ID: 1023250795

View in Genome Browser
Species Human (GRCh38)
Location 7:38258836-38258858
Sequence GACCTGCGTTGTTGCAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023250792_1023250795 2 Left 1023250792 7:38258811-38258833 CCATAAGCCAATAAGAGGCAACA No data
Right 1023250795 7:38258836-38258858 GACCTGCGTTGTTGCAGTGATGG No data
1023250794_1023250795 -5 Left 1023250794 7:38258818-38258840 CCAATAAGAGGCAACAAGGACCT No data
Right 1023250795 7:38258836-38258858 GACCTGCGTTGTTGCAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023250795 Original CRISPR GACCTGCGTTGTTGCAGTGA TGG Intergenic
No off target data available for this crispr