ID: 1023248824

View in Genome Browser
Species Human (GRCh38)
Location 7:38235684-38235706
Sequence CCTACCAGGGGCTCTCCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023248824_1023248831 -6 Left 1023248824 7:38235684-38235706 CCATAAGGAGAGCCCCTGGTAGG No data
Right 1023248831 7:38235701-38235723 GGTAGGATGGATAAGGCAGCAGG No data
1023248824_1023248832 15 Left 1023248824 7:38235684-38235706 CCATAAGGAGAGCCCCTGGTAGG No data
Right 1023248832 7:38235722-38235744 GGTCTTAAGTCAGACAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023248824 Original CRISPR CCTACCAGGGGCTCTCCTTA TGG (reversed) Intergenic
No off target data available for this crispr