ID: 1023241349

View in Genome Browser
Species Human (GRCh38)
Location 7:38151194-38151216
Sequence TATGCAAGACCACCCTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023241349_1023241352 -5 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241352 7:38151212-38151234 GCATATCAGATGGAGCTGGTCGG No data
1023241349_1023241351 -9 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241351 7:38151208-38151230 TCTTGCATATCAGATGGAGCTGG No data
1023241349_1023241353 12 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241353 7:38151229-38151251 GGTCGGACCTGAGCACTCCTTGG No data
1023241349_1023241356 30 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241356 7:38151247-38151269 CTTGGTCTGCTGTCCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023241349 Original CRISPR TATGCAAGACCACCCTGCAG AGG (reversed) Intergenic
No off target data available for this crispr