ID: 1023247872

View in Genome Browser
Species Human (GRCh38)
Location 7:38225851-38225873
Sequence GACACGGATGTGTCTGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023247870_1023247872 -4 Left 1023247870 7:38225832-38225854 CCTTGGCTTTCAGCAGGTTGACA 0: 1
1: 1
2: 3
3: 16
4: 213
Right 1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG 0: 1
1: 0
2: 0
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023247872 Original CRISPR GACACGGATGTGTCTGCATG TGG Intronic
900127438 1:1074742-1074764 GCCACGTATGTGTATGGATGAGG - Intergenic
900187911 1:1341584-1341606 GATGTGCATGTGTCTGCATGAGG - Intronic
901186687 1:7378100-7378122 GACTCAGATGTGTCTGAGTGAGG - Intronic
902563778 1:17296240-17296262 GACAAGGATTTGTGTGCAAGAGG - Intergenic
908211669 1:61906555-61906577 GACATAGATGTGTGTGCCTGTGG - Intronic
912243287 1:107934543-107934565 GACAAAGATGTGTCTCCAGGAGG + Intronic
914804418 1:150982144-150982166 GGCAGGAAGGTGTCTGCATGTGG + Exonic
918086296 1:181247970-181247992 GACAGGGGTGTCCCTGCATGAGG - Intergenic
918148535 1:181779136-181779158 GCCAGGGCTGTGTCTGCATCTGG + Intronic
921830690 1:219724679-219724701 GCCAGGGATGTGTCTGCAGGGGG - Intronic
1063662870 10:8046011-8046033 AACCCAGATGTGTCTGCATCTGG + Intergenic
1067739587 10:48884516-48884538 CACATGTATGTGTGTGCATGTGG - Intronic
1069708673 10:70475363-70475385 GTCACGGATGAGTTTGCCTGAGG + Intergenic
1071178638 10:82957180-82957202 GACACTGTGGTGGCTGCATGTGG - Intronic
1075313047 10:121430732-121430754 GACACTGATCTGTTTGAATGTGG - Intergenic
1075383454 10:122037673-122037695 CACACGGATGGGTATACATGAGG - Intronic
1078954857 11:16181009-16181031 GACCCAGATGTGTCTGTGTGGGG + Intronic
1083291147 11:61690869-61690891 GCCACAGATGGGTCTACATGTGG - Intronic
1084154106 11:67304170-67304192 CAGACGGAAGTGTCTGCGTGGGG - Intronic
1084424670 11:69077960-69077982 GACACGTCTGTGTGTGCAAGAGG - Intronic
1091396104 12:155102-155124 CACACGGATGTGGCCGCATAGGG + Intronic
1091655752 12:2345756-2345778 GACATGGAGGTGACTGAATGGGG + Intronic
1091801259 12:3326192-3326214 GACACGGATGGGCCTGCAGGGGG - Intergenic
1091865863 12:3836141-3836163 GACTTTGATGTGTCTGCATTTGG - Intronic
1104442169 12:128802568-128802590 GACACCAAAGTGTCTGCAGGGGG + Intronic
1105699407 13:22925144-22925166 GAAACGGATGTATCTCCATGCGG + Intergenic
1107357339 13:39582130-39582152 GAGACTGATGTGTCTACAGGAGG - Intronic
1107808754 13:44179251-44179273 AACATGGATGTGACAGCATGGGG + Intergenic
1107910492 13:45101065-45101087 GAAAGGGAGGAGTCTGCATGTGG - Intergenic
1110959490 13:81603427-81603449 TACTCTGATGTGACTGCATGTGG - Intergenic
1116537459 14:46051165-46051187 GTCTAGTATGTGTCTGCATGTGG + Intergenic
1127645959 15:60959638-60959660 GACACTAATATGTCTGCATCTGG - Intronic
1128364465 15:66987941-66987963 TACAAGGAGGTGTCTGCTTGAGG - Intergenic
1128790702 15:70431749-70431771 GTCACGGATGGGCCTGCAGGAGG + Intergenic
1129691873 15:77718398-77718420 GACACGTGTGTGTATACATGTGG - Intronic
1130054074 15:80507346-80507368 GACAGAGATGTGTGTGCAGGCGG + Intronic
1131092115 15:89631141-89631163 AACACAGATGTGTGGGCATGAGG + Intronic
1131542479 15:93286789-93286811 GACCCATATTTGTCTGCATGTGG + Intergenic
1142708982 17:1713376-1713398 CACACAGATGAGTGTGCATGAGG - Intergenic
1143682880 17:8490681-8490703 GGGAAGGATGTGTATGCATGTGG - Intronic
1145865659 17:28239891-28239913 GGAATGGATGTGTCTGCCTGTGG - Intergenic
1148165131 17:45478244-45478266 CACATAGATGTGTGTGCATGTGG - Intronic
1149022942 17:51991300-51991322 GACATGGATGTGTTTGCAGCTGG - Intronic
1151342760 17:73482341-73482363 GATACAGATGTGTCTGAAAGCGG + Intronic
1152946681 17:83201609-83201631 GACATGTATGTGCATGCATGTGG - Intergenic
1153931773 18:9885547-9885569 TACTTGGATGTGTCTGCATGGGG + Intergenic
1154202693 18:12309911-12309933 CACATGTATGTGTATGCATGGGG + Intronic
1154317965 18:13320937-13320959 GCCACGCCTGTGTCTGCAGGTGG + Intronic
1157404770 18:47413670-47413692 GGCATGGATGTGTGTGCATGAGG - Intergenic
1159966597 18:74601106-74601128 GACACTGATGTGTCTGCTTCGGG + Intronic
1160210483 18:76874114-76874136 GTCACGGCTCTGCCTGCATGGGG - Intronic
1163603890 19:18263977-18263999 GACTCGGGGGTGGCTGCATGTGG + Intronic
1164907793 19:31981750-31981772 GACAGTGATGAGTCTGCATAGGG - Intergenic
1166196163 19:41207207-41207229 GACCCAGATGTGTTTGCATTTGG - Exonic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925350789 2:3199711-3199733 GACATGGGTGTGTCTGCATCTGG + Intronic
925350804 2:3199774-3199796 GACAGGGGTGTGTCTGCATCTGG + Intronic
925350824 2:3199863-3199885 GACATGGGTGTGTCTGCATCTGG + Intronic
925350853 2:3199979-3200001 GTGACGGGTGTGTCTGCATCTGG + Intronic
927524053 2:23721244-23721266 GTCAGGGACTTGTCTGCATGGGG - Intergenic
930302609 2:49636051-49636073 GACATGGATGTGACAGGATGTGG - Intergenic
936159354 2:110072010-110072032 GACACGGAGGTGCCTGGAAGAGG - Intergenic
936185307 2:110299322-110299344 GACACGGAGGTGCCTGGAAGAGG + Intergenic
937309408 2:120892880-120892902 GACAAGGATGTGAGTGCAAGTGG - Intronic
938252122 2:129823304-129823326 GACACTGCTGTGCCTGCCTGTGG - Intergenic
944662122 2:201929889-201929911 GACATGGGTGTGTCTGTGTGTGG - Intergenic
944917321 2:204374350-204374372 GACAGGGATGTTTCTGTATAAGG + Intergenic
944920183 2:204404563-204404585 GACAAGGATTTGAGTGCATGTGG + Intergenic
948470355 2:238173493-238173515 GGCACAGGTGTGTGTGCATGTGG - Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
1169946287 20:10992359-10992381 AACACAGCAGTGTCTGCATGTGG + Intergenic
1170429940 20:16266689-16266711 GTGACAGCTGTGTCTGCATGGGG + Intergenic
1170480490 20:16760538-16760560 GAAACCTATGTGTCTGCTTGCGG - Intronic
1171342240 20:24439520-24439542 GATACATATGTGTGTGCATGTGG + Intergenic
1172026952 20:31955037-31955059 GACACTGCTGTGTATGCCTGTGG + Intergenic
1172497760 20:35400931-35400953 GACAGGCCTGTTTCTGCATGTGG + Intronic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1181004191 22:20002184-20002206 GTCACGGATGTGTCTACCTCTGG + Intronic
1184921206 22:47606955-47606977 CAGAAGGATGTGTGTGCATGGGG + Intergenic
952337403 3:32415876-32415898 CACAGGTCTGTGTCTGCATGAGG + Intronic
953584610 3:44188393-44188415 AAGACATATGTGTCTGCATGGGG - Intergenic
953907993 3:46877963-46877985 TCCACAGATGTGTCTCCATGCGG - Intronic
954109444 3:48425913-48425935 TATATGGATGTGTCTTCATGTGG - Intronic
956724514 3:72145986-72146008 GACACGGAGCTGTCTCCTTGGGG - Intergenic
965136389 3:164776296-164776318 TACACATATGTGTGTGCATGTGG - Intergenic
966019617 3:175191510-175191532 GTCAGGGATTTGTCTCCATGTGG + Intronic
967965899 3:194960132-194960154 AACACAGAAGTGTCAGCATGGGG + Intergenic
971424604 4:26503421-26503443 GAGACGGATGAGTCTTCCTGGGG + Intergenic
973636822 4:52868745-52868767 GGCAGGGATGTGTATGCATCTGG + Intergenic
975594897 4:76040694-76040716 GACAAAGATGTGTCTACATGGGG - Intronic
976493348 4:85697781-85697803 GAAACGGATGTTTCTGTGTGAGG + Intronic
977258189 4:94763468-94763490 AACAAGGATATGGCTGCATGTGG + Intronic
978448612 4:108804907-108804929 TACACTGAGGTATCTGCATGAGG + Intergenic
980715522 4:136623729-136623751 GAAACAGATTTGTCTGCCTGTGG - Intergenic
982307277 4:153945828-153945850 GACTCTGATGTGTCTCAATGTGG + Intergenic
984143914 4:176037935-176037957 CACATGTGTGTGTCTGCATGTGG - Intergenic
984669423 4:182465411-182465433 CACACGGCTGTGTCTGAATGAGG + Intronic
985571412 5:647541-647563 CACAGGGATGTGGCTCCATGGGG + Intronic
992153190 5:73926617-73926639 GAGATGGCTGTGGCTGCATGTGG - Intronic
993765242 5:91848342-91848364 GACAAGGATGTGTCAGGTTGGGG + Intergenic
994888375 5:105596757-105596779 GTCAAGCATGTGTCTGCATATGG + Intergenic
1001422326 5:171597169-171597191 GACTCTCATGTTTCTGCATGTGG - Intergenic
1005783733 6:29220474-29220496 AACATGGATGTGACTGCATTGGG + Intergenic
1007256843 6:40535578-40535600 GCCAAGGATGTGTCTGGATGGGG - Intronic
1007629743 6:43266233-43266255 CACATGTATGTGCCTGCATGTGG + Intronic
1013779866 6:113717518-113717540 GGCATGGATGTGTGTGCCTGTGG - Intergenic
1017872803 6:158501535-158501557 GACAGAGACGTGTCTGCTTGGGG - Intronic
1020088863 7:5326185-5326207 TACACGGTTGTGTGTGCTTGTGG - Intronic
1022395596 7:29985577-29985599 AACACAGATGTGTCAGAATGAGG + Intronic
1022464667 7:30645490-30645512 GAAAGGGATGTGTCTGAATGTGG - Intergenic
1023247872 7:38225851-38225873 GACACGGATGTGTCTGCATGTGG + Intronic
1026857038 7:73762021-73762043 GACACAGATGTGTGTGCACATGG + Intergenic
1028708227 7:93875340-93875362 GGCTCAGATGTGTCTGAATGAGG + Intronic
1029426051 7:100494473-100494495 GCCAAGGAGGGGTCTGCATGGGG + Exonic
1034715627 7:153238773-153238795 GACACAGCTGTGTCTTCATTTGG + Intergenic
1035273686 7:157734780-157734802 GACACGGGTGGGACTGAATGTGG - Intronic
1035606015 8:930072-930094 CACACTGATGTGTTTGCATCGGG + Intergenic
1037015679 8:13903253-13903275 GACACAGATGTGTCTGTCTTGGG - Intergenic
1037842387 8:22254499-22254521 GAACTGGATGTGTGTGCATGTGG - Exonic
1039136113 8:34324423-34324445 CTCATGGATGTGTATGCATGTGG + Intergenic
1040866966 8:52057382-52057404 GACACGGATGTGTCAACTAGCGG - Intergenic
1044355410 8:91216957-91216979 GACTAGAATGTGTCTGCCTGGGG - Intronic
1049060968 8:140276017-140276039 GACCTGGACGTGTCTGCATGAGG - Intronic
1056703582 9:88932393-88932415 GTCTCCCATGTGTCTGCATGGGG + Intergenic
1056810753 9:89762137-89762159 CACACTGATGTGTCTGCATAGGG - Intergenic
1057517470 9:95734253-95734275 GACACAGATGTGTGTGTGTGTGG + Intergenic
1062360021 9:136183218-136183240 GACACTAATGTGTCTCCAAGGGG - Intergenic
1062559828 9:137136550-137136572 GACAGAAATGTGTCTGCAGGTGG + Intergenic
1185575993 X:1172707-1172729 GACACGGTTGTGGCTGCAATGGG - Intergenic
1189099317 X:38172597-38172619 GATACGGATTTATGTGCATGAGG + Intronic
1194811161 X:98388946-98388968 GACAGAGATGTGTGTGCAAGAGG + Intergenic
1195288698 X:103410446-103410468 GAGAGGGATGTGTGTGGATGAGG + Intergenic