ID: 1023241351

View in Genome Browser
Species Human (GRCh38)
Location 7:38151208-38151230
Sequence TCTTGCATATCAGATGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023241348_1023241351 -4 Left 1023241348 7:38151189-38151211 CCTGACCTCTGCAGGGTGGTCTT No data
Right 1023241351 7:38151208-38151230 TCTTGCATATCAGATGGAGCTGG No data
1023241349_1023241351 -9 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241351 7:38151208-38151230 TCTTGCATATCAGATGGAGCTGG No data
1023241344_1023241351 5 Left 1023241344 7:38151180-38151202 CCTGTTGAACCTGACCTCTGCAG No data
Right 1023241351 7:38151208-38151230 TCTTGCATATCAGATGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023241351 Original CRISPR TCTTGCATATCAGATGGAGC TGG Intergenic
No off target data available for this crispr