ID: 1023255399

View in Genome Browser
Species Human (GRCh38)
Location 7:38307806-38307828
Sequence AAGCTGCACCAGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023255396_1023255399 -10 Left 1023255396 7:38307793-38307815 CCTGGAGCAGGAGAAGCTGCACC No data
Right 1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG No data
1023255391_1023255399 18 Left 1023255391 7:38307765-38307787 CCTGAGACAAGGCTGAGGAAATA No data
Right 1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023255399 Original CRISPR AAGCTGCACCAGGATGAGGA AGG Intergenic
No off target data available for this crispr