ID: 1023228692

View in Genome Browser
Species Human (GRCh38)
Location 7:38000659-38000681
Sequence CAATCTATGCTGATGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023228684_1023228692 23 Left 1023228684 7:38000613-38000635 CCTTGGAAGATAGCAGGGTAAAT 0: 1
1: 0
2: 0
3: 18
4: 188
Right 1023228692 7:38000659-38000681 CAATCTATGCTGATGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023228692 Original CRISPR CAATCTATGCTGATGGGGGA TGG Intronic
No off target data available for this crispr