ID: 1023248101

View in Genome Browser
Species Human (GRCh38)
Location 7:38228449-38228471
Sequence ACATGCAAAAATGTTGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023248101_1023248102 10 Left 1023248101 7:38228449-38228471 CCAAGCTCAACATTTTTGCATGT 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1023248102 7:38228482-38228504 ATGCAAGCTTGTCAGCAAAGAGG 0: 1
1: 0
2: 0
3: 4
4: 119
1023248101_1023248103 16 Left 1023248101 7:38228449-38228471 CCAAGCTCAACATTTTTGCATGT 0: 1
1: 0
2: 0
3: 24
4: 261
Right 1023248103 7:38228488-38228510 GCTTGTCAGCAAAGAGGCAGAGG 0: 1
1: 0
2: 1
3: 43
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023248101 Original CRISPR ACATGCAAAAATGTTGAGCT TGG (reversed) Intronic
902340362 1:15779234-15779256 ACATTCAAAAGAGTTGATCTAGG - Intronic
902356317 1:15903827-15903849 ACATGTAATATTGTTGTGCTTGG + Intronic
902942136 1:19808237-19808259 ACATACAAAAAAATTTAGCTGGG - Intergenic
905750476 1:40458675-40458697 AAATACAAAAATGATTAGCTGGG - Intronic
907093530 1:51752637-51752659 ACAGGCCAGAATGTTGATCTTGG - Intronic
911058812 1:93730490-93730512 TCATTCAAAAATGTTTAGCAAGG - Intronic
911209380 1:95123162-95123184 ACATGTAAAAATATTGAGACAGG + Intronic
911734177 1:101319388-101319410 ACATGCAAAGGTGTTGACATGGG - Intergenic
913062021 1:115217117-115217139 GCATGCCCAAATGATGAGCTGGG + Intergenic
916279423 1:163032684-163032706 ACATACAAAAATAATTAGCTGGG - Intergenic
916897177 1:169177489-169177511 AAATGCAAAATTCTTGGGCTGGG + Intronic
918474780 1:184912515-184912537 ACAGGCAAAAATGTGGAAGTGGG - Intronic
918775362 1:188622576-188622598 TCATGCAGAAATTTTGAGTTCGG + Intergenic
919240506 1:194909565-194909587 AGAAGAAAAAATGTTCAGCTGGG - Intergenic
919546580 1:198929178-198929200 ACTTGCAAAAATGTTGCACCTGG + Intergenic
919690131 1:200521670-200521692 GCATGCAAAAATGTTGTCATGGG - Intergenic
920317956 1:205092723-205092745 ACAAGAAAAAACCTTGAGCTGGG - Intronic
920369630 1:205470062-205470084 ACATGCAGAATTCATGAGCTTGG - Intergenic
921304872 1:213786004-213786026 AGATGCAAGAATTTTGAGCCAGG + Intergenic
923123434 1:231015028-231015050 ACAACAAAAAATGTTGAGCAAGG - Intergenic
923580397 1:235205793-235205815 ACATGAAAAAATGTTGCATTAGG + Intronic
1063076248 10:2719586-2719608 AGAAGCTAAAATGTTGAGATTGG + Intergenic
1064830482 10:19460358-19460380 ACATGCACAAATATTAAGCCAGG + Intronic
1065652304 10:27905103-27905125 ACATGCAAGCATTTTGAACTAGG + Intronic
1067160760 10:43822883-43822905 ACTTGCAAAATTGATGAGTTTGG + Intergenic
1067557758 10:47284533-47284555 ATATACAAAAATGATGGGCTGGG - Intergenic
1067994347 10:51254314-51254336 ACATGCAAAAATGTATACATTGG - Intronic
1068254181 10:54486917-54486939 CCATGGAATAATGTTGATCTGGG + Intronic
1068469005 10:57436421-57436443 ACATTAAAAAATCTTGAGTTGGG - Intergenic
1072634995 10:97172201-97172223 AAATGCAAAAAAATTTAGCTGGG - Intronic
1074811821 10:117112343-117112365 AGATGCATAAATGATGAGCTAGG - Intronic
1075339508 10:121634803-121634825 ACATGGAAAAGTGTTTAGCCAGG + Intergenic
1077734795 11:4778651-4778673 ACCTGCTAAAATGTTGATTTGGG + Intronic
1077983269 11:7323451-7323473 ACAAGCAAAAAAGATGAGGTAGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078218204 11:9329565-9329587 AAATACAAAAAAGTTTAGCTGGG - Intergenic
1078362080 11:10676837-10676859 ACCTCCAAACATATTGAGCTTGG - Intronic
1078674948 11:13401931-13401953 AAGTGCAAAAGTGTTGAGGTAGG - Intronic
1079481776 11:20888887-20888909 ACATGTAAATAAGCTGAGCTAGG - Intronic
1080624745 11:34017971-34017993 ACAGGCAAAAAGGTTGAATTTGG + Intergenic
1081663739 11:44904287-44904309 ACTTGGAAAAATGCTGAGCAGGG - Intronic
1083241374 11:61391349-61391371 AAATGCAAAAATATTTAGCCGGG + Intergenic
1083559389 11:63660607-63660629 ATATACAAGAATGTTGAGCTGGG + Intronic
1083732726 11:64661447-64661469 GCATGCCGAAATCTTGAGCTCGG + Intronic
1084172117 11:67405772-67405794 AGATGCAAGACTGTAGAGCTGGG - Intronic
1085305841 11:75485764-75485786 ACCAACCAAAATGTTGAGCTTGG - Intronic
1085407050 11:76269646-76269668 ACATGCTAAAAGGATGAGATGGG - Intergenic
1085818115 11:79763013-79763035 ATATGCAAATATGTTGAACCTGG - Intergenic
1088927556 11:114317702-114317724 TCAAAAAAAAATGTTGAGCTAGG + Intergenic
1090352728 11:126117791-126117813 AATTGCAAAAATATGGAGCTGGG + Intergenic
1091255787 11:134183955-134183977 TAATGAAAAAATGTAGAGCTGGG - Intronic
1093509458 12:19909104-19909126 AAATGCAAACATGTTTAGCAAGG - Intergenic
1093671930 12:21886804-21886826 AGATGCAAAGATCTTGAGGTAGG - Intronic
1094031586 12:26017881-26017903 ACAAGCAAAAAGGTTGAAGTTGG + Intronic
1094158714 12:27367007-27367029 AAATTCATAAATGTAGAGCTTGG - Intronic
1097655694 12:62359820-62359842 AAATTCAAAATTGTTGAGTTTGG + Intronic
1097932227 12:65200994-65201016 ACATGCAAAAAAATTAATCTAGG - Intronic
1098017990 12:66126633-66126655 ATATGAAAAAATGTTCAGCCGGG + Intronic
1098586330 12:72158096-72158118 TCATGCAAAAATGTTTTGGTAGG + Intronic
1100810659 12:98334564-98334586 ACATGCAAAAATATTCAATTTGG - Intergenic
1100903257 12:99267847-99267869 ACAAGCAAAGATATGGAGCTCGG + Intronic
1102376307 12:112424213-112424235 ACATGCAAAAGTGCTGAAGTGGG + Intronic
1102688284 12:114741064-114741086 ACATGCAAAGCTTTTGGGCTTGG - Intergenic
1103263063 12:119605587-119605609 AAATACAAAAAAGTTTAGCTGGG - Intronic
1104632249 12:130413470-130413492 AAATGCAAAAAAATTTAGCTGGG + Intronic
1105479620 13:20762345-20762367 AAATGCAAAAAAATTTAGCTGGG - Intronic
1107534374 13:41313358-41313380 AGATTTAAAAATGTTTAGCTTGG - Intronic
1107921269 13:45210803-45210825 ATATGGAAAAATTTTAAGCTGGG + Intronic
1107969755 13:45630032-45630054 TCATGCAAAAATAATGACCTTGG - Intergenic
1108167069 13:47704557-47704579 ACAGGCAAAAAAGCTGACCTTGG + Intergenic
1109234545 13:59798898-59798920 ACATGCAGAATTGTTGAGAATGG + Intronic
1110916223 13:81024395-81024417 AAATGCAAAAGTCTTGAGGTGGG + Intergenic
1111061397 13:83023456-83023478 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1111478731 13:88792640-88792662 ACATTCCCAAATGTTGATCTGGG - Intergenic
1111640803 13:90967105-90967127 ACATGCAAAAATGGTGCTGTTGG - Intergenic
1112770974 13:102794502-102794524 AAATACAAAAAAGTTTAGCTGGG + Intronic
1115581750 14:34766567-34766589 ACATGAAAAAATGGAGAGCAAGG + Intronic
1116190397 14:41657949-41657971 ACTTGAAAAAATGTTGACATAGG - Intronic
1117548454 14:56811573-56811595 CCAGGCAAAAAAGTTGGGCTGGG - Intergenic
1119797462 14:77411932-77411954 AAATGCAAAAAAATTTAGCTGGG + Intronic
1120185444 14:81389049-81389071 AGATGTAAAAATGTTTATCTTGG - Intronic
1121276337 14:92670525-92670547 AACTGCCAAAATGTTGGGCTGGG + Intronic
1122452431 14:101820750-101820772 ACATGCAAAAATGTACAACATGG + Intronic
1124588164 15:31029522-31029544 AAATGCAAATATTTTAAGCTTGG + Intronic
1125327564 15:38552355-38552377 ACATAACAAAATGTTGAGGTGGG - Intronic
1126116689 15:45214325-45214347 ACATGCAACAATATTGAGTCTGG + Intergenic
1126224394 15:46253505-46253527 ATATGTAAAAATTTTGAGTTTGG + Intergenic
1126561159 15:50045633-50045655 AGCAGTAAAAATGTTGAGCTTGG + Intronic
1127119246 15:55757137-55757159 ACATGCAGGAATGCTGTGCTGGG - Intergenic
1127519433 15:59728582-59728604 GCATGAAAAAATGTTGATGTTGG - Intergenic
1127587291 15:60390620-60390642 ACATGCAAACATTTTCAACTGGG + Intronic
1128833494 15:70790426-70790448 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1128950157 15:71871213-71871235 AAATGAAAAAATATTTAGCTAGG + Intronic
1128976117 15:72155073-72155095 AAATGCAAAAAGGTTGGGTTGGG - Intergenic
1129275375 15:74441943-74441965 ATATGCAAATATGTAGAGATGGG - Intergenic
1129919121 15:79304204-79304226 ATATGCAAAAAAGATGAACTTGG - Intergenic
1130542895 15:84834815-84834837 ACATGCACAAATGCACAGCTGGG + Intronic
1130840789 15:87699023-87699045 ACATGCAAAAAGAATGAACTTGG - Intergenic
1131109345 15:89755142-89755164 AAAAATAAAAATGTTGAGCTAGG - Intergenic
1131157969 15:90086564-90086586 AAATGCAAAAAAATTTAGCTGGG - Intronic
1131444297 15:92483829-92483851 ATATGAAAAAATGTTTAGCCAGG + Intronic
1131656448 15:94464682-94464704 ACATGCCAAAATGTTTGGCATGG - Intronic
1134083586 16:11341279-11341301 ACATGAAAATGTCTTGAGCTGGG + Intronic
1135270404 16:21064839-21064861 AAATGCATAAATATTGAGGTAGG + Intronic
1135605030 16:23816619-23816641 ACATGAAAATATGTTCAGCCTGG - Intergenic
1135848002 16:25936431-25936453 TCATGCAAAAATCTTGTGTTAGG + Intronic
1138003535 16:53307570-53307592 ACATACACATATGTTGAACTAGG + Intronic
1138765717 16:59600779-59600801 ACACTGAAAAATCTTGAGCTAGG - Intergenic
1138965315 16:62077475-62077497 ACCTGCCAAAATCTTGATCTTGG + Intergenic
1139282429 16:65782221-65782243 ACATAGATAAATGGTGAGCTAGG - Intergenic
1139939806 16:70597010-70597032 ACATACAAACAGGTTGAGCTGGG - Intronic
1140039226 16:71394644-71394666 ACATGCCAACATGTTGACATAGG - Intergenic
1140042949 16:71421459-71421481 ACATGCAAGCATTTTGAACTGGG + Intergenic
1145814045 17:27782792-27782814 ACATTCCCAAATGTTGAGATGGG - Intronic
1146241589 17:31233735-31233757 ACATGCTAAAACGTTGAGACGGG + Intronic
1146392330 17:32433985-32434007 ACTTGCAAAAATGTAAAGCATGG - Intergenic
1146449710 17:32963071-32963093 ACATGTAAAAAAGTTGACATTGG - Intergenic
1146822010 17:35990950-35990972 AAAAGTAAAAATCTTGAGCTGGG - Intronic
1147379891 17:40048023-40048045 ACATACAAAGATCTTGCGCTGGG - Intronic
1147435954 17:40415353-40415375 TCTTTAAAAAATGTTGAGCTAGG - Intronic
1149502178 17:57161780-57161802 ACATGCAAAAAAATAAAGCTGGG - Intergenic
1149810249 17:59662203-59662225 ACATGGAAAAATATTTAACTTGG + Intronic
1149929807 17:60740335-60740357 ACATACAAAAAAATTCAGCTGGG + Intronic
1150685047 17:67313837-67313859 AAATGCAAAAAAGATTAGCTGGG + Intergenic
1151595972 17:75078179-75078201 AGATCCAAAAATGTTGGGCTGGG + Intergenic
1153038134 18:783907-783929 ACATGAAAAATTAATGAGCTAGG - Intronic
1158526457 18:58219058-58219080 AAATGAAAAAATGTTAAGCCTGG - Intronic
1158669324 18:59460772-59460794 AAATACAAAAAGGTTTAGCTGGG + Intronic
1159176450 18:64841543-64841565 GCAGGCAGAAAAGTTGAGCTAGG - Intergenic
1159621439 18:70643487-70643509 ATATGCAAATATTTTTAGCTAGG - Intronic
1164539699 19:29113694-29113716 CCATCCATAAACGTTGAGCTGGG - Intergenic
1165210766 19:34234015-34234037 AAATGCAAAAATTATTAGCTAGG + Intergenic
1165344910 19:35239178-35239200 ACATGCAAAGGTCTTGAGGTGGG + Intergenic
1165618663 19:37225387-37225409 ACATTTAAAAATGATTAGCTTGG - Intronic
1166823071 19:45592334-45592356 ACATGAGAAAGTGTTGAGATAGG + Exonic
1167025279 19:46911778-46911800 ATATGCAAAAATGATGTGTTAGG - Intergenic
926130672 2:10301997-10302019 ACAGCCAGAAATGTGGAGCTGGG - Intergenic
926906550 2:17811120-17811142 ACAAACAAAAATCTTGTGCTGGG - Intergenic
927315101 2:21672660-21672682 ATAAGCATAAATGTTGGGCTTGG - Intergenic
928655880 2:33451157-33451179 ATATGAAAAAATGCTCAGCTGGG - Intronic
928753002 2:34492852-34492874 AAATGGTAAAATTTTGAGCTAGG + Intergenic
929042190 2:37755908-37755930 AGCTGCAAAAATGTTAAGTTGGG - Intergenic
929134688 2:38612522-38612544 AAAAGCAAAAATGATGGGCTGGG - Intergenic
931387024 2:61806985-61807007 AAATAAAAAGATGTTGAGCTGGG - Intergenic
931585944 2:63828222-63828244 ACATGCAAAAACTTTGAGTTGGG - Intergenic
931622465 2:64224568-64224590 ATATGCAAAAATGATGAAGTTGG - Intergenic
934546626 2:95222936-95222958 ACATGTAAAAACAATGAGCTGGG - Intronic
936677233 2:114729470-114729492 ACATGCCAAAATGAAGAGCAAGG + Intronic
937034412 2:118769069-118769091 AAATGCAAAAAAATTTAGCTGGG + Intergenic
940585672 2:155645536-155645558 ACGTGCAAAAAAATTGAACTAGG - Intergenic
940927541 2:159381762-159381784 ATATGCAACAATGATGAACTAGG - Intronic
941551190 2:166917520-166917542 CCATGCAAATATGTTTAGTTGGG - Intronic
943223606 2:185140870-185140892 ACACCCAAAAATGTGGAACTGGG - Intergenic
943311270 2:186328041-186328063 ACAAGCAAAAATGTACAACTTGG - Intergenic
946029806 2:216694923-216694945 ACTTGCAAAAATGTAGAGAGAGG + Exonic
948638275 2:239354941-239354963 ACATCCAAAAATTTTGAGGGGGG - Intronic
1169672982 20:8124783-8124805 ATAAGGAATAATGTTGAGCTGGG - Intergenic
1169674186 20:8135271-8135293 ACATTCAAAAATGATGAATTTGG + Intronic
1170545363 20:17431553-17431575 ACATCCAAAGATTTTGAGCAAGG + Intronic
1170587825 20:17748676-17748698 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1170954767 20:20969444-20969466 ACTTACAAAAATGTACAGCTGGG + Intergenic
1174722048 20:52823152-52823174 ACATTTAAGAATGTTGTGCTTGG + Intergenic
1174945529 20:54981102-54981124 TATTGCAAAAATGTTTAGCTTGG + Intergenic
1177789250 21:25704900-25704922 ATTTGCAGAAATGTTAAGCTTGG + Intronic
1180653820 22:17401972-17401994 AAAAGTTAAAATGTTGAGCTGGG - Intronic
1180665568 22:17508945-17508967 ACATTTAAAAATGTTGACCTGGG + Intronic
1181890806 22:26061848-26061870 TCATGGAAAAATGATGGGCTAGG - Intergenic
949288451 3:2434393-2434415 ATGTGCAAAAGTCTTGAGCTAGG + Intronic
952719342 3:36515947-36515969 AAATGAAAAACTGTTAAGCTTGG - Intronic
954475832 3:50744771-50744793 ACATGCAAAAACAATGAGGTTGG - Intronic
956504100 3:69919505-69919527 ACATGCACAAATGTTGTCTTGGG - Intronic
956526843 3:70173914-70173936 AGATGCAGAAATGTGGAACTTGG - Intergenic
956561958 3:70588340-70588362 CCCTGTAAAAATGTTCAGCTTGG + Intergenic
960368338 3:116802837-116802859 ACATTCAGCAATGTTGTGCTAGG + Intronic
960585324 3:119315855-119315877 ACTTGCCAAAATGTTGGGGTGGG + Intronic
961221258 3:125202066-125202088 AAATACAAAAAAGTTTAGCTGGG - Intronic
962254870 3:133863689-133863711 ACTTGAAAAAAAGTTGAGGTAGG - Intronic
967631599 3:191749019-191749041 CCAGGCAAAAATGTTGACGTTGG - Intergenic
969049868 4:4365165-4365187 ACACCCAAAAACGTTTAGCTTGG + Intronic
970647467 4:18138969-18138991 CCCTGCAAAAATCTTGGGCTCGG + Intergenic
971316511 4:25572404-25572426 AAATGAACAAATGATGAGCTAGG + Intergenic
971675931 4:29629636-29629658 AAATACAAAAATGTTGAGATAGG - Intergenic
975191884 4:71473711-71473733 AAATAAAAAAATGTTCAGCTTGG + Intronic
975890285 4:79019350-79019372 ACATGAAAAAATGCTTACCTTGG - Intergenic
978358330 4:107901794-107901816 ACATACAAGAATGTTTGGCTGGG + Intronic
978941412 4:114440348-114440370 CCATGGAAAAAGGTTGAACTGGG - Intergenic
979520687 4:121663105-121663127 AAATGAAAAAATAATGAGCTTGG - Intergenic
980815793 4:137944112-137944134 ACATACAAAAATGTTAATCATGG + Intergenic
981561007 4:146048457-146048479 ACTTGCAAAAATTTTCAGCTTGG + Intergenic
981636054 4:146880563-146880585 ACTTGCAAAGATGTTGTGCAGGG - Intronic
983233343 4:165151525-165151547 ACATCAAAAAATGATGAGATTGG - Intronic
983548189 4:168985785-168985807 ACATGCAAAAATGTGGCATTTGG + Intronic
984528503 4:180886360-180886382 CAATGCTCAAATGTTGAGCTTGG - Intergenic
984548427 4:181133305-181133327 ACATGCAAAAAGGCTGAGGAAGG - Intergenic
984773305 4:183457385-183457407 ACATGTAAATATTTAGAGCTGGG - Intergenic
987948421 5:24645375-24645397 ACATTCCAAAATGATGAGCGAGG - Intergenic
990141999 5:52716143-52716165 ACATGCAAAAAAGTAAATCTAGG - Intergenic
990373319 5:55143300-55143322 ATATGAGAAAATGTTGAGTTGGG - Intronic
992713487 5:79485365-79485387 ATATGTAAAAATGTTGGGGTGGG - Intronic
993209262 5:84927266-84927288 ACATGCAAAAATTTGGATCTGGG - Intergenic
993704691 5:91156204-91156226 AGATGAAAAAAGGTTGATCTGGG + Intronic
995326608 5:110896640-110896662 ACATGGAAATATGGAGAGCTAGG - Intergenic
995497225 5:112759138-112759160 ACATTCTGAAATGTTGATCTCGG - Intronic
995739839 5:115344313-115344335 ACATGCAAAAATAGTGATGTTGG + Intergenic
995948251 5:117677531-117677553 GCAGACAAAAATGTTGAACTTGG + Intergenic
995983516 5:118138952-118138974 AGATGCAAAAATTTTTACCTAGG - Intergenic
996269227 5:121582168-121582190 ACATTCACAAATGTTGATCAAGG - Intergenic
996287914 5:121816651-121816673 ATATTCAAACATGTTGAGTTAGG - Intergenic
996662394 5:126019884-126019906 ATATTCAAAAATGTTGAACAAGG + Intergenic
997255597 5:132425526-132425548 ACAAGCAAAAAGGCAGAGCTGGG - Intronic
997784475 5:136696499-136696521 ACAGGTCAAAATCTTGAGCTTGG - Intergenic
998952590 5:147406929-147406951 ACATGCAATAAAGTGCAGCTTGG - Intronic
999709042 5:154300134-154300156 ACATGAAAAAATCTAGGGCTTGG - Intronic
999842566 5:155444866-155444888 AGATGCAAAATTGTTTATCTCGG + Intergenic
1000817598 5:165942971-165942993 ACATGCAAAGGTATTGAGGTGGG + Intergenic
1000936268 5:167306013-167306035 AAATGCAAAAATGGTGAGAGTGG + Intronic
1001220615 5:169897343-169897365 AAATACAAAAATGGTTAGCTGGG - Intronic
1005086480 6:22012596-22012618 ACATGAAAAACTGTTCAGCTAGG - Intergenic
1006534471 6:34687047-34687069 ACATGCAAGCATTTTGAACTGGG + Intronic
1006831854 6:36972884-36972906 ATATGCTAAGATTTTGAGCTCGG - Intronic
1007193093 6:40036657-40036679 ACTTGCTCAAATCTTGAGCTTGG - Intergenic
1007641683 6:43345678-43345700 ACATGGAAAAAAATAGAGCTTGG + Intronic
1012280321 6:97320868-97320890 ACCTGCAAAAAGCTTCAGCTAGG - Intergenic
1012372843 6:98528313-98528335 ACATGCAAACATGACCAGCTTGG + Intergenic
1014651526 6:124044814-124044836 TCATTGAAAGATGTTGAGCTTGG + Intronic
1016712890 6:147193689-147193711 ACATGTGACAATTTTGAGCTAGG + Intergenic
1019146631 6:169979427-169979449 ACATGCGGAAATGTTGAGATCGG + Intergenic
1022260807 7:28703079-28703101 TCATGCAAGAATGTTGAACAGGG + Intronic
1023248101 7:38228449-38228471 ACATGCAAAAATGTTGAGCTTGG - Intronic
1023446733 7:40239590-40239612 AAATGAAAAACTGTTGAGCTGGG + Intronic
1024375463 7:48632865-48632887 ACATGCAAAAGTATGAAGCTGGG + Intronic
1024391587 7:48819106-48819128 ACACACCAAAATGTGGAGCTGGG + Intergenic
1026422936 7:70259278-70259300 TCATACAAAAATCTAGAGCTTGG + Intronic
1026476235 7:70738190-70738212 ACATGCAAAAATGCTGGGAGTGG + Intronic
1027545334 7:79520584-79520606 CCATTCAAAAAATTTGAGCTTGG + Intergenic
1030271419 7:107672529-107672551 ACATGCTAAAATGTTAAAGTAGG - Intronic
1030481728 7:110113061-110113083 AGAGGCAAAAATGTTGAATTGGG - Intergenic
1032137265 7:129291279-129291301 CCATGCAAAAATGTTCAGAGCGG - Intronic
1033012973 7:137642251-137642273 ACATGAAGATATGTGGAGCTGGG + Intronic
1033802264 7:144915092-144915114 ACATGCAAAGATGTGGAAGTTGG + Intergenic
1034651442 7:152693949-152693971 ACATTTAAAAATATTAAGCTGGG - Intergenic
1035210361 7:157323467-157323489 ACAAACAAAAAAGTTCAGCTGGG - Intergenic
1037003858 8:13752371-13752393 ACATGCAGAAAGGTTGAGATAGG + Intergenic
1037661420 8:20930128-20930150 AGATCCAAAAATATTGAGATTGG - Intergenic
1038057864 8:23878353-23878375 ACATTCAAAAATTTTAAGGTGGG - Intergenic
1039390992 8:37180680-37180702 ACATGGGAAATTGTTGAGCTAGG - Intergenic
1040008404 8:42640449-42640471 ACAAGAAAAAGTGATGAGCTGGG - Intergenic
1040486109 8:47873377-47873399 ACATACAAAAAAAATGAGCTGGG + Intronic
1041732773 8:61078966-61078988 ACATTCACAAATGTTGTTCTTGG - Intronic
1042386198 8:68177596-68177618 ACATGGAAAGATGTTGAGTTTGG - Intronic
1042423671 8:68621176-68621198 CCATCCAGAAATGTTGAGCTGGG + Intronic
1042857321 8:73280529-73280551 AAATGCAAAAAAATTTAGCTGGG - Intergenic
1043286703 8:78541086-78541108 AAATGCAGAGATGTTGAGGTTGG - Intronic
1044484727 8:92738462-92738484 AAAAGAAAAAATGTTGAACTGGG - Intergenic
1045192268 8:99894572-99894594 CCATGCAAAGATTTTCAGCTGGG - Intergenic
1045731683 8:105248743-105248765 ACATGCCAAAACCTTGATCTTGG + Intronic
1046101417 8:109618405-109618427 TGATGCAAATATGTAGAGCTGGG - Intronic
1047183933 8:122615021-122615043 ACATGAATGAATGATGAGCTAGG + Intergenic
1050883461 9:10734588-10734610 ACCTGCAAAAATGTTGTCCCTGG - Intergenic
1051819352 9:21146462-21146484 ACATACAAAAATAATTAGCTGGG + Intergenic
1051950241 9:22622140-22622162 AAATCCCAAAATGTTGAGTTAGG - Intergenic
1055334039 9:75213798-75213820 AAATGCACAAGTGTTAAGCTCGG + Intergenic
1058261267 9:102835356-102835378 ACATGAAAAAATGTTGAAATTGG - Intergenic
1058262351 9:102851349-102851371 ACATGCACAAATATTTGGCTTGG - Intergenic
1059447105 9:114345235-114345257 ACATGCAAAAAAAATTAGCTGGG - Intronic
1061240233 9:129366024-129366046 ACAGGCAAAAATCATGAGATGGG + Intergenic
1186745158 X:12560287-12560309 ACATGCAAAAATGAACAGCCAGG + Intronic
1187452368 X:19410326-19410348 ACTTGCAAAAATGTTGGGAGAGG + Intronic
1188640960 X:32504124-32504146 ACATGCAAAAAAGTTTATCTAGG + Intronic
1189051828 X:37653315-37653337 ATATGAATAAATGTTCAGCTGGG + Intronic
1189753907 X:44251438-44251460 AAATGCAAAAAAGTTTAGCCAGG + Intronic
1191789007 X:64948548-64948570 ACATGCATAAATGTTAACCTGGG + Intronic
1193089724 X:77481478-77481500 ACATGCAACAATTCTGAGGTAGG - Intergenic
1193332285 X:80248462-80248484 ACATGCATAAATGTAGATATAGG + Intergenic
1193797856 X:85898351-85898373 ACAGGCAAAAATGTTGCCCTTGG - Intronic
1195208829 X:102630809-102630831 ACCTGCCAAAATCTTGATCTTGG + Intergenic
1195825990 X:109001440-109001462 ACAGGAACAAATGTTGAGGTGGG + Intergenic
1195882105 X:109603305-109603327 TCATGCAAAAATATACAGCTGGG + Intergenic
1196116584 X:112005716-112005738 CCATGCAAAAAGCTTAAGCTGGG + Intronic
1196311849 X:114177243-114177265 ACATGAAAAATAGTTCAGCTGGG - Intergenic
1197061594 X:122187818-122187840 ACACACAAAAATATTGAGCTAGG - Intergenic
1197292692 X:124679040-124679062 AAATGCAAAGATATTCAGCTAGG + Intronic
1198867429 X:141139112-141139134 AGATGCAAGCATTTTGAGCTGGG + Intergenic
1199542816 X:148976371-148976393 ACATGCAAAAATGGTGAAGTTGG - Intronic
1201782551 Y:17739596-17739618 ACATGCACAAATGTTTAGATTGG - Intergenic
1201819002 Y:18166392-18166414 ACATGCACAAATGTTTAGATTGG + Intergenic