ID: 1023233927

View in Genome Browser
Species Human (GRCh38)
Location 7:38064438-38064460
Sequence GCCTCCACCAGAATCACCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023233919_1023233927 25 Left 1023233919 7:38064390-38064412 CCAGGGCAGTTAGAGCAAGGAGC No data
Right 1023233927 7:38064438-38064460 GCCTCCACCAGAATCACCTAAGG No data
1023233918_1023233927 26 Left 1023233918 7:38064389-38064411 CCCAGGGCAGTTAGAGCAAGGAG No data
Right 1023233927 7:38064438-38064460 GCCTCCACCAGAATCACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023233927 Original CRISPR GCCTCCACCAGAATCACCTA AGG Intergenic
No off target data available for this crispr