ID: 1023241352

View in Genome Browser
Species Human (GRCh38)
Location 7:38151212-38151234
Sequence GCATATCAGATGGAGCTGGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023241344_1023241352 9 Left 1023241344 7:38151180-38151202 CCTGTTGAACCTGACCTCTGCAG No data
Right 1023241352 7:38151212-38151234 GCATATCAGATGGAGCTGGTCGG No data
1023241349_1023241352 -5 Left 1023241349 7:38151194-38151216 CCTCTGCAGGGTGGTCTTGCATA No data
Right 1023241352 7:38151212-38151234 GCATATCAGATGGAGCTGGTCGG No data
1023241348_1023241352 0 Left 1023241348 7:38151189-38151211 CCTGACCTCTGCAGGGTGGTCTT No data
Right 1023241352 7:38151212-38151234 GCATATCAGATGGAGCTGGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023241352 Original CRISPR GCATATCAGATGGAGCTGGT CGG Intergenic
No off target data available for this crispr