ID: 1023232553

View in Genome Browser
Species Human (GRCh38)
Location 7:38050060-38050082
Sequence GCTGCCTGCCAGTCCCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023232553_1023232556 -2 Left 1023232553 7:38050060-38050082 CCTGCATGGGACTGGCAGGCAGC No data
Right 1023232556 7:38050081-38050103 GCCCCACCTTCCGTCGGGTGTGG No data
1023232553_1023232558 -1 Left 1023232553 7:38050060-38050082 CCTGCATGGGACTGGCAGGCAGC No data
Right 1023232558 7:38050082-38050104 CCCCACCTTCCGTCGGGTGTGGG No data
1023232553_1023232555 -7 Left 1023232553 7:38050060-38050082 CCTGCATGGGACTGGCAGGCAGC No data
Right 1023232555 7:38050076-38050098 AGGCAGCCCCACCTTCCGTCGGG No data
1023232553_1023232564 25 Left 1023232553 7:38050060-38050082 CCTGCATGGGACTGGCAGGCAGC No data
Right 1023232564 7:38050108-38050130 CACTAAGCACCTGATCCACTAGG No data
1023232553_1023232554 -8 Left 1023232553 7:38050060-38050082 CCTGCATGGGACTGGCAGGCAGC No data
Right 1023232554 7:38050075-38050097 CAGGCAGCCCCACCTTCCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023232553 Original CRISPR GCTGCCTGCCAGTCCCATGC AGG (reversed) Intergenic
No off target data available for this crispr