ID: 1023255396

View in Genome Browser
Species Human (GRCh38)
Location 7:38307793-38307815
Sequence GGTGCAGCTTCTCCTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023255396_1023255400 -9 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255400 7:38307807-38307829 AGCTGCACCAGGATGAGGAAGGG No data
1023255396_1023255404 22 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255404 7:38307838-38307860 AAGAGTGTTCACAGAGAAAATGG No data
1023255396_1023255405 23 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255405 7:38307839-38307861 AGAGTGTTCACAGAGAAAATGGG No data
1023255396_1023255399 -10 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG No data
1023255396_1023255401 -8 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255401 7:38307808-38307830 GCTGCACCAGGATGAGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023255396 Original CRISPR GGTGCAGCTTCTCCTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr