ID: 1023255391

View in Genome Browser
Species Human (GRCh38)
Location 7:38307765-38307787
Sequence TATTTCCTCAGCCTTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023255391_1023255398 14 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255398 7:38307802-38307824 GGAGAAGCTGCACCAGGATGAGG No data
1023255391_1023255397 8 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255397 7:38307796-38307818 GGAGCAGGAGAAGCTGCACCAGG No data
1023255391_1023255400 19 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255400 7:38307807-38307829 AGCTGCACCAGGATGAGGAAGGG No data
1023255391_1023255399 18 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG No data
1023255391_1023255401 20 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255401 7:38307808-38307830 GCTGCACCAGGATGAGGAAGGGG No data
1023255391_1023255395 -7 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255395 7:38307781-38307803 GGAAATAGGGAACCTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023255391 Original CRISPR TATTTCCTCAGCCTTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr