22560244 TAAAGGTCACCTGGTCAGAGAGG + Intergenic
1117663444 14:58032114-58032136 TAAAGGGCCCTTCGTCGGAGAGG + Intronic
1118358927 14:65039511-65039533 TACAGGGAACCTCCACAAAGTGG - Intronic
1119512718 14:75224063-75224085 TAAAGGTCACCTTCTCAGAGAGG + Intergenic
1122933338 14:104944773-104944795 CAAAGGGCACCTGCCCAAAGTGG - Exonic
1129638336 15:77346994-77347016 TAAATGTCCCCTCTTCAAAGAGG - Intronic
1131669611 15:94605915-94605937 GAAATGGCACTTCATCAAAGAGG + Intergenic
1134355061 16:13474727-13474749 TAAAAGGCACCTCCTCAGAGAGG - Intergenic
1137260396 16:46823125-46823147 TAAATGTCACCTCCTCATAGGGG + Intronic
1137565506 16:49530283-49530305 TAAAGGACACCTCCTCAGGGAGG + Intronic
1138123172 16:54416821-54416843 TAAATGACACCTCCTCAGAGTGG + Intergenic
1139496843 16:67326436-67326458 TGAAGACCACCCCGTCAAAGGGG + Intronic
1140263042 16:73397200-73397222 TAAATGTCACCTCCTCAGAGAGG - Intergenic
1141726440 16:85792318-85792340 TAAGGGCAACCTCTTCAAAGAGG - Intronic
1142129232 16:88425217-88425239 TAAAGGCCACCTCCTCCAGGAGG + Intergenic
1146367187 17:32238316-32238338 TAAATGTTACCTCCTCAAAGTGG + Intronic
1147972906 17:44229386-44229408 TAAAGGGCTTCATGTCAAAGAGG + Intergenic
1148464256 17:47855606-47855628 TACAGGGGACCTCCACAAAGAGG - Intronic
1148791769 17:50177179-50177201 CAAAGGGCACCTCCTCAGAGAGG + Intergenic
1150318234 17:64187815-64187837 CAAAAGTCACCTCCTCAAAGAGG + Intronic
1151101498 17:71561290-71561312 GACAGGGCACCTCATCCAAGTGG - Intergenic
1154041320 18:10859133-10859155 TAAATGTCACCTCCTCAGAGAGG - Intronic
1156442905 18:37209573-37209595 TAAATGTCACCTCCTCAAAGAGG - Intronic
1162314854 19:9932561-9932583 TAAATGTCACCTCCTCCAAGAGG - Intronic
1162362745 19:10229718-10229740 TAAAGGTCACTTCCTCAGAGGGG + Intronic
1167537673 19:50065451-50065473 TACAGGTCACCTCCTCCAAGTGG - Intergenic
927552542 2:24011861-24011883 TAAATGTCACCTCCTCCAAGAGG - Intronic
931926607 2:67080105-67080127 GAAAGGGGACCTCTTAAAAGAGG - Intergenic
932980871 2:76664364-76664386 TAAAGGCTACCTTTTCAAAGAGG + Intergenic
938452176 2:131431209-131431231 TAAAAGGCACCTCCTCAAAAAGG - Intergenic
939860808 2:147417819-147417841 CAAAGGTCATCTCCTCAAAGAGG + Intergenic
942944730 2:181659757-181659779 TAAAGGCCACCACCTCAAAGAGG + Intronic
944422332 2:199544639-199544661 GAAAGGGCACCTCTTGAATGAGG - Intergenic
944456303 2:199898302-199898324 GAAAGGGCACCTCTTTAAACTGG + Intergenic
946074619 2:217063727-217063749 CAAAGGTCACCTCTTCAGAGAGG - Intergenic
948428111 2:237901448-237901470 TAAATGTCACGTCCTCAAAGAGG - Intronic
1168856813 20:1014407-1014429 CAAATGTCACCTCCTCAAAGAGG + Intergenic
1170381532 20:15765074-15765096 CAAATGGCACTTCCTCAAAGAGG + Intronic
1170442553 20:16393797-16393819 TAAATGTCACTTCCTCAAAGAGG - Intronic
1172440877 20:34965713-34965735 CAAATGTCACCTCCTCAAAGGGG - Intergenic
1172622418 20:36328237-36328259 TAAAGTGCACATTGGCAAAGTGG + Intronic
1177130853 21:17253265-17253287 TAAATGTCACCTCTTCAAACGGG + Intergenic
1183792536 22:40084593-40084615 TAAATAGCACCTCCTCAGAGAGG - Intronic
1183853080 22:40608445-40608467 AAAAGGTCACCTGGCCAAAGGGG - Intronic
1184305838 22:43601109-43601131 TAATTGGCATCTCTTCAAAGAGG - Intronic
950735798 3:15007090-15007112 TAAATGTCACCTTGTCACAGAGG + Intronic
951500352 3:23379755-23379777 TAAAGGTCACCTCCTCAGAGAGG - Intronic
952850258 3:37722199-37722221 TAAATGGTACCTCCTCAAAAGGG + Intronic
953781428 3:45874515-45874537 TAAATGTCACCTCCTCAGAGAGG + Intronic
955641219 3:61087101-61087123 TCAATGTCACCTCTTCAAAGAGG + Intronic
956726341 3:72159579-72159601 TAAATGGCACCTTCTCAGAGAGG - Intergenic
961697883 3:128718704-128718726 AAAAAGGCACCTCCTCAGAGAGG + Intergenic
961742529 3:129041689-129041711 CACAGGGCACCTCATCACAGGGG + Intergenic
962958714 3:140290453-140290475 CAAAGGGCACCCCATCTAAGAGG - Intronic
962994497 3:140612006-140612028 TAAAGTTCACCTCTTCAAAGAGG + Intergenic
963519856 3:146350010-146350032 CAAAGGGCACCTCCTAAGAGTGG - Intergenic
964434232 3:156635231-156635253 TAAATGTCACCTCCTCAGAGAGG + Intergenic
966086472 3:176073423-176073445 TAAAGGGCATCTACTCAAATGGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
972663910 4:41145379-41145401 GAAAGAGCACTTGGTCAAAGTGG - Intronic
975378572 4:73672341-73672363 TAAAGAGCACATGGTCAAATTGG + Intergenic
976605175 4:86975932-86975954 AAAATGTCACCTCCTCAAAGAGG - Intronic
979503160 4:121462862-121462884 TAGAGGGCACTTGTTCAAAGAGG + Intergenic
981527208 4:145718915-145718937 TAAATGTCACCTCTTCAGAGAGG + Intronic
986076844 5:4346777-4346799 TAAATGTCACCTTGTCATAGAGG - Intergenic
988414309 5:30926850-30926872 AAAAGGGCACATATTCAAAGAGG - Intergenic
989668467 5:43885826-43885848 TAAAGAGCACCTTTACAAAGGGG - Intergenic
991292633 5:65047411-65047433 TAAATGTCACCTCCTCAGAGAGG + Intergenic
993049067 5:82904492-82904514 GAAGGGACACCTCATCAAAGAGG - Intergenic
995755818 5:115502938-115502960 TAAATGTCACCTCCTCAGAGGGG + Intergenic
997729026 5:136151362-136151384 CAAAGGTCACCTCCTGAAAGAGG - Intronic
998603703 5:143612044-143612066 TAAAGGGCACTTCACAAAAGAGG - Intergenic
999774924 5:154804403-154804425 TAAAGGGACCCTCATCTAAGAGG + Intronic
1000231496 5:159319665-159319687 TAAATGTCACCTCCTCAGAGAGG + Intronic
1001374890 5:171246721-171246743 TCAAGGGCATCTTGACAAAGTGG + Intronic
1001947794 5:175795193-175795215 CAAATGTCACCTTGTCAAAGAGG - Intergenic
1010051964 6:71515398-71515420 TAAAGGGCAATTCTTGAAAGAGG + Intergenic
1010662760 6:78589895-78589917 GAAATGTCACCTCCTCAAAGAGG - Intergenic
1011013264 6:82726091-82726113 CAAATGTCACCTCCTCAAAGAGG - Intergenic
1011750599 6:90451117-90451139 TCAAGGTCACCTCCTTAAAGAGG - Intergenic
1011754047 6:90481256-90481278 TAAAGGACTACTCGTTAAAGCGG - Intergenic
1014622859 6:123691172-123691194 TGAAAGGCACCTTGTCAGAGAGG + Intergenic
1018976284 6:168569848-168569870 TAAACGGGACTTCCTCAAAGTGG - Intronic
1019004801 6:168787728-168787750 GACAGGGGACCTCGGCAAAGAGG - Intergenic
1019540562 7:1549423-1549445 TTAAGGGCACCTGGGCCAAGGGG - Intronic
1019890441 7:3941746-3941768 TAACGTCCACTTCGTCAAAGAGG - Intronic
1021078975 7:16340435-16340457 TAAAAGACACCTCACCAAAGAGG + Intronic
1022011350 7:26310540-26310562 TAAAGGCCACCTCCCCAAAGAGG - Intronic
1022164616 7:27745102-27745124 TAAAGTGCACCTCTACAAACAGG - Intronic
1022547899 7:31206008-31206030 TATAGGGAACCTCTTCAAAATGG - Intergenic
1022606248 7:31817218-31817240 TAAATGTCACCTTGTCAAGGAGG - Intronic
1022834763 7:34102927-34102949 TACAGGGCACCTCATCCCAGAGG - Intronic
1023111297 7:36813549-36813571 TAAAGGTCACCTTCTCAAAGAGG + Intergenic
1023225050 7:37960456-37960478 TAAAGGGCACCTCGTCAAAGAGG - Intronic
1023616984 7:42029733-42029755 TAAATGTCACCTCCTCAGAGGGG + Intronic
1028604745 7:92643556-92643578 TAAATGTCACCTCCTTAAAGAGG - Intronic
1028876266 7:95826756-95826778 TAAATGTTACCTCCTCAAAGAGG - Intronic
1029279956 7:99429171-99429193 CAAAGGGCACGTGGTCACAGAGG - Exonic
1034499062 7:151438523-151438545 AAATGGGCACCTAGACAAAGGGG - Intronic
1038040293 8:23718520-23718542 CAAAGGGCACCCTCTCAAAGAGG - Intergenic
1038943063 8:32326977-32326999 TAAATAGAACCTCATCAAAGAGG + Intronic
1039295017 8:36141162-36141184 TAAATGTCACTTCATCAAAGTGG + Intergenic
1041544864 8:59031674-59031696 TAAATGTCACCTCCTCAGAGAGG - Intronic
1042807166 8:72783533-72783555 TCAATGTCACCTTGTCAAAGAGG + Intronic
1043859233 8:85296662-85296684 CAAATGTCACCTCTTCAAAGAGG + Intergenic
1045258470 8:100550461-100550483 TAATGGACACCTCATCACAGAGG - Intronic
1046686184 8:117229388-117229410 TAAAGGCCAGCTCCTCAAAAAGG + Intergenic
1046760023 8:118011134-118011156 CAAACGACACCTCCTCAAAGAGG + Intronic
1046975503 8:120271552-120271574 CAAAAGGCACCTCCTCAAAGAGG - Intronic
1051333360 9:16045282-16045304 CAAAGGGAACCTCGTCAAGGTGG + Intronic
1054983559 9:71235225-71235247 TAAATGGCTCCTCTTCAGAGAGG + Intronic
1055739551 9:79371560-79371582 TAAATGACACCTCCTCAGAGGGG + Intergenic
1058022830 9:100107635-100107657 TTAAGGTCACTTCTTCAAAGAGG + Intronic
1061221937 9:129257254-129257276 TAAAGGTCACCTCCTCAGGGAGG + Intergenic
1187504917 X:19871718-19871740 TAAAGGGCACCACGTAAGGGTGG - Intronic
1188012115 X:25068321-25068343 TAAATGTCACCTCTTCAGAGAGG - Intergenic
1188499673 X:30811432-30811454 CAAAGGGCACCTGCTCAAAATGG + Intergenic
1189136563 X:38556738-38556760 TAAATGTCACCTCCTCAGAGAGG - Intronic
1189437805 X:41008301-41008323 CCAACGGCACCTCCTCAAAGAGG + Intergenic
1190001730 X:46695552-46695574 TAAATGCCACCTCCTCCAAGAGG + Intronic
1192221739 X:69201955-69201977 TAAATGTCACCTCTTCAAAGAGG - Intergenic
1192246203 X:69373683-69373705 CAAAGGTCACCTCCTCCAAGAGG + Intergenic
1196779319 X:119368597-119368619 CAAATGTCACCTCCTCAAAGAGG - Intergenic
1197712887 X:129684755-129684777 TAAATGTCACCTCCTCACAGAGG - Intergenic
1199913569 X:152314706-152314728 TAAATGGCACTTCGTCAGAGAGG + Intronic
1200650631 Y:5836381-5836403 TAAAGGGCAATTAGTTAAAGAGG + Intergenic