ID: 1023253448

View in Genome Browser
Species Human (GRCh38)
Location 7:38290249-38290271
Sequence CTAATTGCTGACACTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023253441_1023253448 30 Left 1023253441 7:38290196-38290218 CCAGATATCCTAATGTTGTAGGA No data
Right 1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG No data
1023253442_1023253448 22 Left 1023253442 7:38290204-38290226 CCTAATGTTGTAGGAAATAGTGT No data
Right 1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG No data
1023253445_1023253448 -10 Left 1023253445 7:38290236-38290258 CCTAATTTGGATCCTAATTGCTG No data
Right 1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG No data
1023253444_1023253448 -9 Left 1023253444 7:38290235-38290257 CCCTAATTTGGATCCTAATTGCT No data
Right 1023253448 7:38290249-38290271 CTAATTGCTGACACTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023253448 Original CRISPR CTAATTGCTGACACTGATAT GGG Intergenic
No off target data available for this crispr